Gerd Krause, Structural bioinformatics and protein design Leibniz-Institute of molecular Pharmacology
|
|
|
- Roy Powers
- 6 years ago
- Views:
Transcription
1 Basics of Molecular modelling _2 History, Interdisciplinary classification, Goals, Model definition, Molecular mechanics forcefields, Energy minimization algorithms Molecular dynamics simulation Comparative modelling (homology modelling) Simulated annealing Scanning conformational space of a molecule Molecular properties as recognition patterns Gerd Krause, Structural bioinformatics and protein design Leibniz-Institute of molecular Pharmacology Molecular dynamic simulations -enables characterizing of molecule properties and movement over a time scale 1
2 tasks for molecular dynamic Simulations - Evaluation of geometric stability larger molecular structures (Protein (Homology models) - conformational change of molecules at room temperature - since all biological processes are running at 310 Kelvin, ( but potential energy of force field are calculated at 0 K!!) - considering of kinetic energy. - geting over the problem of multiminima of proteins (Simulated Annealing) - study of structural and thermal energies - study of functional properties of fast biological processes( sec) F = m a 2
3 Newtons equation is used to simulate atom movement force At each atom calculated from energy change between current position and a position in a small distance Energy caculation from molecular mechanics F = m a By means of Atom forces and masses are positions of each atom calculated along a series of extreme short time steps (femto Second=10 15 Second). Resulting snapshots of structural changes: Trajectory 3
4 Trajectory Subdivide between two states into large number of sub-states By extreme small time steps ( 1 femto Seconds) Initiale Atom position at time t is used predicting Atom positions at time t + delta t Atom position at time t + delta t is used predicting atom position at tie t + 2 delta t etc. Dynamic Trajectory: - resting at start point a -> after initial movement going with constant total energy (kinetic E. + potential E.), - initialer Gradient pulls Particle in the valley - portion of accelaration inceases in direction of d (potential Energy decreases) - kinetic energy moves particle forth and back, therfore running through many points at the surface (b, c) 4
5 Phases of MD E pot 1. Start structure: conformation of low energy time 2. Initial movement assigned to all atoms, is dictated by choosen temperature 3. Equilibration phase: slow heating e.g. from 0K to 310 K Energy compensation between the atoms 4. Data production phase: Trajektory e. g. at constant temperature. Randbedingungen der MD - Statistische Ensembles - Periodic boundary conditions - Explicit image model - Nonbond cutoff Statistic Ensembles N: number Particles V: Volumen T: Temperature E: Energy P: pressure Canonical : constant NVT Temp-Bath coupling Vacuo without periodic conditions Micro-canonical: : constant NVE Energy-coupling surface const. Energy Isothermal-isobaric : constant NPT constant pressure and temp 5
6 Randbedingungen der MD Periodic boundary conditions Docking strategy constrained experimentally determined contact points (mutants) MD supported docking of peptide ligand ET1 ET A RECEPTOR J. Lättig 6
7 MD water channel Aquaporin de Groot B, Grubmüller H, Science 2001 de Groot B, Grubmüller H, Science
8 Molecular modelling _2 History, Interdisciplinary classification, Goals, Model definition, Molecualr mechanics forcefields, Energy minimization algorithms Molecular dynamics simulation Comparative modelling (homology modelling) Application of Protein Structure Models Depending much on accuracy and reliability of the model: Studying catalytic mechanism Designing and improving ligands Docking of macromolecules Prediction of interacting protein partners Virtual screening of small ligands Defining antibody epitopes Designing chimeras, stable and crystallizable variants Supporting site-directed mutagenesis Refining NMR structures Fitting proteins into low-resolution electron density maps Functional site identification by 3D Motif searching Fold assignment => annotating function & establishing evol. Relationships Facilitate prediction of genes e.g. Drosophila In In principle: principle: every every application application for for structures structures 8
