cerevisiae functions in the same transport pathway as Ypt7p

Transcription

1 Journal of Cell Science 113, (2000) Printed in Great Britain The Company of Biologists Limited 2000 JCS The novel protein Ccz1p required for vacuolar assembly in Saccharomyces cerevisiae functions in the same transport pathway as Ypt7p Róz a Kucharczyk 1, Sophie Dupre 2, Sandrine Avaro 2, Rosine Haguenauer-Tsapis 2, Piotr P. Sl/onimski 3 and Joanna Rytka 1, * 1 Institute of Biochemistry and Biophysics, Polish Academy of Sciences 2, Pawińskiego 5A, Warsaw, Poland 2 Institut Jacques Monod-CNRS, Universites Paris VI & VII, 2 Place Jussieu, Tour 43-44, Paris, France 3 Centre de Genetique Moleculaire, CNRS, F-91198, Gif-sur-Yvette, France *Author for correspondence ( Rytka@psd.ibb.waw.pl) Accepted 21 September; published on WWW 7 November 2000 SUMMARY CCZ1 was previously identified by the sensitivity of ccz1 mutants to high concentrations of Caffeine and the divalent ions Ca 2+ and Zn 2+. In this paper we show that deletion of CCZ1 leads to aberrant vacuole morphology, similar to the one reported for the family of vacuolar protein sorting (vps) mutants of class B. The ccz1 cells display severe vacuolar protein sorting defects for both the soluble carboxipeptidase Y and the membrane-bound alkaline phosphatase, which are delivered to the vacuole by distinct routes. Ccz1p is a membranous protein and the vast majority of Ccz1p resides in late endosomes. These results, along with a functional linkage found between the CCZ1 and YPT7 genes, indicate that the site of Ccz1p function is at the last step of fusion of multiple transport intermediates with the vacuole. Key words: Yeast, Vacuole, Vesicular transport INTRODUCTION The structural analysis of the yeast Saccharomyces cerevisiae genome sequence is now completed and the yeast genome project has entered the second phase, functional analysis (Goffeau et al., 1996). The first major challenge was that out of more than 6300 open reading frames (ORFs) identified in the Saccharomyces cerevisiae genome, for about one third there is no clue as to their function. The results of the genomewide functional analysis indicate that most of the deletion mutants do not display a clearcut, easy-to-score phenotype. In the search for gene functions, Sl/onimski and his coworkers developed a large-scale screening procedure via a systematic phenotypic analysis of yeast mutants carrying targeted deletions of single genes (Rieger et al., 1997). Often the observed phenotypes do not define the function of the genes analysed, but they can be helpful in finding the starting point for more in-depth investigation, as in the case of ORF YBR131w, which is the subject of this work. The predicted amino acid sequence of the product of this YBR131w does not show any significant homology to a protein of known function from any species. We have found previously that the deletion of YBR131w does not affect the growth of yeast cells on standard media. However, a diploid strain homozygous for the YBR131w deletion failed to sporulate. In addition the ybr131w mutant, both the haploid and homozygous diploid, displayed increased sensitivity to caffeine, calcium and zinc. To emphasise this phenotype we named the gene CCZ1 (Kucharczyk et al., 1999). Genes that respond to increased ion concentrations belong to a number of related functional categories, such as homeostasis of metal ions, signalling, vesicular transport, endocytosis, vacuolar transport and biogenesis. In this paper we present data indicating that CCZ1 encodes a new member of class B VPS (Vacuolar Protein Sorting) genes (Raymond et al., 1992). Yeast strains with a deleted CCZ1 gene show abnormalities in vacuolar morphology and function. We show that the gene product localises predominantly to the late endosomal compartment, but there are two distinct routes from Golgi-tovacuole: (1) trafficking through an endocytic compartment (PVC, prevacuolar compartment), used by carboxypeptidase Y (CPY), and (2) bypassing the endosome, used by alkaline phosphatase (ALP) (for reviews see Bryant and Stevens, 1998; Conibear and Stevens, 1998), and both these routes are disturbed in the ccz1 mutant. Uptake of the endocytic markers FM4-64 stain (Vida and Emr, 1995) and uracil permease Fur4p (Volland et