T H E J O U R N A L O F C E L L B I O L O G Y
|
|
|
- Victor Fitzgerald
- 5 years ago
- Views:
Transcription
1 Supplemental material Kasprowicz et al., T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. NMJ morphology of shi 12-12B ; shi-4c not treated with FALI. (A and B) shi 12-12B ; shi-4c are viable and show no obvious behavioral defects, including flight ability (A) and climbing behavior after being tapped down (negative geotaxis; B) as compared with yw controls. Error bars show SEMs; t test. n > 40 flies in groups of five flies. (C) Images of yw control and shi 12-12B ; shi-4c third instar larval fillets at rest labeled with anti-hrp, a presynaptic marker, and anti-dlg, a pre- and postsynaptic marker. Bar, 20 µm. (D and E) Quantification of the bouton number normalized to the muscle area (D) and total NMJ length normalized to the muscle area (E) in yw controls and shi 12-12B ; shi-4c at rest. Error bars show SEMs; t test. n = 6 7 NMJs from four larvae each. Dynamin prevents bulk membrane retrieval Kasprowicz et al. S1
2 Figure S2. RNAi-mediated knockdown of Dynamin shows massive membrane internalizations upon stimulation. (A D) Electron micrographs of boutons of KCl-stimulated controls (dicer-2/+;; nsybgal4/+; A) and larvae expressing shi RNAi (dicer-2/+; shi RNAi/+; nsybgal4/+; B) as well as larger magnifications of the cisternal invaginations seen upon expression of shi RNAi (C) and a presynaptic density in such animals (D). Arrows, active zone; arrowheads, membrane inclusions; m, mitochondria. Bars, 250 nm. S2
3 Figure S3. HA-Chc and -Ada localization upon Dynamin inactivation. (A J) Superresolution imaging of HA-Chc fusion proteins with anti-ha antibodies (A E) and of -Ada with antibody labeling (F J) using structured illumination microscopy and at different z intervals (330 nm for A G, I, and J and 660 nm for H) through the boutons shown in Fig. 5 (the color coding of the boxed image is identical to Fig. 5) without stimulation ( KCl) and with stimulation (+KCl; 90 mm for 5 min). (A and B) Anti-HA labeling of yw; HA-chc controls (yw, red) and shi 12-12B /Y; HA-chc/shi-4C without FALI (yellow) at rest ( KCl). (C E) Anti-HA labeling of yw; HA-chc (yw, magenta) and shi 12-12B /Y; HA-chc/shi-4C, stimulated with KCl without Dynamin inactivation (blue; C and D) and with Dynamin inactivation using FALI (green; E). (F and G) Anti -Ada labeling of yw controls (yw, red) and shi 12-12B /Y; shi-4c/+ without FALI (yellow) at rest ( KCl). (H J) Anti -Ada labeling of yw (yw, magenta) and shi 12-12B /Y; shi-4c/+, stimulated with KCl without Dynamin inactivation (blue; H and I) and with Dynamin inactivation using FALI (green; J). Bar, 2 µm. Dynamin prevents bulk membrane retrieval Kasprowicz et al. S3
4 Figure S4. HA-Chc and -Ada localization upon RNAi-mediated knockdown of Dynamin. (A F) Superresolution imaging of HA-Chc fusion proteins with anti-ha antibodies (A C) and of -Ada with antibody labeling (D F) using structured illumination microscopy and at different z intervals (330 nm) through the boutons that were not stimulated (green, KCl) or were stimulated (red, +KCl; 90 mm for 5 min) in control animals (dicer-2/+;; nsybgal4/+; A, B, D, and E) and in larvae expressing shi RNAi (dicer-2/+; shi RNAi/+; nsybgal4/+; C and F). Bars, 2 µm. S4