9 Comparative modelling structural bioinformatics Comparative modeling Target sequence Homologous Proteine(s) Alignment Model building Refinement Model evaluation 9
10 Comparative Modeling qerry: protein, domain, motif homolog protein domain motif Similar/common Sequence function Sequence -> fold -> function Sequence fold -> function fold function qerry homolog Application of Protein Structure Models -Studying catalytic mechanism activation mechanism -Designing and improove ligands -Docking of macromolecules Prediction of protein partners -Virtual screening and docking of small molecules -Defining antibody epitopes -Support site directed mutagenesis -Refining NMR structures -Structures from sparse experimental restraints -Functional relationships from structural similarity -Finding functional sites by 3D motif searches 10
11 A Jaeschke et al. JBC 2006 B TMH3 TMH4 ECL2 htshr 3.32 TVFASELSV ALLP ISSYAKVSICLPMD 573 hlhcgr 3.32 TVFASELSV ALLP VSNYMKVSICFPMD 518 TMH5 TMH6 TMH7 htshr 5.34 PLALAYIVFVLTLN MAPISFYALSAI VLFY 7.42 hlhcgr 5.34 TLSQVYILTILILN MAPISFFAISAA VLFY
12 Comparative Modelling Progamm PROCHECK phi / psi Winkel-Bereiche typischer Sekundärstrukturelemente Aminosäuren Zu überprüfende Backbone Struktur Molecular modelling _2 History, Interdisciplinary classification, Goals, Model definition, Molecualr mechanics forcefields, Energy minimization algorithms Molecular dynamics simulation Comparative modelling (homology modelling) Simulated annealing 12
13 NMR spectroscopy Simulated annealing n x ( Aufheizen + Abkühlung) Überwindung Energiebarrieren Wirkung des Kraftfeldes + experimentelle Restraints Temp (Standardgeometrien) (zb. NOE Abstands-Bereich) Zeit Datensammlung (n Konformationen) Satz von n Konformationen eine Konformationsfamilie NMR spectroscopy Austausch der Magnetisierungszustände führt zu exp. Atomabständen zb. Nuclear Overhauser Effects (NOE) (blau gestrichelt) werden als restraints benutzt 13
14 NMR spectroscopy Konformationsensemble nach Simmulated Annealing Cα Atom trace Protein-protein interaction profiles of PDZ domain and C-terminal peptides of proteins lead to patterns for preferred docking poses of small molecules into binding pocket Figure 2. a) Surface representation of the AF6 PDZ domain without ligand, 1XZ9. Surface coloring indicates hydrophobic (yellow) and hydrophilic (green) areas. b) AF6 PDZ domain in complex with 5 f. Surface coloring indicates hydrophobic (yellow) and hydrophilic (green) areas. The hydrogen bonding interaction between the PDZ domain and 5 f are shown as yellow-dotted lines. c) Schematic representation of the AF6 PDZ-5 f interaction. Hydrogen bonds are shown as green-dotted lines. Hydrophobic interactions are highlighted by red line fences. Joshi et al Angew. Chemie Intern. Ed 14
Molecular Dynamics, Monte Carlo and Docking. Lecture 21. Introduction to Bioinformatics MNW2
Molecular Dynamics, Monte Carlo and Docking Lecture 21 Introduction to Bioinformatics MNW2 Allowed phi-psi angles Red areas are preferred, yellow areas are allowed, and white is avoided 2.3a Hamiltonian
I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
Molecular Dynamics, Monte Carlo and Docking. Lecture 21. Introduction to Bioinformatics MNW2
Molecular Dynamics, Monte Carlo and Docking Lecture 21 Introduction to Bioinformatics MNW2 If you throw up a stone, it is Physics. If you throw up a stone, it is Physics. If it lands on your head, it is
Today s lecture. Molecular Mechanics and docking. Lecture 22. Introduction to Bioinformatics Docking - ZDOCK. Protein-protein docking
C N F O N G A V B O N F O M A C S V U Molecular Mechanics and docking Lecture 22 ntroduction to Bioinformatics 2007 oday s lecture 1. Protein interaction and docking a) Zdock method 2. Molecular motion
SAM Teacher s Guide Protein Partnering and Function
SAM Teacher s Guide Protein Partnering and Function Overview Students explore protein molecules physical and chemical characteristics and learn that these unique characteristics enable other molecules