al., 1994) revealed that the internalisation step is not affected in ccz1 cells and the defect is limited to the very last stage of delivery of the cargo to the vacuole. The phenotype of the ccz1 mutant is clearcut, so it was possible to use a genetic screen selecting for multicopy suppressors that enable the mutant to grow on high-calcium and/or high-zinc media. That led to the identification of four genes. Three of them, PMR1, PMC1 and ZRC1 (Rudolph et al., 1993; Cunningham and Fink, 1994; Kamizono et al., 1989), partially restored the wild type when overexpressed in ccz1 cells. The fourth one, YPT7 encoding a ras-like GTPase (Wichmann et al., 1992; Schimmoller and Riezman, 1993;

2 4302 R. Kucharczyk and others Table 1. Yeast strains Strain Genotype Source W303 MATa/α; ura3-1/ura3-1 leu2-3,112/leu2-3, Rothstein collection 112 his3-11,15 /his3-11,15 trp1-1/trp1-1 ade2-1 /ade2-1 can1-100/can1-100 SIIV07-6C* MAT a ccz1::kanmx4 Kucharczyk et al., 1999 SIIV07-6D* MATα 1 ccz1::kanmx4 Kucharczyk et al., 1999 SIIV09* MATα / MATa ccz1::kanmx4/ ccz1::kanmx4 Kucharczyk et al., 1999 W303 pep4* MAT α pep4::kanmx4 Provided by M.-O. Blondel RH1 MAT a his4 bar1 ypt7::ura3 Provided by T. Lazar MSUC-1A MAT a ade8 ypt7::his3 Max-Planck Institute, Gottingen RKY45-1C MATα ypt7::ura3 ccz1::kanmx4 This study RH2605 MATα end13-1leu2 ura3 his4 bar1 Munn and Riezman, 1994 *These strains harbor the following additional mutations: ade2-1 can1-100 his3,11-15 leu2-3,112 trp1-1 ura3-1. Table 2. Plasmids pycg_ybr131w CEN6 ARSH4 URA3 CCZ1 Kucharczyk et al., 1999 prk15 CEN6 ARSH4 URA3 CCZ1::HA This study prk20 (prs304 Integrative TRP1) CCZ1::HA This study prk11 Yep352[CCZ1] This study prk101s ZRC1, isolate from library in pembl Ye31 This study prk102s & 103S CCZ1, isolate from library in pembl Ye31 This study prk104s & 105S ZRC1, isolate from library in pfl46s This study prk106s YPT7, isolate from library in pfl46s This study prk107s & 108S PMC1, isolate from library in pembl Ye31 This study prk109s & 110S PMR1, isolate from library in pembl Ye31 This study prk111s YKL160w, isolate from library in pembl Ye31 This study prin82 prs425[nhx1::gfp] Nass and Rao, 1998 pyes2-ypt51 2µ URA3 YPT51 prs326-ypt53 2µ URA3 YPT53 T. Lazar, Max-Planck Institute, prs326-ypt31 2µ URA3 YPT31 Gottingen prs326-sec4 2µ URA3 SEC4 p195gf 2µ URA3 P GAL10-FUR4 Volland et al., 1994 Lazar et al., 1997), suppressed the effect of CCZ1 deletion completely. The functional linkage between CCZ1 and YPT7 genes was confirmed by phenotypic similarities between the ccz1 and ypt7 mutants. MATERIALS AND METHODS Media and growth conditions The S. cerevisiae strains and plasmids used in this study are described in Tables 1 and 2, respectively. E. coli DH5a was used for plasmid preparation (Sambrook et al., 1989). Standard complete YPD, YPGal, minimal SD and SC-drop-out media were used (Adams et al., 1997). For biochemical analysis, cells were grown in liquid medium at 30 C with vigorous agitation. Growth was followed by counting cells in a haemocytometer or by measurement of absorbance (OD) at 600 nm. Genetic analysis Standard media and procedures were used for crossing, sporulation and tetrad analysis (Rose et al., 1990). The efficiency of zygote formation and sporulation was assessed by direct microscopic examination. Phenotypic characterisation of ion sensitivities For testing the sensitivity to caffeine, Ca 2+ and Zn 2+, YPD solid medium was supplemented with: 5-12 mm caffeine, mm CaCl 2 and 3-7 mm ZnCl 2 (Rieger et al., 1997). Sensitivity was determined by dilution spot assay. For each strain tested, four serial 33-fold dilutions were made from a saturated overnight culture diluted to a starting concentration of cells/ml. 5 µl portions of each cell suspension were spotted on the plates. The plates were incubated at 30 C for 3-5 days. One particular concentration that gave the most distinct difference between wild type and mutants was chosen for presentation. DNA manipulations Routine DNA manipulations, i.e. plasmid preparation, subcloning, transformation and transfection of E. coli and agarose gel electrophoresis were carried out as described in Sambrook et al. (1989). Yeast transformations were performed by the improved lithium acetate procedure (Gietz et al., 1995). To isolate plasmid DNA