5 Figure S5. Shi-4C acts dominantly. (A) FM 1-43 labeling in shi 12-12B ; shi-4c and yw; shi-4c animals after FALI. Preparations were stimulated with KCl in the presence of FM 1-43 for 5 min, washed, and imaged. Note, large cisternal-like membrane internalizations are also observed in animals expressing Shi-4C in a wild-type background after FALI, indicating that Shi-4C acts dominantly. Bar, 5 µm. (B and C) Quantification of FM 1-43 labeling intensity (int.; n = 32 and 20 boutons from three larvae each) and the number of FM 1-43 labeled accumulations (accum.) per bouton surface area (n = 72, 72, and 32 boutons from 8, 16, and 5 larvae) in shi 12-12B ; shi-4c after FALI and yw; shi-4c after FALI. The labeling intensity is normalized to the control (shi 12-12B ; shi-4c after FALI). Error bars show SEMs. (B) t test. (C) ANOVA (post hoc Tukey s test): ***, P < Dynamin prevents bulk membrane retrieval Kasprowicz et al. S5
6 Table S1. Primers used to create the genomic tagged shi-4c, endo-4c, and HA-chc constructs Template vector Primer name Primer sequence (5 3 ) Primers used for recombineeringmediated tagging of shi shi-4c Dyn_L_term_PL452_R CATCGCCTGGCTGAAAGTGCTTAAACTCCTCCACCTCCTTCTCC- AAAGTACTAGTGGATCCCCTCGAGGGAC Dyn_L_Flag_4C_F CAGGGACACGTTACCTGGCCTGCGGGATAAGTTGCAGAAGCA- GATGCTCATGGATTACAAGGATGACGAC Dyn_N_reco_F TCACTATAGGGCGAATTGG Dyn_N_reco_R GAACAAAAGCTGGGTACCGCCC Primers used for tagging endoa with the 4C tag endo-4c Endo F CTCGACGGTCACGGCGGGCATGTCGAGACTTCGTGCTCGGTA- CCACTATCGACTGGAAGAATGAGGAAATCGAGG Endo 4C R GAACTCGTTGCGTGGGGGCTCCATGCAGCAGCCGGGGCAGC- AATTCAAAAACCGGCTCTCCGCCTCGGAGCGC Endo 4C F GAGGCGGAGAGCCGGTTTTTGAATTGCTGCCCCGGCTGCTGCA- TGGAGCCCCCACGCAACGAGTTCGTGCCC Endo R GGGTTTTATTAACTTACATACATACTAGAATTCGCATGCCTGCAGTCT- AGACCAGGAGCAGGGCGTCTACAAG Primers used for tagging chc with the HA tag HA-chc P[acman]_ura3_AscI_CHC_F CGAGCGGTCCGTTATCGATGGCGCGCCGGCCTTAATGGCCAGG- CGCGCCTAATGAATGAAGGAGTCGTCCTG Left_arm_R CCATCGCTTAACACACAAGATCCTCCTACGCTCCCTCGCTC Right_arm_L CAAGATTATCGCCGTGAGGTAACGATGTAATCGAAGGATTAC P[acman]_ura3_CHC_PacI_R ACAAAAGCTGGGTACCGCCCGGGCGCGATCGCGGCCGGCC- ACCTTAATTAAAATTTAGAAACTCACAGATAGC Chc_part1_F CTGGTGTCTGCACCTGTTGGAAACGCTGGATCGTCTGTGGCGTA- CGCAGAATGGCCTTGG Chc_part_1R CGGATGGGCAGTGGTTGCGTGGCGTAGTCGGGCACGTCGTAG- GGGTACATCTTTACTACT HA_20_bp_chc_F1 GGCGTAGTCGGGCACGTCGTAGGGGTACATCTTTACTACTACAG- TGAGGTC R3 GGAATGTGAAGTTATTATACCCGTTACTCGTAGAGTAACAGAACA- CACC 40_bp_chc_+_20_bp_HA_F2 CCTGTAAATGCTCCTGAAAGCGGATGGGCAGTGGTTGCGTGGC- GTAGTCGGGCACGTCGTAG F3 GGAATGTGAAGTTATTATACCCGTTACTCGTAGAGTAACAGAAC- ACACC HA_middle_R GCGCCCATGTCGCGGCCGCTGTAATCCTTCGATTACATCGTTAC- CTCACGGCGATAATCTTG F, forward; R, reverse. Video 1. Electron tomogram of stimulated shi 12-12B /Y; shi-4c/+ larvae at restrictive temperature after FALI. Video shows an electron tomogram of a stimulated bouton of shi 12-12B /Y; shi-4c/+ larvae at restrictive temperature after FALI. A tilt series of a 300-nm-thick section was collected from 52 to 60 with 2 angular increments in a transmission electron microscope (JEM-2100; JEOL) at 10,000 using Recorder software (JEOL) and a 1,024 1,024 pixel bottom-mounted charge-coupled device camera (MultiScan; Gatan). Tomograms were reconstructed with the etomo module in IMOD. Each video frame in the tomogram is an individual slice (54 slices in total). The surface-rendered model, built by semiautomated surface rendering and computed using 3dmod in IMOD, is shown in Fig. 7. Note the accumulation of membrane inclusions that are also connected to the presynaptic membrane. Bar, 200 nm. S6