In silico pharmacology for drug discovery
In silico pharmacology for drug discovery In silico drug design In silico methods can contribute to drug targets identification through application of bionformatics tools. Currently, the application of
Modeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
Principles of Physical Biochemistry
Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles
Visualization of Macromolecular Structures
Visualization of Macromolecular Structures Present by: Qihang Li orig. author: O Donoghue, et al. Structural biology is rapidly accumulating a wealth of detailed information. Over 60,000 high-resolution
STRUCTURAL BIOINFORMATICS II. Spring 2018
STRUCTURAL BIOINFORMATICS II Spring 2018 Syllabus Course Number - Classification: Chemistry 5412 Class Schedule: Monday 5:30-7:50 PM, SERC Room 456 (4 th floor) Instructors: Ronald Levy, SERC 718 (ronlevy@temple.edu)
Molecular Interactions F14NMI. Lecture 4: worked answers to practice questions
Molecular Interactions F14NMI Lecture 4: worked answers to practice questions http://comp.chem.nottingham.ac.uk/teaching/f14nmi jonathan.hirst@nottingham.ac.uk (1) (a) Describe the Monte Carlo algorithm
Why Proteins Fold? (Parts of this presentation are based on work of Ashok Kolaskar) CS490B: Introduction to Bioinformatics Mar.
Why Proteins Fold? (Parts of this presentation are based on work of Ashok Kolaskar) CS490B: Introduction to Bioinformatics Mar. 25, 2002 Molecular Dynamics: Introduction At physiological conditions, the
Experimentally solving protein structures, protein-protein interactions and simulating protein dynamics. Lecture 15
Experimentally solving protein structures, protein-protein interactions and simulating protein dynamics C E N T R F O R I N T B I O I N F E Lecture 15 Introduction to Bioinformatics 2007 E G R A T I V
Introduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
DISCRETE TUTORIAL. Agustí Emperador. Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING:
DISCRETE TUTORIAL Agustí Emperador Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING: STRUCTURAL REFINEMENT OF DOCKING CONFORMATIONS Emperador
Medical Research, Medicinal Chemistry, University of Leuven, Leuven, Belgium.
Supporting Information Towards peptide vaccines against Zika virus: Immunoinformatics combined with molecular dynamics simulations to predict antigenic epitopes of Zika viral proteins Muhammad Usman Mirza
Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769
Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral
Introduction to Computational Structural Biology
Introduction to Computational Structural Biology Part I 1. Introduction The disciplinary character of Computational Structural Biology The mathematical background required and the topics covered Bibliography
Molecular dynamics simulation of Aquaporin-1. 4 nm
Molecular dynamics simulation of Aquaporin-1 4 nm Molecular Dynamics Simulations Schrödinger equation i~@ t (r, R) =H (r, R) Born-Oppenheimer approximation H e e(r; R) =E e (R) e(r; R) Nucleic motion described
Protein Structure Analysis
BINF 731 Protein Modeling Methods Protein Structure Analysis Iosif Vaisman Ab initio methods: solution of a protein folding problem search in conformational space Energy-based methods: energy minimization
Protein Structure Analysis
BINF 731 Protein Modeling Methods Protein Structure Analysis Iosif Vaisman Ab initio methods: solution of a protein folding problem search in conformational space Energy-based methods: energy minimization
Structural Bioinformatics (C3210) Molecular Docking
Structural Bioinformatics (C3210) Molecular Docking Molecular Recognition, Molecular Docking Molecular recognition is the ability of biomolecules to recognize other biomolecules and selectively interact
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
Computational Analysis of Small Proteins using the WebAmber Interface. By Eddie Gorr Gustavus Adolphus College
Computational Analysis of Small Proteins using the WebAmber Interface By Eddie Gorr Gustavus Adolphus College Research Goals Upgrade And Revise Web-based Amber interface Use Amber to Explore Interactions
Molecular Dynamics Simulations. Dr. Noelia Faginas Lago Dipartimento di Chimica,Biologia e Biotecnologie Università di Perugia