from yeast cells for the transformation of E. coli and to prepare chromosomal DNA for PCR, the procedures described by Hoffman and Winston (1987) were used. Oligonucleotide primers were prepared using a Beckman Oligo 1000M DNA Synthesiser according to the manufacturer s instructions. Sequencing reactions were carried out using ABI Prism BigDye terminator cycle sequencing ready reaction kit with unlabelled primers, and analysed on an ABI310 Genetic Analyser (Perkin-Elmer). Isolation of plasmids conferring Ca 2+ and Zn 2+ tolerance of the ccz1 mutant Strain SIIV09 was transformed with either of the two yeast genomic libraries constructed in the high-copy-number vectors pfl46s (a gift from F. Lacroute; partial digestion with Sau3AI) and pembl Ye31 (a gift from D. Thomas; partial digestion with HindIII), and grown at 30 C on solid synthetic medium lacking leucine. Colonies were then replica-plated onto medium containing 5 mm ZnCl 2 or 500 mm CaCl 2. The colonies were grown for 3 days at 30 C, then purified by subcloning. Plasmid-dependent zinc and calcium resistance was confirmed by the loss of the plasmids and than reintroduction into SIIV09 cells. Plasmid inserts were identified by sequencing from both

3 Ccz1p functions in cooperation with Ypt7p 4303 ends. Genes responsible for ion resistance were deduced from the sequence of overlapping fragments in different plasmids bearing the same part of the yeast genome or by subcloning of fragments from one insert and retransformation into the ccz1 cells. Light microscopy A Nikon Microphot-SA microscope equipped with filters for Nomarski optics and for epifluorescence was used. Cells were viewed at 600 magnification. Photographs were taken with a Nikon FX- 35DX camera with Kodak T-Max 400 film. Visualisation of the yeast vacuole Endogenous ade2 fluorophore was used to label vacuoles as described by Weisman et al. (1987). Cells grown on complete SD medium with 12 µg/ml of adenine were collected in the late logarithmic phase of growth and observed under fluorescence microscopy by exciting with nm light. Vacuolar staining with FM4-64 Uptake and transport to the vacuole of the styryl dye FM4-64 (Molecular Probes Inc. Eugene, OR, USA) was determined as described by Vida and Emr (1995). Cells grown to OD 600 of were harvested and resuspended at OD in YPD. FM4-64 was added to 40 µm from a 4 mm stock in DMSO. After a preliminary labelling step for 30 minutes at 0 C, the cells were harvested at 4 C, resuspended in fresh YPD at OD and incubated at 28 C or 37 C with vigorous shaking. 100 µl samples were withdrawn after 20, 40, 60 or 120 minutes of incubation, centrifuged, resuspended in fresh YPD at OD , placed on standard slides and immediately viewed with a 546 nm filter. Tagging of Ccz1p with hemaglutinin epitope The triple influenza virus hemaglutinin (HA) epitope that is recognised by the 16B12 (BabCo) mouse monoclonal antibody was inserted into a BglII site between +42 and +43 nucleotides of the CCZ1 gene. The 114 nucleotides encoding the tag were amplified by PCR with primers: 5 CAAGATCTCGCATCTTTTACCCATACG3 and 5 TAGATCTGCAGTGAGCAGCGTAATCTG3 with BglII restriction sequences (underlined), using pbf30 plasmid (Żoĺądek et al., 1995) containing the HA epitope coding sequence as a template. The amplified HA sequence was digested by BglII and cloned into the coding sequence of CCZ1 gene (plasmid prk15, Table 2). The construction was confirmed by DNA sequencing and complementation test of ccz1. The CCZ1-HA construct was subcloned into prs304, a TRP1 integrative vector, using SacI-KpnI restriction sites, to give prk20. Subcellular localisation of HA epitope-tagged Ccz1p by immunofluorescence Detection of the cellular Ccz1-HA protein by indirect immunofluorescence microscopy was performed as described by Pringle et al., As the first antibody we used anti-ha mouse antibody (raw ascites fluid, clone 16B12, BabCo) at 1:750 dilution, and goat anti-mouse Cy3-conjugated antibody (Jackson ImmunoResearch Lab. Inc.) was used as the secondary antibody at 1:250 dilution. The same samples were stained for DNA. The secondary antiserum was washed off, then the preparation was incubated with 20 µl of DAPI (4, 6-diamino-2-phenylindole dihydrochloride) at a final concentration of 0.04 µg/ml for 2 minutes, followed