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10923 Supplementary Figure 1 Ten-a and Ten-m antibody and cell type specificities. a c, Representative single confocal sections of a Drosophila NMJ stained with antibodies to Ten-a (red),
Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and
Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Lifeact-Ruby (red) were imaged in vivo to visualize secretion
Electric-Field-Assisted Assembly of. Nanopores
Supporting Information for: Electric-Field-Assisted Assembly of Polymer-Tethered Gold Nanorods in Cylindrical Nanopores Ke Wang, Seon-Mi Jin, Jiangping Xu, Ruijing Liang, Khurram Shezad, Zhigang Xue,*,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,
Fig. S1. Expression pattern of moody-gal4 in third instar. Maximum projection illustrating a dissected moody-gal4>ngfp L3 larva stained for Repo
Fig. S1. Expression pattern of moody-gal4 in third instar. Maximum projection illustrating a dissected moody-gal4>ngfp L3 larva stained for Repo (magenta), Fas2 (blue) and GFP (green) in overview (A) and
Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
SUPPLEMENTARY INFORMATION
Supplementary Figure 1 Sns and Duf co-localise in embryonic nephrocytes a-c, Wild-type stage 11 (a),14 (b) and 16 (c) embryos stained with anti-duf (green) and anti-sns (red). Higher magnification images
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization
Cell Metabolism Supplemental Information Mitochondrial Dynamics Is a Distinguishing Feature of Skeletal Muscle Fiber Types and Regulates Organellar Compartmentalization Prashant Mishra, Grigor Varuzhanyan,
Heather Currinn, Benjamin Guscott, Zita Balklava, Alice Rothnie and Thomas Wassmer*
Online Resources APP controls the formation of PI(3,5)P 2 vesicles through its binding of the PIKfyve complex. Cellular and Molecular Life Sciences Heather Currinn, Benjamin Guscott, Zita Balklava, Alice
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.1244624/dc1 Supplementary Materials for Cytoneme-Mediated Contact-Dependent Transport of the Drosophila Decapentaplegic Signaling Protein Sougata Roy, Hai Huang,
Nature Neuroscience: doi: /nn.2662
Supplementary Figure 1 Atlastin phylogeny and homology. (a) Maximum likelihood phylogenetic tree based on 18 Atlastin-1 sequences using the program Quicktree. Numbers at internal nodes correspond to bootstrap
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Eisner et al., http://www.jcb.org/cgi/content/full/jcb.201312066/dc1 Figure S1. Mitochondrial continuity in adult skeletal muscle. (A)
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body
Anterograde Activin Signaling Regulates Postsynaptic Membrane Potential and GluRIIA/B Abundance at the Drosophila Neuromuscular Junction
Anterograde Activin Signaling Regulates Postsynaptic Membrane Potential and GluRIIA/B Abundance at the Drosophila Neuromuscular Junction Myung-Jun Kim, Michael B. O Connor* Department of Genetics, Cell
Role of Mitochondrial Remodeling in Programmed Cell Death in
Developmental Cell, Vol. 12 Supplementary Data Role of Mitochondrial Remodeling in Programmed Cell Death in Drosophila melanogaster Gaurav Goyal, Brennan Fell, Apurva Sarin, Richard J. Youle, V. Sriram.