Molecular Dynamics Simulations Dr. Noelia Faginas Lago Dipartimento di Chimica,Biologia e Biotecnologie Università di Perugia 1 An Introduction to Molecular Dynamics Simulations Macroscopic properties
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Structure to Function. Molecular Bioinformatics, X3, 2006
Structure to Function Molecular Bioinformatics, X3, 2006 Structural GeNOMICS Structural Genomics project aims at determination of 3D structures of all proteins: - organize known proteins into families
Exercise 2: Solvating the Structure Before you continue, follow these steps: Setting up Periodic Boundary Conditions
Exercise 2: Solvating the Structure HyperChem lets you place a molecular system in a periodic box of water molecules to simulate behavior in aqueous solution, as in a biological system. In this exercise,
Docking. GBCB 5874: Problem Solving in GBCB
Docking Benzamidine Docking to Trypsin Relationship to Drug Design Ligand-based design QSAR Pharmacophore modeling Can be done without 3-D structure of protein Receptor/Structure-based design Molecular
Hands-on : Model Potential Molecular Dynamics
Hands-on : Model Potential Molecular Dynamics OUTLINE 0. DL_POLY code introduction 0.a Input files 1. THF solvent molecule 1.a Geometry optimization 1.b NVE/NVT dynamics 2. Liquid THF 2.a Equilibration
Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G2019S.
Type II Kinase Inhibitors Show an Unexpected Inhibition Mode against Parkinson s Disease-Linked LRRK2 Mutant G219S. Min Liu@&*, Samantha A. Bender%*, Gregory D Cuny@, Woody Sherman, Marcie Glicksman@ Soumya
Fondamenti di Chimica Farmaceutica. Computer Chemistry in Drug Research: Introduction
Fondamenti di Chimica Farmaceutica Computer Chemistry in Drug Research: Introduction Introduction Introduction Introduction Computer Chemistry in Drug Design Drug Discovery: Target identification Lead
Structural Bioinformatics (C3210) Molecular Mechanics
Structural Bioinformatics (C3210) Molecular Mechanics How to Calculate Energies Calculation of molecular energies is of key importance in protein folding, molecular modelling etc. There are two main computational
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med
Chemogenomic: Approaches to Rational Drug Design. Jonas Skjødt Møller
Chemogenomic: Approaches to Rational Drug Design Jonas Skjødt Møller Chemogenomic Chemistry Biology Chemical biology Medical chemistry Chemical genetics Chemoinformatics Bioinformatics Chemoproteomics
HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.
HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental
Potassium channel gating and structure!
Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
Receptor Based Drug Design (1)
Induced Fit Model For more than 100 years, the behaviour of enzymes had been explained by the "lock-and-key" mechanism developed by pioneering German chemist Emil Fischer. Fischer thought that the chemicals
A Nobel Prize for Molecular Dynamics and QM/MM What is Classical Molecular Dynamics? Simulation of explicit particles (atoms, ions,... ) Particles interact via relatively simple analytical potential
Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues
Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback
ALL LECTURES IN SB Introduction
1. Introduction 2. Molecular Architecture I 3. Molecular Architecture II 4. Molecular Simulation I 5. Molecular Simulation II 6. Bioinformatics I 7. Bioinformatics II 8. Prediction I 9. Prediction II ALL
CAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
Contents. xiii. Preface v
Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak
Exploring the Free Energy Surface of Short Peptides by Using Metadynamics
John von Neumann Institute for Computing Exploring the Free Energy Surface of Short Peptides by Using Metadynamics C. Camilloni, A. De Simone published in From Computational Biophysics to Systems Biology
An introduction to Molecular Dynamics. EMBO, June 2016
An introduction to Molecular Dynamics EMBO, June 2016 What is MD? everything that living things do can be understood in terms of the jiggling and wiggling of atoms. The Feynman Lectures in Physics vol.