by two washes with distilled water. A drop of mounting medium was placed on the slide and covered with coverslips, sealed with nail polish and viewed under microscope. If necessary, preparations were stored at 20 o C. Subcellular localisation of HA epitope-tagged Ccz1p by cell fractionation and immunoblot analysis Cellular fractionation was performed by differential centrifugation. ccz1 cells bearing the CCZ1-HA tagged construct on multicopy plasmids were grown in uracil drop-out medium, collected at a density (OD 600) 1.4, washed with water and spheroplasts and spheroplast lysates prepared as described by Hoffman and Chiang, The lysate was centrifuged at 300 g for 15 minutes to remove unbroken cells. The 300 g supernatant was fractionated by centrifugation at g for 15 minutes. The pellet was resuspended in TEA buffer (fraction P13) and the supernatant (fraction 13S) was further centrifuged at 100,000 g for 2 hours to obtain the cytosolic (100S) and membrane (100P) fractions, which were mixed with electrophoresis sample buffer. Proteins (40-60 µg) were separated on 10% SDS-PAGE gels and immunoblotted with anti-ha antibody. An alkaline phosphatase-coupled secondary antibody was used to detect the primary antibody. Yeast cell extracts and immunoblotting For the immunodetection of carboxypeptidase Y (CPY) and alkaline phosphatase (ALP), cells were grown in YPD and collected at exponential growth phase ( cells). Protein extracts were prepared from a 3 ml culture as described by Volland et al. (1994), except that they were heated for 4 minutes at 95 C. Precipitated proteins were separated by SDS-PAGE on 10% Tricine gels and analysed by immunoblots, using either a polyclonal antibody raised against CPY (a kind gift of Howard Riezman) or a monoclonal antibody against ALP (Molecular Probes, Eugene, Oregon, USA). Primary antibodies were detected with a horseradish peroxidase-conjugated anti-rabbit or antimouse IgG secondary antibody, followed by BM chemiluminescence (Boehringer Mannheim). For the immunodetection of uracil permease, cells expressing FUR4 from a multicopy plasmid p195gf were used. Transformants were grown at 30 C in SC medium supplemented with 4% galactose and 0.02% glucose to a density (OD 600) 0.6. Protein extracts were prepared as described above (except for treatment at 37 C instead of 95 C) and analysed by immunoblots. Permease was immunodetected using a rabbit antiserum against the last 10 residues of the permease. Primary antibodies were detected with a horseradish peroxidase-conjugated anti-rabbit IgG (Volland et al., 1994). For quantification of the western blot, the nitrocellulose sheet was reprobed using the Chemiluminescent kit ECL-Plus (Amersham), followed by analysis on a Storm 860 (Amersham, Pharmacia), and quantification was made using ImageQuant software. Detection of secreted CPY For the detection of secreted CPY, cells were grown on YPD plates for 48 hours in contact with a 0.45 µm nitrocellulose filter (Schleicher and Schuell). The filter was then removed from the plate, the cells were washed off with water and the presence of immunodetectable CPY was tested as described above (Roberts et al., 1991). Uracil permease activity Uracil uptake, used to quantify the amount of cell-surface permease was measured in exponentially growing cells after permease induction (Volland et al., 1994). Pulse-chase labelling and immunoprecipitation of CPY Yeast cells were grown in YNB medium with glucose as a carbon source to a density (OD 600) cells/ml. They were collected, resuspended in fresh medium at OD and incubated for 15 minutes at 30 C. Cells were labelled for 5 minutes by adding 150 µci [ 35 S]-Translabel (NEN) per ml culture and chased with 10 mm cold methionine plus cysteine. Portions of the culture (0.3 ml) were removed at various times during the chase, and cell extracts prepared by lysis with 0.2 M NaOH for 10 minutes on ice. Precipitated proteins were processed for immunoprecipitation (using a polyclonal antibody kindly provided by H. Riezman) as described (Volland et al., 1992), except that they were heated for 4 minutes at 95 C. Immunoprecipitated proteins were separated by SDS-PAGE on 7.5% Tricine gels, and the radioactivity was detected by fluorography as described (Volland et al., 1992).