Nature Methods: doi: /nmeth Supplementary Figure 1. In vitro screening of recombinant R-CaMP2 variants.
Supplementary Figure 1 In vitro screening of recombinant R-CaMP2 variants. Baseline fluorescence compared to R-CaMP1.07 at nominally zero calcium plotted versus dynamic range ( F/F) for 150 recombinant
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX.
Supplementary Figure 1. AnnexinV FITC and Sytox orange staining in wild type, Nlrp3 /, ASC / and casp1/11 / TEC treated with TNF /CHX. Phase contrast and widefield fluorescence microscopy (20x magnification).
SUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.
Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty
SUPPLEMENTARY FIGURES AND TABLES AND THEIR LEGENDS. Transient infection of the zebrafish notochord triggers chronic inflammation
SUPPLEMENTARY FIGURES AND TABLES AND THEIR LEGENDS Transient infection of the zebrafish notochord triggers chronic inflammation Mai Nguyen-Chi 1,2,5, Quang Tien Phan 1,2,5, Catherine Gonzalez 1,2, Jean-François
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
Supplementary Figure 1. Large-area SEM images of rhombic rod foldectures (F1) deposited on Si substrate in (a) an in-plane magnetic field and (b) an
Supplementary Figure 1. Large-area SEM images of rhombic rod foldectures (F1) deposited on Si substrate in (a) an in-plane magnetic field and (b) an out-of-plane magnetic field. Scale bars: 10 m. 1 Supplementary
Supplementary Figure 1.
Supplementary Figure 1. Characterisation of IHG-1 overexpressing and knockdown cell lines. (A) Total cellular RNA was prepared from HeLa cells stably overexpressing IHG-1 or mts-ihg-1. IHG-1 mrna was quantified
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Purification of yeast CKM. (a) Silver-stained SDS-PAGE analysis of CKM purified through a TAP-tag engineered into the Cdk8 C-terminus. (b) Kinase activity
Shaggy, the Homolog of Glycogen Synthase Kinase 3, Controls Neuromuscular Junction Growth in Drosophila
The Journal of Neuroscience, July 21, 2004 24(29):6573 6577 6573 Brief Communication Shaggy, the Homolog of Glycogen Synthase Kinase 3, Controls Neuromuscular Junction Growth in Drosophila Bénédicte Franco,
Nature Neuroscience: doi: /nn.2717
Supplementary Fig. 1. Dendrite length is not secondary to body length. Dendrite growth proceeds independently of the rate of body growth and decreases in rate in adults. n 20 on dendrite measurement, n
DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein
Supplemental Figure and Movie Legends Figure S1. Time course experiments on the thermal stability of apo AT cpn-α by native PAGE (related to Figure 2B). The samples were heated, respectively, to (A) 45
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2215 Figure S1 Number of egfp-vps4a bursts versus cellular expression levels. The total number of egfp-vps4a bursts, counted at the end of each movie (frame 2000, after 1h 28 min) are plotted
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
Original Article Overexpression of ter94, Drosophila VCP, improves motor neuron degeneration induced by knockdown of TBPH, Drosophila TDP-43
Am J Neurodegener Dis 2018;7(1):11-31 www.ajnd.us /ISSN:2165-591X/AJND0069303 Original Article Overexpression of ter94, Drosophila VCP, improves motor neuron degeneration induced by knockdown of TBPH,
Supplementary Figure 1. CoMIC in 293T, HeLa, and HepG2 cells. (a) Mitochondrial morphology in 293T, HeLa and HepG2 cells. Cells were transfected with
Supplementary Figure 1. CoMIC in 293T, HeLa, and HepG2 cells. (a) Mitochondrial morphology in 293T, HeLa and HepG2 cells. Cells were transfected with DsRed-mito. Right panels are time-course enlarged images
Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration
Cell Stem Cell Supplemental Information Intravital Imaging Reveals Ghost Fibers as Architectural Units Guiding Myogenic Progenitors during Regeneration Micah T. Webster, Uri Manor, Jennifer Lippincott-Schwartz,
SUPPLEMENTARY INFORMATION
Supplementary Notes Downregulation of atlastin does not affect secretory traffic We investigated whether Atlastin might play a role in secretory traffic. Traffic impairment results in disruption of Golgi
Life is Cellular. At the cellular level, what is the difference between animal cells and bacterial cells? How do microscopes work?