Supplementary Information
Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
Prediction and refinement of NMR structures from sparse experimental data
Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk
T 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
Basic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine
Molecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov
Biophysical Journal, Volume 98 Supporting Material Molecular dynamics simulations of anti-aggregation effect of ibuprofen Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Supplemental
Physiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing
Molecular Mechanics, Dynamics & Docking
Molecular Mechanics, Dynamics & Docking Lawrence Hunter, Ph.D. Director, Computational Bioscience Program University of Colorado School of Medicine Larry.Hunter@uchsc.edu http://compbio.uchsc.edu/hunter
Bioinformatics. Macromolecular structure
Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain
Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
The Molecular Dynamics Simulation Process
The Molecular Dynamics Simulation Process For textbooks see: M.P. Allen and D.J. Tildesley. Computer Simulation of Liquids.Oxford University Press, New York, 1987. D. Frenkel and B. Smit. Understanding
SUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
Protein Structure Basics
Protein Structure Basics Presented by Alison Fraser, Christine Lee, Pradhuman Jhala, Corban Rivera Importance of Proteins Muscle structure depends on protein-protein interactions Transport across membranes
Targeting protein-protein interactions: A hot topic in drug discovery
Michal Kamenicky; Maria Bräuer; Katrin Volk; Kamil Ödner; Christian Klein; Norbert Müller Targeting protein-protein interactions: A hot topic in drug discovery 104 Biomedizin Innovativ patientinnenfokussierte,
Interpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
Ligand Scout Tutorials
Ligand Scout Tutorials Step : Creating a pharmacophore from a protein-ligand complex. Type ke6 in the upper right area of the screen and press the button Download *+. The protein will be downloaded and
MM-GBSA for Calculating Binding Affinity A rank-ordering study for the lead optimization of Fxa and COX-2 inhibitors
MM-GBSA for Calculating Binding Affinity A rank-ordering study for the lead optimization of Fxa and COX-2 inhibitors Thomas Steinbrecher Senior Application Scientist Typical Docking Workflow Databases
Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data
Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular
Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
Toward an Understanding of GPCR-ligand Interactions. Alexander Heifetz
Toward an Understanding of GPCR-ligand Interactions Alexander Heifetz UK QSAR and ChemoInformatics Group Conference, Cambridge, UK October 6 th, 2015 Agenda Fragment Molecular Orbitals (FMO) for GPCR exploration
Sequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
A Brief Guide to All Atom/Coarse Grain Simulations 1.1
A Brief Guide to All Atom/Coarse Grain Simulations 1.1 Contents 1. Introduction 2. AACG simulations 2.1. Capabilities and limitations 2.2. AACG commands 2.3. Visualization and analysis 2.4. AACG simulation
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
Table 1. Kinetic data obtained from SPR analysis of domain 11 mutants interacting with IGF-II. Kinetic parameters K D 1.
Kinetics and Thermodynamics of the Insulin-like Growth Factor II (IGF-II) Interaction with IGF-II/Mannose 6-phosphate Receptor and the function of CD and AB Loop Solvent-exposed Residues. Research Team:
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural
CSCE555 Bioinformatics. Protein Function Annotation
CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The
Advanced in silico drug design
Advanced in silico drug design RNDr. Martin Lepšík, Ph.D. Lecture: Advanced scoring Palacky University, Olomouc 2016 1 Outline 1. Scoring Definition, Types 2. Physics-based Scoring: Master Equation Terms
MD Thermodynamics. Lecture 12 3/26/18. Harvard SEAS AP 275 Atomistic Modeling of Materials Boris Kozinsky
MD Thermodynamics Lecture 1 3/6/18 1 Molecular dynamics The force depends on positions only (not velocities) Total energy is conserved (micro canonical evolution) Newton s equations of motion (second order
Goals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions
Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke 1,2 and Carlos Camacho 3 1 Bioengineering and Bioinformatics Summer Institute,
schematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc.