4 4304 R. Kucharczyk and others RESULTS Vacuolar morphology in ccz1 mutants Yeast cell vacuole is the main storage reservoir for calcium and other divalent cations. It is essential in such complex functions and processes as ion homeostasis, osmoregulation and sporulation (Dunn et al., 1994; Jones et al., 1997; Klionsky, 1998; Conibear and Stevens, 1998 and references therein). Therefore the increased sensitivity to Ca 2+ and Zn 2+ of the ccz1 mutant and inability of the ccz1 /ccz1 diploid to sporulate could be ascribed to the defective vacuoles. We used Nomarski optics and fluorescence microscopy to examine the morphology of the vacuole in ccz1 cells in comparison with the wild-type strain. Endogenous ade2 fluorophore was used to label the vacuoles (Weisman et al., 1987). As shown in Fig. 1, wild-type cells typically contain a single large fluorescent spot that corresponds to a structure of low refraction coefficient visible using Nomarski optics (Fig. 1A). In contrast the ccz1 cells have multiple small structures that accumulate the ade2 fluorophore (Fig. 1B). The altered vacuolar morphology resembled the structures displayed by mutant cells classified as category B of vacuolar vps mutants (Raymond et al., 1992). Ccz1p colocalises with Nhx1p to the prevacuolar compartment In order to determine the subcellular localisation of the Ccz1 protein we constructed the gene encoding a fusion protein containing the 38-amino-acid HA segment between the fourteenth and fifteenth amino acids of the Ccz1p. Expression of the tagged protein was under the control of the CCZ1 promoter. The diploid SIIV09 (ccz1 /ccz1 ) and haploid SIIV07-6C (ccz1 ) cells transformed with the CCZ1-HA gene (plasmid prk15) were tested for their ability to grow on medium supplemented with 5 mm ZnCl 2 or 500 mm CaCl 2. The transformed diploid was tested for its ability to sporulate. Cells transformed with the wild-type CCZ1 gene (pycg_ybr131) were used as positive controls and SIIV09 was the negative control. The tagged construct fully complemented the CCZ1 deficiency in the growth tests; it also complemented the sporulation defect of the ccz1 /ccz1 homozygous diploids and restored normal morphology of vacuoles (data not shown). To examine the distribution of the tagged Ccz1 protein we used indirect immunofluorescence microscopy. Fluorescently labelled Ccz1-HAp appeared mainly as 1-2 bright dots adjacent to vacuoles, typical for proteins of late endosomal (prevacuolar) compartment (Piper et al., 1995), accompanied by small, discrete dots scattered all over the cell (Fig. 2B,C). Moreover Ccz1-HA protein mostly colocalised with Nhx1- GFP (Fig. 2A), which was used as a marker of the prevacuolar compartment (Nass and Rao, 1998), although some Ccz1-HAp was found in small vesicles. To exclude the possibility that overexpressed NHX1 induces accumulation of the late endosomes we tested the localisation of Ccz1-HAp in a ccz1 strain bearing a single, integrated copy of the CCZ1-HA fusion gene. As shown in Fig. 2C the localisation of Ccz1-HAp in such cells was similar to the one presented in Fig. 2B. As shown in Fig. 2D, anti-ha antibody exhibited negligible cytoplasmic staining on a strain lacking the Ccz1-HA protein. The vesicular localisation of Ccz1p was further supported by cell fractionation. The Ccz1-HAp was recovered in Fig. 1. Abnormal vacuolar morphology of ccz1 mutant cells. Cells grown in liquid complete SD medium were collected at late log phase. Vacuoles were labelled with ade2 endogenous fluorophore. Cells were viewed by Nomarski optics (left) and the same fields for fluorescence (right). Wild-type vacuoles appear as large fluorescent spots corresponding to circular indentations when viewed by Nomarski optics (A). Vacuoles of the mutant appear as numerous, fluorescent spots corresponding to irregular structures in Nomarski optics (B). approximately equal amounts of the g and 100,000 g pellets (Fig. 2E), which contain vacuolar and prevacuolar membranes (P13) and Golgi membranes and transport vesicles (P100) (Wada et al., 1997; Nass and Rao, 1998; Gerrard et al., 2000). Immunofluorescence microscopy (Fig. 2B,C) revealed that Ccz1p was not vacuolar, therefore the fractionation experiment confirms the vesicular localisation of Ccz1p and indicates its membranous character. Ccz1p is required for a postinternalisation step of endocytosis The aberrant vacuolar morphology of ccz1 cells and vesicular localisation of Ccz1p prompted us to check whether the mutant exhibits an endocytic-deficient phenotype. We first used the fluorescent lipophylic styryl dye FM4-64, which allowed us to follow bulk-membrane internalisation from the plasma membrane to the vacuolar membrane via intracellular vesicle membranes. Direct kinetic analysis of endocytic transport of the dye was performed in wild-type and ccz1 cells in a pulsechase experiment (Vida and Emr, 1995). After preincubation with the dye for 30 minutes at 0 C the washed cells were incubated in fresh medium at 28 C. The localisation of FM 4-64 was monitored microscopically every 20 minutes for 3 hours and examples are shown in Fig. 3 at the significant time