Life is Cellular At the cellular level, what is the difference between animal cells and bacterial cells? How do microscopes work? Objectives 8a) I can state the cell theory and distinguish between prokaryotes
GFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
MODULE 2 : FOUNDATIONS IN BIOLOGY
OCR A LEVEL BIOLOGY MODULE 2 : FOUNDATIONS IN BIOLOGY REVISION NOTES For 2015 onwards specification Miss T Banda All living things are primarily made from 4 key elements: Carbon (C) Hydrogen (H) Oxygen
SUPPLEMENTARY INFORMATION
GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram
Reason... (2) Reason... (2) Reason... (2)
1 The figure below shows four different types of cell. (a) Which cell is a plant cell? Give one reason for your answer. Cell... Reason... (b) Which cell is an animal cell? Give one reason for your answer.
A role for PS integrins in morphological growth and synaptic function at the postembryonic neuromuscular junction of Drosophila
Development 126, 5833-5846 (1999) Printed in Great Britain The Company of Biologists Limited 1999 DEV8655 5833 A role for PS integrins in morphological growth and synaptic function at the postembryonic
Anti-icing surfaces based on enhanced self-propelled jumping of condensed water microdroplets
Anti-icing surfaces based on enhanced self-propelled jumping of condensed water microdroplets Qiaolan Zhang, a,b Min He, a Jing Chen, a,b Jianjun Wang,* a Yanlin Song* a and Lei Jiang a a Beijing National
Neuronal Differentiation: Synapse Formation NMJ
Neuronal Differentiation: Synapse Formation NMJ Approaches to study synapse formation Rodent NMJ (cholinergic) Drosophila NMJ (glutamatergic) Rodent CNS synapse (glutamatergic or GABAergic) C. elegans
Nonlinear Optics. Single-Molecule Microscopy Group. Physical Optics Maria Dienerowitz.
Single-Molecule Microscopy Group Nonlinear Optics Physical Optics 21-06-2017 Maria Dienerowitz maria.dienerowitz@med.uni-jena.de www.single-molecule-microscopy.uniklinikum-jena.de Contents Introduction
Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
Use of light microscope and stereomicroscope: measuring microscopic
Experiment 1 Use of light microscope and stereomicroscope: measuring microscopic objects 1.1 Introduction The microscope is a major tool used by biologists, which was invented about 350 years ago. It is
Supporting Information. For. Preparation and Characterization of Highly Planar Flexible Silver
Supporting Information For Preparation and Characterization of Highly Planar Flexible Silver Crystal Belts Dharmesh Varade and Kazutoshi Haraguchi* [*] Dr. K. Haraguchi (Corresponding-Author), Dr. D. Varade
The Discovery of the Cell
The Discovery of the Cell The Discovery of the Cell Because there were no instruments to make cells visible, the existence of cells was unknown for most of human history. This changed with the invention
Electron Microscopy (TEM and SEM)
7 Electron Microscopy (TEM and SEM) Paul Verkade Wolfson Bioimaging Facility, Physiology & Pharmacology and Biochemistry, University of Bristol, UK 7.1 Basic how-to-do and why-do section 7.1.1 Electron
Synaptic Homeostasis Is Consolidated by the Cell Fate Gene gooseberry,adrosophila pax3/7 Homolog
The Journal of Neuroscience, June 16, 2010 30(24):8071 8082 8071 Development/Plasticity/Repair Synaptic Homeostasis Is Consolidated by the Cell Fate Gene gooseberry,adrosophila pax3/7 Homolog Bruno Marie,