Lecture 1: Noncovalent Biomolecular Interactions Bioengineering and Modeling of biological processes -e.g. tissue engineering, cancer, autoimmune disease Example: RTK signaling, e.g. EGFR Growth responses
Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1
Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1
Biomolecules are dynamic no single structure is a perfect model
Molecular Dynamics Simulations of Biomolecules References: A. R. Leach Molecular Modeling Principles and Applications Prentice Hall, 2001. M. P. Allen and D. J. Tildesley "Computer Simulation of Liquids",
Supporting Information. The hinge region strengthens the nonspecific interaction. between lac-repressor and DNA: a computer simulation.
Supporting Information The hinge region strengthens the nonspecific interaction between lac-repressor and DNA: a computer simulation study Lili Sun 1, Marcin Tabaka 1, Sen Hou 1, Lin Li 2, Krzysztof Burdzy
Introduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
Fragment Hotspot Maps: A CSD-derived Method for Hotspot identification
Fragment Hotspot Maps: A CSD-derived Method for Hotspot identification Chris Radoux www.ccdc.cam.ac.uk radoux@ccdc.cam.ac.uk 1 Introduction Hotspots Strongly attractive to organic molecules Organic molecules
Biology Chemistry & Physics of Biomolecules. Examination #1. Proteins Module. September 29, Answer Key
Biology 5357 Chemistry & Physics of Biomolecules Examination #1 Proteins Module September 29, 2017 Answer Key Question 1 (A) (5 points) Structure (b) is more common, as it contains the shorter connection
Tutorial: Structural Analysis of a Protein-Protein Complex
Molecular Modeling Section (MMS) Department of Pharmaceutical and Pharmacological Sciences University of Padova Via Marzolo 5-35131 Padova (IT) @contact: stefano.moro@unipd.it Tutorial: Structural Analysis
Structure Investigation of Fam20C, a Golgi Casein Kinase
Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project
Journal of Pharmacology and Experimental Therapy-JPET#172536
A NEW NON-PEPTIDIC INHIBITOR OF THE 14-3-3 DOCKING SITE INDUCES APOPTOTIC CELL DEATH IN CHRONIC MYELOID LEUKEMIA SENSITIVE OR RESISTANT TO IMATINIB Manuela Mancini, Valentina Corradi, Sara Petta, Enza
BCMP 201 Protein biochemistry
BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry with emphasis on the interrelated roles of protein structure, catalytic activity, and macromolecular interactions in biological processes. The
Viewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
Protein Structures. 11/19/2002 Lecture 24 1
Protein Structures 11/19/2002 Lecture 24 1 All 3 figures are cartoons of an amino acid residue. 11/19/2002 Lecture 24 2 Peptide bonds in chains of residues 11/19/2002 Lecture 24 3 Angles φ and ψ in the
The molecular basis of the interactions between synthetic retinoic acid analogues and the retinoic acid receptors
Electronic Supplementary Material (ESI) for MedChemComm. This journal is The Royal Society of Chemistry 2017 The molecular basis of the interactions between synthetic retinoic acid analogues and the retinoic
What is Classical Molecular Dynamics?
What is Classical Molecular Dynamics? Simulation of explicit particles (atoms, ions,... ) Particles interact via relatively simple analytical potential functions Newton s equations of motion are integrated
Minireview: Molecular Structure and Dynamics of Drug Targets
Prague Medical Report / Vol. 109 (2008) No. 2 3, p. 107 112 107) Minireview: Molecular Structure and Dynamics of Drug Targets Dahl S. G., Sylte I. Department of Pharmacology, Institute of Medical Biology,
BUDE. A General Purpose Molecular Docking Program Using OpenCL. Richard B Sessions
BUDE A General Purpose Molecular Docking Program Using OpenCL Richard B Sessions 1 The molecular docking problem receptor ligand Proteins typically O(1000) atoms Ligands typically O(100) atoms predicted
Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
Model Worksheet Teacher Key
Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids,