Time-course responses of ileal and fecal microbiota and metabolite profiles to. antibiotics in cannulated pigs

Transcription

1 Applied Microbiology and Biotechnology Time-course responses of ileal and fecal microbiota and metabolite profiles to antibiotics in cannulated pigs Kan Gao 1, Yu Pi 1, Yu Peng, Chun-Long Mu, Wei-Yun Zhu * Laboratory of Gastrointestinal Microbiology, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu , P. R. China 1 First Author: Kan Gao Address: kevingogh911@hotmail.com Yu Pi Address: @njau.edu.cn These authors contributed equally to this work. *Corresponding Author: Professor: Weiyun Zhu Telephone/Max: Address: zhuweiyun@njau.edu.cn

2 Fig. S1. Sample collection timeline during the experiment.

3 Fig. S2. The average daily feed intake (A) and daily body weight gain (B) of piglets during the entire experiment.

4 Fig. S3. Summary of rarefaction results of microbiota in ileal digesta (A) and feces (B) based on operational taxonomic unit (OTUs) (3% divergence).

5 Fig. S4. The co-occurrence analysis of some important commensal genera in the ileal digesta and in the feces. The size of each dot was in accordance with its relative abundance. Blue line means significantly positive correlation (P <0.05, coefficient r >0.8).

6 Table S1. Dietary composition and nutrient levels (air dry basis). Items Composition, % Corn Soybean meal Fish meal 1.00 Limestone 0.72 Calcium hydrophosphate 1.10 Soy protein concentrate 2.00 Soybean oil 2.00 Salt 0.30 Choline chloride 0.10 Fine rice bran 2.32 L-Lys, 98.5% 0.54 DL-Met, 99% 0.23 L-Thr, 98.5% 0.21 L-Trp, 98% 0.05 L-Val, 98.5% 0.10 L-Ile, 99% 0.06 L-Leu, 99% 0.13 L-Phe, 99% 0.09 L-His, 99% 0.07 Chromium oxide 0.30 Premix a 1.00 Nutrient levels, % Net energy b, kcal/kg CP EE 4.81 ADF 4.60 NDF Ash 4.83 Ca 0.63 P 0.53 AA composition, % (DM basis) TLys 1.25 TMet 0.49 TThr 0.82 TTrp 0.24 TVal 0.89 TIle 0.71 TLeu 1.58 TPhe 0.92 THis 0.49 TArg 1.12 TTyr 0.58

7 TCys 0.26 Met+Cys 0.74 a Supplied the following per kg of diet: 8,000 IU, vitamin A; 2400 IU, vitamin D3; 20 mg, vitamin E; 15 mg, pantothenic acid; 5 mg, vitamin B6; 0.3 mg, biotin; 3 mg, folic acid; 0.03 mg, vitamin B12; 40 mg, ascorbic acid; 120 mg, Fe; 25 mg, Cu; 20 mg, Mn; 150 mg, Zn; 0.5 mg, I; 0.30 mg, Se. b Values for net energy were calculated, the contents of ether extract, crude protein, acid-detergent fibre, neutral-detergent fiber, ash, Ca, and P were analyzed. DM, dry matter; T, Total; AA, amino acid.

8 Table S2. List of primers used in this study. qpcr bacterial group Forward primer (5'-3') Reverse primer (5'-3') Reference Annealing temp.( C) Total bacteria GTGSTGCAYGGYYGTCGTCA ACGTCRTCCMCNCCTTCCTC [1] 60 Firmicutes GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC [2] 60 Bifidobacterium TCGCGTCYGGTGTGAAAG GGTGTTCTTCCCGATATCTACA [3] 60 Escherichia coli CATGCCGCGTGTATGAAGAA CGGGTAACGTCAATGAGCAAA [4] 60 Lactobacillus AGCAGTAGGGAATCTTCCA ATTCCACCGCTACACATG [5] 60 Ruminococcus GAAAGCGTGGGGAGCAAACAGG GACGACAACCATGCACCACCTG [6] 60 Roseburia GCGGTRCGGCAAGTCTGA CCTCCGACACTCTAGTMCGAC [7] 60 [1] Suzuki MT, Taylor LT, DeLong EF. Quantitative analysis of small-subunit rrna genes in mixed microbial populations via 5'-nuclease assays[j]. Appl Environ Microbiol, 2000, 66: [2] Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs[j]. Lett Appl Microbiol, 2008, 47: [3] Walker AW, Ince J, Duncan SH. Dominant and diet-responsive groups of bacteria within the human colonic microbiota[j]. ISME J, 2011, 5: [4] Huijsdens XW, Linskens RK, Mak M, Meuwissen SG, Vandenbroucke-Grauls CM, Savelkoul PH. Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR[J]. J Clin Microbiol, 2002, 40: [5] Lan Y, Xun S, Tamminga S, et al. Real-time PCR detection of lactic acid bacteria in cecal contents of eimeria tenella-lnfected broilers fed soybean oligosaccharides and soluble soybean polysaccharides.[j]. Poultry Science, 2004, 83(10): [6] Verma R, Verma A K, Ahuja V, et al. Real-time analysis of mucosal flora in patients with inflammatory bowel disease in India.[J]. Journal of Clinical Microbiology, 2010, 48(11): [7] Walker A W, Duncan S H, Leitch E C M W, et al. ph and peptide supply can radically alter bacterial populations and short-chain fatty acid ratios within microbial communities from the human colon[j]. Applied and Environmental Microbiology, 2005, 71(7):