Waithe et al Supplementary Figures
Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2
Introduction to cells
Almen Cellebiologi Introduction to cells 1. Unity and diversity of cells 2. Microscopes and visualization of cells 3. Prokaryotic cells, eubacteria and archaea 4. Eucaryotic cells, nucleus, mitochondria
L.Cseh, G. H. Mehl. Supporting information
The design and investigation of room temperature thermotropic nematic gold nanoparticles L.Cseh, G. H. Mehl Supporting information Instrumentation Nuclear magnetic resonance (NMR) spectra were taken on
Ral mediates activity-dependent growth of postsynaptic membranes via recruitment of the exocyst
The EMBO Journal (2013) 32, 2039 2055 www.embojournal.org Ral mediates activity-dependent growth of postsynaptic membranes via recruitment of the exocyst THE EMBO JOURNAL Rita O Teodoro 1,2, *, Gulc in
Supporting information for
Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of
Modeling of snrnp Motion in the Nucleoplasm
Excerpt from the Proceedings of the COMSOL Conference 008 Hannover Modeling of snrnp Motion in the Nucleoplasm Michaela Blažíková 1, Jan Malínský *,, David Staněk 3 and Petr Heřman 1 1 Charles University
Frequency (Hz) Amplitude (pa) D1 WT D1 KO D2 WT D2 KO D1 WT D1 KO D2 WT D2 KO
A D1 MSNs B D2 MSNs C Frequency (Hz) 4 3 2 1 D Amplitude (pa) 5 4 3 2 1 D1 D1 D2 D2 D1 D1 D2 D2 Supplemental Figure 1. B deletion did not alter GABA-mIPSCs in D1 or D2 MSNs. (A,B) Representative recording
Imaging structural changes of exo- & endocytosis in live cells Imaging Structural Changes Vesicle Fusion and
Imaging structural changes of exo- & endocytosis in live cells Imaging Structural Changes Vesicle Fusion and Ling-Gang Wu Endocytosis National Institute of in Neurological Live Cells Disorders and Stroke,
This script will produce a series of pulses of amplitude 40 na, duration 1ms, recurring every 50 ms.
9.16 Problem Set #4 In the final problem set you will combine the pieces of knowledge gained in the previous assignments to build a full-blown model of a plastic synapse. You will investigate the effects
Focused-ion-beam BRIEF COMMUNICATIONS. Michael Marko 1, Chyongere Hsieh 1, Richard Schalek 2, Joachim Frank 1,3 & Carmen Mannella 1
BRIEF COMMUNICATIONS 2007 Nature Publishing Group http://www.nature.com/naturemethods Focused-ion-beam thinning of frozenhydrated biological specimens for cryoelectron microscopy Michael Marko 1, Chyongere
Supporting Information. Single-Crystalline Copper Nano-Octahedra
Supporting Information Single-Crystalline Copper Nano-Octahedra Shu-Chen Lu, Ming-Cheng Hsiao, Mustafa Yorulmaz, Lin-Yung Wang, Po-Yuan Yang, Stephan Link, Wei-Shun Chang, Hsing-Yu Tuan * Department of
Supplementary Information
Supplementary Information MAP2/Hoechst Hyp.-AP ph 6.5 Hyp.-SD ph 7.2 Norm.-SD ph 7.2 Supplementary Figure 1. Mitochondrial elongation in cortical neurons by acidosis. Representative images of neuronal
Supplementary Information
Supplementary Information Supplementary Figures Supplementary figure S1: Characterisation of the electron beam intensity profile. (a) A 3D plot of beam intensity (grey value) with position, (b) the beam
Biology Homework Chapter 5: The Cell Pages Answer the questions with complete thoughts!