5 Ccz1p functions in cooperation with Ypt7p 4305 Fig. 2. Ccz1p mainly colocalises with Nhx1p, in the prevacuolar compartment. Distribution of fluorescence was viewed in ccz1 cells bearing the integrated CCZ1-HA tagged construct transformed with NHX1-GFP fusion. Transformants were grown in leucine drop-out medium, collected at log phase, fixed and stained with antibodies to HA epitope and secondary goat anti-mouse Cy3-conjugated antibody. (A) Nhx1-GFP appears as one or two fluorescent spots. (B) The big fluorescent spots of Ccz1-HAp superimposed on those of the marker protein are accompanied by numerous, vesicle-like, small spots. (C) The Ccz1-HA dependent fluorescence in ccz1 cells. (D) The anti-ha antibody staining of ccz1 cells lacking the Ccz1-HA protein. (E) Distribution of Ccz1-HAp in subcellular fractions. Spheroplasts of ccz1 strains bearing CCZ1-HA fusion on multicopy plasmid (prk18) were lysed and after removing cell debries, the lysate (TL) was spun at g to yield pellet (13P) and supernatant (13S) fractions. The 13S supernatant was further spun at 100,000 g to give the pellet (100P) and supernatant (100S) fractions. Each fraction was analysed by immunoblotting using anti-ha antibodies. points. At zero time in both wild-type and mutant cells (Fig. 3A and B, respectively) the dye stained the plasma membrane. Differences between the wild-type and mutant cells were observed after as little as 20 minutes of incubation. In wildtype cells a few fluorescent dots appeared in the proximity of the vacuole whereas in ccz1 cells numerous small dots were observed. By 60 minutes, the difference between wild-type and mutant cells was striking. In wild-type cells the dye stained the vacuolar membrane and for the next 2 hours there were no further changes in its localisation. At the same time in Ccz1pdeficient cells the fluorescence still appeared as numerous dots representing endocytic intermediates and only after 2 hours of incubation were the membranes of aberrant vacuolar structures stained. These results indicate that CCZ1 deletion leads to a delay in endosome-to-vacuole transport. Another way to probe endocytosis is to follow the clearance of permease transporters from the plasma membrane and their subsequent vacuolar degradation (Volland et al., 1994; Hein et al., 1995; Lai et al., 1995). To follow endocytosis in ccz1 cells we used uracil permease encoded by FUR4 as a marker. Uracil permease undergoes internalisation at basal rates and subsequent degradation in actively growing cells (Volland et al., 1994; Galan et al., 1996). Excess substrate (Seron et al., 1999), or stress conditions such as heat shock, nutrient deprivation or inhibition of protein synthesis, result in acceleration of the permease turnover rate (Volland et al., 1994; Galan et al., 1996). Both basal and accelerated internalisation depends on the Npi1p/Rsp5p ubiquitin protein ligase, which is required for permease ubiquitination. Once internalised, permease is targeted to the vacuole for degradation in a PEP4- dependent, proteasome-independent way (Galan et al., 1996). The fate of plasma membrane uracil permease was followed in wild-type and ccz1 cells after addition of cycloheximide. Two simultaneous tests were employed. The rate of uracil uptake by the cell was measured as an accurate index of plasma membrane-located permease. The degradation rate of uracil permease was analysed by western immunodetection of Fur4p in protein extracts. After addition of cycloheximide, wild-type and disrupted cells exhibited a similar time-dependent loss of uracil uptake (Fig. 4A), indicating that the disruption did not inhibit permease internalisation. In contrast, the rate of permease degradation was strongly reduced in ccz1 cells (Fig. 4B). The pool of permease originally present in CCZ1 cells was noticeably degraded by 30 minutes, and had completely disappeared in 2 hours. On the contrary much less degradation was observed in ccz1 cells, which still exhibited a strong permease signal 2 hours after the addition of cycloheximide. Quantification of the data (Fig. 4C) led to estimate that t 1/2 of permease degradation was increased at least threefold in ccz1 cells compared to the wild-type cells. These observations show that Ccz1p is involved in postinternalisation steps of the endocytic pathway, or in Fur4p vacuolar degradation. Processing and targeting of vacuolar proteins is defective in the ccz1 null mutant The abnormal vacuolar morphology and defects in endocytosis suggested that protein transport to the vacuole and/or vacuolar function might be disturbed in ccz1 cells. The