Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
|
|
- Randolph Holmes
- 6 years ago
- Views:
Transcription
1 Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A " J.A. 12/11/13
2 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy Theory and Practice 3. Protein NMR & Resonance Assignment 4. NMR Structure Determination & " "Biological NMR Applications "
3 " Lecture #3 Overview" " 1. Protein NMR Structure Determination i. NMR data -> Restraints ii. Structure Calculation & Validation 2. Some Biological NMR Applications i. Residual Dipolar Couplings ii. NMR of large proteins iii. Relaxation and Dynamics
4 Protein NMR Structure Determination" OVERVIEW "" 13 C, 15 N-protein 2D, 3D, 4D NMR Spectral Analysis / Assignment Structure Calculation / Refinement
5 Protein NMR Structure Determination" THE LEVELS OF PROTEIN STRUCTURE "" 1 o" 2 o" 3 o" 4 o"
6 Protein NMR Structure Determination" Experimental NMR Constraints" "NMR ensemble " Distance - NOE - H-bonds Dihedral Angle - 13 C δ - J-couplings Orientational - RDCs Other - PRE/PCS Structure" Program" CYANA XPLOR UNIO ARIA CNS AMBER Rosetta
7 NMR Observable: NOE (d) - a through space correlation (<5 Å) distance restraint Coupling Constant (J) - through bond correlation dihedral angle restraint 1 H- 1 H NOE 4.1Å 2.9Å 3 J HNHα NH Hα Chemical Shift (δ) - very sensitive to local changes in environment dihedral angle restraint Residual Dipolar Coupling Constant (D) - X-Y bond vector orientation in weak alignment medium orientational restraint Hα D XY NH
8 I. Distance Restraints: 1 H- 1 H NOEs" Nuclear Overhauser Effect: change is intensity of 1 NMR signal is " another is irradiated" NOE depends on motion" Through-space dipole-dipole interaction" η" η i = (I-I o )/I o { 1 H}- 15 N NOE 2D noe 1 6 r ab 3Dʼs Estrada et al (2011)
9 I. Distance Restraints: 1 H- 1 H NOEs" through-space < 5Å" noe " 1 r ab 6 H N d αn O N A A 2 d αα Hα H N d NN O N d Nβ, d Nγ, A A 1 Hα H O A A 3 Hα H d αβ, d αγ, d αα i+4 d αβ(i, i+3) d αn(i, i+3) d NN(i, i+3) d αn (i, i+4) i-1 i i+3 i+2 i+1 C C N N d α(i)n(j) N N C C
10 I. Distance Restraints: 1 H- 1 H NOEs" Nomenclature Distances & 2 0 structure K. Wüthrich (1986) NOE patterns & 2 0 structure <5Å weak <4Å medium <2.5Å strong 3 J HNHα
11 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure i. α-helix H-bond " Diagnostics: 3D 15 N-NOESY 3D HNHA" - big sequential H N -H N NOEs" small 3 J HNHα " - H α -H N (i,i+2), (i,i+3), (i,i+4) " d NN" α-helix
12 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure ii. β-strands β-strands antiparallel parallel Diagnostics: 3D 15 N-NOESY 3D 13 C-NOESY 3D HNHA" - big sequential H α -H N NOEs" big cross-strand large 3 J HNHα " " " " " " H α -H α NOEs"
13 I. Distance Restraints: 1 H- 1 H NOEs" 1 H- 1 H Distances & 2 0 structure iii. β-turns β-turns Diagnostics: 3D 15 N-NOESY 3D HNHA" - specific sequential " " " specific 3 J HNHα " H N -H N and H α -H N NOEs " " pattern"
14 II. Dihedral Angle Restraints:" Protein chemical shifts depend on fold" " " Unfolded " " " " "" " " random " coil " " " " "" " " δ s Folded " " " " " "Local Environment" " " " " " "Secondary Structure"
15 II. Dihedral Angle Restraints:" 3 J HNHα & backbone dihedral angles" " " " " H " " " " "" α " 3 " " " " "" J HNHα " " " " " "" H N" 3D HNHA" β- ~8-10 Hz " J(φ-60) = 6.51cos 2 (φ-60) cos(φ-60) α ~3-4 Hz " Vuister & Bax (1993) J. Am. Chem. Soc. 115, 7772
16 II. Dihedral Angle Restraints:" Chemical shifts & backbone dihedral angles" IFNγ " Cα and Cβ CSI " " " " " +1, 0, -1 vs. random coil δ ± range α-helix: ΔCα ~ +3 ppm ΔCβ ~ -1 ppm β-strand: ΔCα ~ -2 ppm ΔCβ ~ +3 ppm Spera & Bax (1991) J. Am. Chem. Soc. 113, 5490 Wishart & Sykes (1994) J. Biomol. NMR 4, 171
17 II. Dihedral Angle Restraints:" TALOS+: Φ,ψ restraints from δʼs "" Φ,ψ space using δʼs, residue type, neighbors " L8" INPUT: 13 C α, 13 C β, 13 C, 1 H α, 1 H N, 15 N "" OUTPUT: Φ,ψ; +/-; S 2 " Ex. Ubq" S 2 " Shen et al (2009) J. Biomol. NMR 44, 213 CSI "
18 Structure Determination:" Manual" Automated: CYANA, AutoStructure, ARIA, UNIO,." "Input Files: assignments (δʼs), NOE spectral peak lists" " " TALOS+ Φ/ψ, stereospecific assignments" " " (Other: H-bonds, Jʼs, RDCs, etc.)" " " " " " "" FGF-2 Montelione et al (2000) Nat Struct Mol Biol 7, 982
19 Iterative NMR Structure Refinement:" " " " " " "" Convergence" Constraints Convergence"
20 Structure Quality & Validation: Many Programs & Metrics " "" NMR Assignment & Restraint Stats Restraint Violations RMSD stats Rama- Global NOE chandran Quality Agreement
21 III. Residual Dipolar Couplings:" Global structural restraints" Weak alignment" "" RDC (D in Hz)" Dipole-Dipole Interaction"
22 III. Residual Dipolar Couplings:" Many alignment methods" i. Bicelles" " ii. Filamentous phage" iii. PAGE" Measure " ΔJ free aligned J NH J NH + D NH
23 III. Residual Dipolar Couplings:" RDC Theory" " 1 H" 15 N"
24 III. Residual Dipolar Couplings: Applications" Global Structural Information " " Structure Refinement" Helical Curvature Angle between 2 o Structural Elements IgG-binding domain of protein A no RDC" + RDC" Relative Orientation of Domains no RDC" + RDC" Zheng et al (2004) Protein Sci. 13, 549
25 NMR of Large Proteins / Complexes" Techniques for raising the MW Limit in Biomolecular NMR" TROSY TRansverse Optimized Deuteration/Selective Protonation SpectroscopY [ 2 H, 13 C, 15 N, 1 H-Ile-δ1,Leu-δ,Val-γ] Pervushin et al (1997) PNAS 94, select narrow " sub-peak" Goto et al (1999) J Biol NMR 13, CAP Tzeng & Kalodimos (2012) Nature 488, 236
26 NMR Relaxation and Dynamics" Insights into a broad range of molecular motions" Boehr et al. (2006)
27 NMR Relaxation Analysis of Proteins" T 1, T 2, CPMG relaxation dispersion experiments T 1 inversion recovery T 2 CPMG CPMG relaxation dispersion I(τ) = I(0) (1 2e -τ/t 1) [ ] n I(T) = I(0) e -T/T 2 Baldwin & Kay (2009)
28 NMR Relaxation Analysis of Proteins" ns motion " " "ns - μs - ms motion" " Backbone Dynamics Conformational Entropy & Molecular Recognition Oligomerization State 13 CH 3 Relaxation Aramini et al (2010 & 2011) Tzeng & Kalodimos (2012) Nature 488, 236
29 THANK YOU" &" GOOD LUCK"
PROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationSupporting Information
Supporting Information German Edition: DOI: Sampling of Glycan-Bound Conformers by the Anti-HIV Lectin Oscillatoria agardhii agglutinin in the Absence of Sugar** Marta G. Carneiro, Leonardus M. I. Koharudin,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationA topology-constrained distance network algorithm for protein structure determination from NOESY data
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationIntroduction to biomolecular NMR spectroscopy
Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationMillisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev
Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR Dmitry M. Korzhnev Department of Molecular, Microbial and Structural Biology University of Connecticut Health Center 263 Farmington
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationStructure determination
Structure determination NMR Structural Constraints 1. Internuclear distances (Nuclear Overhauser Effect) NOE R -6 2. Dihedral angles (J-coupling): 3 J NHα = 6.4 cos 2 (Φ -60) 1.4cos(Φ -60) + 1.9 3. C hem
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationWhere do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07
Where do we stand on Projection NMR Spectroscopy? Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationModel-Free Approach to Internal Motions in Proteins
Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationNuclear Magnetic Resonance
Nuclear Magnetic Resonance Lectures for CCB 538 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu J.A.! 04/21/14! April 21!!!!April 23!! April 28! Outline 1. Introduction / Spectroscopy Overview! 2. NMR
More informationOrigin of Scalar Couplings BCMB/CHEM 8190
Origin of Scalar Couplings BCMB/CHEM 8190 Traditional View of Scalar Coupling Splitting of NMR signals due to through-bond interactions between nuclei is called scalar coupling (or J coupling or through-bond
More informationProtein NMR spectroscopy
Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationChemical Shift Restraints Tools and Methods. Andrea Cavalli
Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods
More informationChittaranjan Tripathy 1, Anthony K. Yan 1,2, Pei Zhou 2, and Bruce Randall Donald 1,2,
Extracting Structural Information from Residual Chemical Shift Anisotropy: Analytic Solutions for Peptide Plane Orientations and Applications to Determine Protein Structure Chittaranjan Tripathy 1, Anthony
More informationSUPPLEMENTARY ONLINE DATA
SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationOrigin of Chemical Shifts BCMB/CHEM 8190
Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π The Larmor frequencies of nuclei depend on the electronic structure of the molecule and the
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationStructure determination through NMR
Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationQuantification of Dynamics in the Solid-State
Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid
More informationPhotochemical and Structural Studies on Cyclic Peptide Models
Article Photochemical and Structural Studies on Cyclic Peptide Models Tamás Milán Nagy 1, Krisztina Knapp 2, Eszter Illyés 3, István Timári 1, Gitta Schlosser 4, Gabriella Csík 5, Attila Borics 6, *, Zsuzsa
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationSlow symmetric exchange
Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks
More informationNMR BMB 173 Lecture 16, February
NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationApplication of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor
Journal of Biomolecular NMR, 5: 0, 999. KLUWER/ESCOM 999 Kluwer Academic Publishers. Printed in the Netherlands. 0 Application of automated NOE assignment to three-dimensional structure refinement of a
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationPDB Composition (2003)
Biomolecular NMR Dr. Kiattawee hoowongkomon Dept. of Biochemistry Faculty of Science Kasetsart University Email: fsciktc@ku.ac.th Phone: 02-9428281 ext. 121 PDB omposition (2003) Proteins Protein/DNA complexes
More informationSolution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,
026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,
More informationFast High-Resolution Protein Structure Determination by Using Unassigned NMR Data**
NMR Spectroscopic Methods DOI: 10.1002/anie.200603213 Fast High-Resolution Protein Structure Determination by Using Unassigned NMR Data** Jegannath Korukottu, Monika Bayrhuber, Pierre Montaville, Vinesh
More informationJulia Audrey Barette. Copyright by Julia Audrey Barette, 2011
Cross Validation of the Structure of a Transiently Formed and Low Populated FF Domain Folding Intermediate Determined by Relaxation Dispersion NMR and CS- Rosetta by Julia Audrey Barette A thesis submitted
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.
More informationInterleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts
202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,
More informationSupplementary Figures:
Supplementary Figures: Supplementary Figure 1: The two strings converge to two qualitatively different pathways. A) Models of active (red) and inactive (blue) states used as end points for the string calculations
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationStructural Basis of Multivalent Binding to Wheat Germ Agglutinin
Structural Basis of Multivalent Binding to Wheat Germ Agglutinin David Schwefel, Caroline Maierhofer, Johannes G. Beck, Sonja Seeberger, Kay Diederichs, Heiko M. Möller,*, Wolfram Welte,*, and Valentin
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationNMR Spectroscopy of Polymers
UNESCO/IUPAC Course 2005/2006 Jiri Brus NMR Spectroscopy of Polymers Brus J 1. part At the very beginning the phenomenon of nuclear spin resonance was studied predominantly by physicists and the application
More informationStudy of conformational rearrangement and refinement of structural homology models by the use of heteronuclear dipolar couplings
Journal of Biomolecular NMR, 18: 217 227, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 217 Study of conformational rearrangement and refinement of structural homology
More informationIntroduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations
Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field
More informationSecondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure
Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted
More informationOrigin of Chemical Shifts BCMB/CHEM 8190
Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π σ i, shielding constant dependent on electronic structure, is ~ 10-6. Measurements are made
More informationConnecting NMR data to biomolecular structure and dynamics
Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationThe Physical Basis of the NMR Experiment
The Physical Basis of the NMR Experiment 1 Interaction of Materials with Magnetic Fields F F S N S N Paramagnetism Diamagnetism 2 Microscopic View: Single Spins an electron has mass and charge in addition
More informationHADDOCK: High Ambiguity
Determination of Protein-Protein complexes HADDOCK: High Ambiguity Driven DOCKing A protein-protein docking approach based on biochemical and/or biophysical data In PDB: >15000 protein structures but
More informationBCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE
BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications
More informationSolid-State NMR Structural Studies of Proteins Using Paramagnetic Probes
Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes Christopher Jaroniec Department of Chemistry & Biochemistry The Ohio State University Protein Structure by MAS Solid-State NMR D
More informationIntermediates Detection and Hydrogen Exchange
Intermediates Detection and Hydrogen Exchange NMR methods for detecting intermediates and excited states Amide exchange Methods for detecting Amide Exchange Application of Amide Exchange to proteins NMR
More informationIntroduction to Relaxation Theory James Keeler
EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives
More informationSupplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus
Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationPeptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526
Peptide/Protein Structure Determination Using NMR Restraints and CYANA CHEM526 Watson and Crick DNA Model Given what was known about molecular geometry, hydrogen bonding etc Watson and Crick could build
More information