Name Biology Homework Chapter 5: The Cell Pages 115-133 Answer the questions with complete thoughts! Per. * Sections 5.1 through 5.3: Cells Are the Units of Life: Read pages 115 to 122 PART A: Define the
Guided Reading Activities
Name Period Chapter 4: A Tour of the Cell Guided Reading Activities Big Idea: Introduction to the Cell Answer the following questions as you read Modules 4.1 4.4: 1. A(n) uses a beam of light to illuminate
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Photographs of the 3D-MTC device and the confocal fluorescence microscopy. I: The system consists of a Leica SP8-Confocal microscope (with an option of STED), a confocal PC, a 3D-MTC
PROPERTY OF ELSEVIER SAMPLE CONTENT - NOT FINAL. The Nervous System and Muscle
The Nervous System and Muscle SECTION 2 2-1 Nernst Potential 2-2 Resting Membrane Potential 2-3 Axonal Action Potential 2-4 Neurons 2-5 Axonal Conduction 2-6 Morphology of Synapses 2-7 Chemical Synaptic
Journal of Cell Science Accepted manuscript
2013. Published by The Company of Biologists Ltd. A bacterial tubulovesicular network Journal of Cell Science Accepted manuscript Devrim Acehan 1, Rachel Santarella-Mellwig 1 1, *, $, and Damien P Devos
Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria
Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D.
Iterative Data Refinement for Soft X-ray Microscopy
Iterative Data Refinement for Soft X-ray Microscopy Presented by Joanna Klukowska August 2, 2013 Outline Iterative Data Refinement Transmission X-ray Microscopy Numerical Tests Joanna Klukowska IDR for
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Different crystal forms obtained for Sky
Supplementary Figure 1 Different crystal forms obtained for Sky 1 353. (a) Crystal form 1 obtained in the presence of 20% PEG 3350 and 0.2 M ammonium citrate tribasic ph 7.0. (b) Crystal form 1 of the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11589 Supplementary Figure 1 Ciona intestinalis and Petromyzon marinus neural crest expression domain comparison. Cartoon shows dorsal views of Ciona mid gastrula (left) and Petromyzon
Supplementary information
Supplementary information Statistical organelle dissection of Arabidopsis guard cells using image database LIPS Takumi Higaki *, Natsumaro Kutsuna, Yoichiroh Hosokawa, Kae Akita, Kazuo Ebine, Takashi Ueda,
Mutations in palmitoyl-protein thioesterase 1 alter exocytosis and endocytosis at synapses in Drosophila larvae
Paper Type Fly7:4, 267 279; October/November/December 2013; 2013 Landes Bioscience RESEARCH PAPER Mutations in palmitoyl-protein thioesterase 1 alter exocytosis and endocytosis at synapses in Drosophila
Imaging the structure of activated carbon using aberration corrected TEM
Imaging the structure of activated carbon using aberration corrected TEM Article Accepted Version Harris, P. J. F., Liu, Z. and Suenaga, K. (2010) Imaging the structure of activated carbon using aberration
Applications in Biofluidics
Applications in Biofluidics Last Class: 1. Introduction of μpiv 2. Considerations of Microscopy in μpiv 3. Depth of Correlation 4. Physics of Particles in Micro PIV 5. Measurement Errors 6. Special Processing
Cell Structure. Lab Exercise 6. Contents. Objectives. Introduction
Lab Exercise Cell Structure Contents Objectives 1 Introduction 1 Activity.1 Cellular Structures 2 Activity.2 Matching Exercise 2 Activity.3 Identify Organelles 2 Resutls Section 3 Objectives - Identify
13-3. Synthesis-Secretory pathway: Sort lumenal proteins, Secrete proteins, Sort membrane proteins
13-3. Synthesis-Secretory pathway: Sort lumenal proteins, Secrete proteins, Sort membrane proteins Molecular sorting: specific budding, vesicular transport, fusion 1. Why is this important? A. Form and
Visualize and Measure Nanoparticle Size and Concentration
NTA : Nanoparticle Tracking Analysis Visualize and Measure Nanoparticle Size and Concentration 30 Apr 2015 NanoSight product range LM 10 series NS300 series NS500 series Dec 13 34 www.nanosight.com NanoSight
Highwire Regulates Synaptic Growth in Drosophila
Neuron, Vol. 26, 313 329, May, 2000, Copyright 2000 by Cell Press Highwire Regulates Synaptic Growth in Drosophila Hong I. Wan,* Aaron DiAntonio,* Richard D. Fetter,* Kendra Bergstrom,* Roland Strauss,
The EHD protein Past1 controls postsynaptic membrane elaboration and synaptic function
MBo ARTILE The EHD protein Past1 controls postsynaptic membrane elaboration and synaptic function Kate Koles a, Emily M. Messelaar a, Zachary Feiger a, rystal J. Yu a,. Andrew Frank b, and Avital A. Rodal
Supplementary Information
Supplementary Information Supplementary Figure 1. JAK/STAT in early wing development (a-f) Wing primordia of second instar larvae of the indicated genotypes labeled to visualize expression of upd mrna
Modulation of central pattern generator output by peripheral sensory cells in Drosophila larvae. BioNB4910 Cornell University.
Modulation of central pattern generator output by peripheral sensory cells in Drosophila larvae BioNB4910 Cornell University Goals 1) Observe the behavioral effects of remotely activating different populations
Supporting Information for. Long-Distance Charge Carrier Funneling in Perovskite Nanowires Enable by Built-in Halide Gradient
Supporting Information for Long-Distance Charge Carrier Funneling in Perovskite Nanowires Enable by Built-in Halide Gradient Wenming Tian, Jing Leng, Chunyi Zhao and Shengye Jin* State Key Laboratory of
Realization of Marin Mitov Idea for the Stroboscopic Illumination Used in Optical Microscopy
Bulg. J. Phys. 39 (2012) 65 71 Realization of Marin Mitov Idea for the Stroboscopic Illumination Used in Optical Microscopy J. Genova 1, J.I. Pavlič 2 1 Institute of Solid State Physics, Bulgarian Academy
CELL LAB OBJECTIVES INTRODUCTION: CELL UNIT. After completing this lab you should be able to:
AP BIOLOGY CELL UNIT ACTIVITY #3 NAME DATE HOUR CELL LAB OBJECTIVES After completing this lab you should be able to: 1. Compare and contrast prokaryotic and eukaryotic cells, 2. Prepare wet mount slides
Objectives. Key Terms
Objectives Explain the main ideas of the cell theory. Describe how microscopes aid the study of cells. Compare and contrast animal cells and plant cells. Distinguish between prokaryotic and eukaryotic
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
A gas-phase amplified quartz crystal microbalance immunosensor based on catalase modified immunoparticles
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 214 Supplementary Information A gas-phase amplified quartz crystal microbalance immunosensor based on
Practical applications of TIRF microscopy
Practical applications of TIRF microscopy Evgeny Pryazhnikov University of Helsinki, Neuroscience Center Functional and Morphological Plasticity of the Tripartite Synapse Vesicular release ATP Perisynaptic
Drosophila VAP-33A Directs Bouton Formation at Neuromuscular Junctions in a Dosage-Dependent Manner
Neuron, Vol. 35, 291 306, July 18, 2002, Copyright 2002 by Cell Press Drosophila VAP-33A Directs Bouton Formation at Neuromuscular Junctions in a Dosage-Dependent Manner Giuseppa Pennetta, 1,2 Peter Robin
let s examine pupation rates. With the conclusion of that data collection, we will go on to explore the rate at which new adults appear, a process
Population Dynamics and Initial Population Size (Module website: http://web.as.uky.edu/biology/faculty/cooper/population%20dynamics%20examples%20 with%20fruit%20flies/theamericanbiologyteacher-populationdynamicswebpage.html
Drosophila Spastin Regulates Synaptic Microtubule Networks and Is Required for Normal Motor Function
Drosophila Spastin Regulates Synaptic Microtubule Networks and Is Required for Normal Motor Function Nina Tang Sherwood 1, Qi Sun 1 1, Mingshan Xue 2 2, Bing Zhang 2, Kai Zinn 1 * Open access, freely available
Supplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
Open Syntaxin Docks Synaptic Vesicles
Marc Hammarlund 1,2[, Mark T. Palfreyman 1,2[, Shigeki Watanabe 1,2[, Shawn Olsen 1,2, Erik M. Jorgensen 1,2* PLoS BIOLOGY 1 Department of Biology, University of Utah, Salt Lake City, Utah, United States
Module 2: Foundations in biology
alevelbiology.co.uk Module 2: Foundations in biology SPECIFICATION 2.1.1 Cell structure Learners should be able to demonstrate and apply their knowledge and understanding of: (a) The use of microscopy