yeast vacuole receives material from two vesicular pathways: biosynthetic vesicular traffic from the Golgi apparatus and endocytic vesicular traffic from the cell surface. We checked whether biosynthetic delivery and processing of vacuolar hydrolases is affected in ccz1 cells using the marker enzyme carboxypeptidase Y (CPY), which reaches the vacuole via the prevacuolar compartment (Bryant and Stevens, 1998). CPY is synthesised as a precursor, which is translocated into the lumen of the ER where it is coreglycosylated. This ER form of CPY (p1 CPY) is 67 kda in size. In the Golgi compartment, CPY is further glycosylated, which increases its size to 69 kda (p2 CPY). CPY is finally transported via late endosomes to the vacuole, where it is processed to the 61

6 4306 R. Kucharczyk and others Fig. 3. The delay of FM4-64 transfer from plasma membrane to vacuole in ccz1 mutant cells (B) as compared to the wild-type (A). Cells were incubated with 40 µm FM4-64 for 30 minutes at 0 C. The dye was removed by centrifugation and cells were incubated in fresh YPD medium. Every 20 minutes of incubation portions were removed and photographed. Left, Nomarski optics; right, FM4-64 fluorescence. kda mature species (mcpy) by proteinase A (PrA), the product of the PEP4 gene (Ammerer et al., 1986; Graham and Emr, 1991). We analysed the fate of CPY in wild-type and ccz1 cells by pulse-chase experiment and subsequent immunoprecipitation (Fig. 5). Formation of the p1 form and processing from p1 to p2 occurred similarly in the wild-type and mutant strains, indicating that translocation across the endoplasmic reticulum (ER) membrane and transit from the ER to the Golgi is normal in ccz1 cells. However, processing from p2 to mature CPY was strongly delayed in the mutant. Whereas mcpy appeared after 10 minutes chase, and processing was complete after 40 minutes chase in wild-type cells, long exposure of the film was necessary in order to detect tiny amounts of mcpy after a 40 minute chase in mutant cells. In agreement with this observation, western

7 Ccz1p functions in cooperation with Ypt7p 4307 Fig. 5. Delayed CPY maturation in ccz1 cells. Wild-type and mutant cells were labelled with [ 35 S]-Translabel (NEN) for 5 minutes and chased for the indicated times in the presence of 10 mm cold methionine plus cysteine. The immunoprecipitated CPY forms were separated by SDS-PAGE. Fig. 4. Degradation of uracil permease is impaired in ccz1 cells. CCZ1 and ccz1 cells transformed with the plasmid p195gf (2 µ URA3 P GAL10-FUR4) were grown to logarithmic phase on galactose medium. Cycloheximide (CHX) at 100 µg/ml was added to the medium (A). Uracil uptake was measured at different times after the addition of CHX. The results are expressed as percentage of initial activity. (B) Protein extracts were prepared in parallel at the times indicated and analysed by western immunoblotting. Permease appeared in total extracts as several bands corresponding to the various phosphorylated states of uracil permease (Volland et al., 1992). (C) Quantitation of protein bands using Storm 860 and ImageQuant software. The results are expressed as percentage of initial protein concentration. Filled circles, wild type; filled triangles, ccz1. immunoblotting of total protein extracts revealed decreased steady state amounts of mcpy in ccz1 cells, and accumulation of p2 CPY, which had the same electrophoretic mobility as in control pep4 cells, lacking vacuolar PrA (Fig. 6A). Hence, CCZ1 deletion impairs CPY Golgi-to-vacuole trafficking, or CPY vacuolar processing. In order to further characterise the deficiency in ccz1 cells, we analysed the fate of another vacuolar marker, the membrane-bound alkaline phosphatase (ALP). This enzyme is a type II membrane glycoprotein, which is targeted from the Golgi to the vacuole by an alternative pathway, bypassing the late endosome/prevacuolar compartment (Cowles et al., 1997; Piper et al., 1997; Stepp et al., 1997). It undergoes PEP4- dependent proteolytic processing upon reaching the vacuole (Klionsky and Emr, 1989). Western immunoblots of total protein extracts revealed in ccz1 cells mainly unprocessed ALP, of the same electrophoretic mobility as the form observed in ypt7 cells (Fig. 6B) (or in pep4 cells; data not shown). It is noteworthy that the ALP sorting defect in ccz1 cells appears stronger than that in ypt7 cells; the unprocessed form is far more abundant than the mature form of ALP. In order to further discriminate between a defect of trafficking, or merely an impaired proteolytic processing, of the above vacuolar proteins, we checked ccz1 cells by colony immunoblots. It has long been reported that most vps mutants that fail to deliver CPY to the vacuole display an aberrant secretion of CPY and other vacuolar hydrolases to the medium (Rothman and Stevens, 1986; Raymond et al., 1992). Secreted CPY can