9 Table S3. α diversity analysis of the time course responses of ileal and fecal microbiota toward the antibiotics. Items 1 day -4 day 2 day 7 day 13 P value 2 Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics day -4 day 2 day 7 day 13 Ileal digesta Coverage Ace Shannon Shannoneven Chao Inverse Simpson Feces Coverage Ace Shannon Shannoneven Chao Inverse Simpson Data was presented as medians, with 6 replicates per group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. A P value <0.05 was regarded as statistically significant. 3 Ace, abundance-based coverage estimator.

10 Bacteria 1 at genus level Table S4. Significantly changed ileal and fecal bacteria at genus level induced by the antibiotics. day -4 day 2 day 7 day 13 actual P value 2 adjusted P value 3 C A C A C A C A day -4 day 2 day 7 day 13 day -4 day 2 day 7 day 13 Ileal digesta Lactobacillus Bifidobacterium Clostridium Megasphaera Peptostreptococcus <0.001 < Escherichia/Shigella Enterococcus Klebsiella <0.001 < Proteus Feces Lactobacillus Bifidobacterium < Blautia Clostridium < Coprococcus Lachnospira < Megasphaera Roseburia Ruminococcus

11 Escherichia/Shigella Klebsiella Sutterella Bacteroides Prevotella Data was presented as medians, with 6 replicates per group. C, control group; A, antibiotic group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. 3 Actual P value was adjusted with false discovery rate correction. An adjusted P value <0.05 was regarded as statistically significant.

12 OTUs 1 Ileal Digesta OTU21 OTU257 OTU70 OTU108 Nearest neighboring bacteria Table S5. Significantly changed ileal and fecal bacteria at OTU level induced by the antibiotics. day -4 day 2 day 7 day 13 actual P value 2 adjusted P value 3 (similarity) C A C A C A C A day -4 day 2 day 7 day 13 day -4 day 2 day 7 day 13 Lactobacillus salivarius Lactobacillus reuteri Lactobacillus mucosae Lactobacillus delbrueckii OTU136 Megasphaera sp.(96%) OTU126 Clostridiaceae sp.(96%) OTU135 OTU205 OTU161 Peptostreptococcus stomatis Mitsuokella multacida Bifidobacterium thermacidophilum < OTU25 Escherichia coli OTU238 OTU204 Enterococcus faecium Klebsiella pneumoniae <0.001 <

13 OTU151 Proteus mirabilis Feces Lactobacillus delbrueckii OTU OTU30 Lactobacillus agilis OTU128 Lactobacillus amylovorus OTU207 Clostridium sp. (96%) <0.001 < OTU706 Coprococcus catus OTU107 0 OTU713 OTU107 9 Lachnospira pectinoschiza (98%) Ruminococcus gnavus Ruminococcus bromii < < OTU802 Blautia producta OTU991 Roseburia faecis OTU592 Bifidobacterium thermacidophilum OTU407 Escherichia coli OTU118 6 OTU106 3 Sutterella stercoricanis Klebsiella pneumoniae OTU826 Prevotella copri

14 OTU664 Bacteroides xylanisolvens Data was presented as medians, with 6 replicates per group. C, control group; A, antibiotic group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. 3 Actual P value was adjusted with false discovery rate correction. An adjusted P value <0.05 was regarded as statistically significant.

15 Table S6. Time-course responses of key bacterial groups of pigs (n=8) toward the oral antibiotics. Items (log 10 ) 1 day -4 day 2 day 7 day 13 P value 2 SEM Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics A T A T Ileal digesta Total bacteria a 9.99 a 9.94 a 8.94 b a 8.82 b 9.76 a 8.64 b Firmicutes 9.43 a 9.52 a 9.13 a 7.83 b 9.28 a 8.04 b 8.99 a 7.60 b Bifidobacterium 5.49 a 5.25 a 5.71 a 4.28 b 5.61 a 4.90 b 5.75 a 4.47 b 0.14 < Lactobacillus 8.24 a 8.26 a 8.46 a 7.50 b 8.35 a 5.59 b 8.32 a 7.40 b 0.22 < Escherichia coli 6.17 a 5.98 a 6.36 b 7.70 a 6.82 b 7.45 a 5.98 b 7.68 a Feces Total bacteria a a a a a b a b Firmicutes 9.39 a 9.39 a 9.75 a 9.56 a 9.66 a 8.72 b 9.06 a 8.11 b Ruminococcus 7.04 a 7.20 a 7.69 a 6.82 b 7.33 a 5.90 b 7.81 a 6.19 b Bifidobacterium 5.44 a 5.45 a 4.88 a 5.02 a 5.25 a 4.32 b 5.25 a 4.51 b Roseburia 5.06 a 5.13 a 5.15 a 5.27 a 5.31 a 4.65 b 5.29 a 4.60 b Lactobacillus 7.93 a 8.20 a 8.73 a 8.56 a 8.02 a 5.33 b 8.00 a 6.13 b Escherichia coli 7.71 a 7.62 a 5.96 a 5.31 a 7.51 b 8.03 a 5.75 b 7.45 a The data followed a normal distribution examined by the Kolmogorov Smirnov test, and presented as means with standard error of the mean (SEM). 2 The data were analyzed using repeated measures analysis with baseline data as covariates. The Student s t test was used to compare difference between groups at a given time point. A P value <0.05 was regarded as statistically significant. A, Antibiotics; T, Time. a, b Means at each day with different superscripts differ (P <0.05).

16 Table S7. Concentrations of metabolic profiles in ileal digesta and feces during the experiment. Items 1 day -4 day 2 day 7 day 13 P value 2 SEM Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics A T A T SCFAs μmol/g Ileal Digesta Acetate 7.21 a 6.50 a a 4.32 b a 6.44 b a 7.34 b 0.98 <0.001 <0.001 <0.001 Propionate 1.71 a 1.63 a 1.34 a 1.11 a 2.01 a 0.71 b 2.33 a 0.93 b 0.67 < Butyrate 0.46 a 0.38 a 0.31 a 0.37 a 1.17 a 0.36 b 0.90 a 0.42 b 0.05 < <0.001 Total SCFA a 9.32 a a 6.47 b a 8.33 b a 9.54 b 1.36 < Feces Acetate a a a a a b a a < Propionate a a a a a a a a Butyrate 4.24 a 3.76 a a 7.49 b a 4.42 b a 8.14 b 0.83 <0.001 < Total SCFA a a a b a b a a Amines μmol/g Ileal Digesta Putrescine 1.99 a 1.60 a 2.25 b 3.41 a 2.72 a 2.70 a 1.23 a 1.25 a < Cadaverine 4.71 a 5.13 a 4.20 b a 3.15 b a 4.71 b a 2.40 <0.001 <0.001 <0.001 Spermidine 2.15 a 2.79 a 1.48 b 3.16 a 0.47 a 0.42 a 0.39 a 0.39 a < Total amines 9.96 a a 8.12 b a 6.48 b a 6.54 b a 2.58 <0.001 <0.001 <0.001 Feces Putrescine 3.18 a 3.95 a 4.72 a 3.84 a 3.66 b a 2.77 b a 3.21 < <0.001 Cadaverine 8.00 a 6.67 a 5.34 a 5.94 a 2.84 b a 9.30 b a 4.66 <

17 Spermidine 4.12 a 4.65 a 6.41 a 6.99 a 2.99 b 8.12 a 2.96 b a 0.54 < Total amines a a a a b a b a 8.70 <0.001 <0.001 <0.001 Lactate μmol/g Ileal lactate a a a b a 3.50 b a 2.59 b 2.02 <0.001 <0.001 <0.001 Fecal lactate 0.40 a 0.32 a 0.57 a 0.44 a 0.57 b 3.68 a 1.28 b 3.59 a 0.27 <0.001 <0.001 <0.001 Indole μg/g Fecal indole 4.36 a 4.17 a 8.61 a 7.09 a 6.97 b a 7.42 b a Data followed a normal distribution examined by the Kolmogorov Smirnov test, and presented as means with SEM (n=8). 2 The data were analyzed using repeated measures analysis with baseline data as covariates. The Student s t test was applied to compare difference between groups at a given time point. A P value <0.05 was regarded as statistically significant. A, Antibiotics; T, Time. a, b Means at each day with different superscripts differ (P <0.05).