be detected by colony immunoblot. Interestingly, pep4 mutant cells that target CPY correctly to the vacuole, but fail to process it, do not display CPY secretion (Rothman et al., 1989; Munn and Riezman, 1994). The ccz1 cells exhibited significant CPY secretion (Fig. 6C). The extent of secretion is slightly lower than observed in the case of control vps4 cells, which secrete 43-48% of newly synthesised CPY, as determined by quantitative immunoprecipitation; however, it is known that within each class of vps mutants CPY is secreted to variable extents (Raymond et al., 1992; Munn and Riezman, 1994). Taken together, these data indicate that the delay in CPY processing in ccz1 cells results from defective Golgi-tovacuole trafficking, and not from deficient processing per se. The observation that both CPY and ALP trafficking are altered suggests impairment at the very last step of Golgi-to-vacuole targeting, where the CPY and ALP pathways converge, i.e. the fusion of vesicles to the vacuolar membrane. Multicopy suppressors of ccz1 To further define the role of Ccz1p in the endocytic pathway we looked for other proteins that interact or in any way modulate the function of Ccz1p. We did that by searching for multicopy suppressors that allowed the ccz1 mutant to grow on YPD medium supplemented with 500 mm CaCl 2 or 5 mm ZnCl 2, concentrations which completely inhibit the growth of the ccz1 strain. S. cerevisiae genomic libraries constructed in

8 4308 R. Kucharczyk and others Table 3. Growth of various S. cerevisiae deletion strains on solid YPD media supplemented with Zn 2+, Ca 2+, Mn 2+ or caffeine YPD+ YPD+ YPD+ YPD+ Relevant ZnCl 2 CaCl 2 MnCl 2 Caffeine genotype YPD (5 mm) (0.5 M) (6 mm) (7.5 mm) Wild type ccz ypt ccz1 ypt ccz1 [YPT7] ccz1 [YPT51] ccz1 [YPT53] ccz1 [SEC4] ccz1 [YPT31] ypt7 [CCZ1] Gene names given in square brackets denote genes introduced into yeast cells on the multicopy vector. Growth was tested on the indicated media as described (Rieger et al., 1997). The growth of the strains was classified as follows: ( ) none, (±) very poor, (+) poor, (++) reduced, (+++) normal. Fig. 6. The ccz1 mutant cells display a vacuolar protein sorting defect. Total cell lysates were prepared from exponentially growing CCZ1, ccz1, pep4 or ypt7 cells. Carboxypeptidase Y, CPY (A) and alkaline phosphatase, ALP (B), were analysed by SDS-PAGE and immunoblotting. The positions of the Golgi-derived p2cpy and proalp and mature mcpy and malp forms are indicated. (C) The secreted CPY was detected by colony immunoblot. For the detection of secreted CPY, CCZ1, vps4 (end13-1) and ccz1 cells were grown on YPD plates for 48 hours in contact with a nitrocellulose filter. The filter was removed from the plate, the cells were washed off with water and the presence of immunodetectable CPY was probed with polyclonal antibody raised against CPY. the high-copy-number vectors PFL46S and pembl Ye31 were introduced into the ccz1 /ccz1 strain. From and Leu + transformants, respectively, seven grew on a plate containing 500 mm CaCl 2. Standard subcloning of recovered plasmids followed by the determination of DNA sequence revealed that two plasmids contained the PMC1 gene and two contained the PMR1 gene, both of which encode Ca 2+ -ATPases involved in calcium homeostasis (Antebi and Fink, 1992; Rudolph et al., 1993; Cunningham and Fink, 1996; Halachmi and Eilam, 1996). Two plasmids contained the CCZ1 gene. The zinc sensitivity, inability to sporulate and altered morphology of vacuoles were not suppressed by an increased gene dosage of suppressor genes (Fig. 7, Table 3). Another six transformants were able to grow on a plate containing 5 mm Zn 2+. The restriction and sequence analyses of recovered plasmids revealed that two of them harboured the wild-type CCZ1 gene. Three plasmids contained the ZRC1 gene, which confers increased tolerance to high levels of zinc. The product of that gene is responsible for intracellular zinc detoxification by removing the metal from the cytoplasm to the cell exterior (Conklin et al., 1994). The multicopy plasmid prk105s bearing the ZRC1 gene restored only the growth of ccz1 on zinc medium and failed to suppress other phenotypes of the CCZ1 null mutant. The most interesting plasmid was prk17, bearing the YPT7 gene encoding a small GTPase involved in Fig. 7. Suppression of Zn 2+ and Ca 2+ sensitivity of ccz1 mutants by high-copy-number plasmids bearing the indicated genes. Cells were grown for 2 days at 28 C in leu drop-out medium. Four serial 33-fold dilutions were made from a saturated overnight culture diluted to a starting concentration of cells/ml. 5 µl portions of the third and fourth dilution were spotted onto YPD plates supplemented with 5 mm ZnCl 2 (left) and 500 mm CaCl 2 (right). Pictures were taken after 4 days of incubation at 28 C. the transport between late endosomes and vacuoles (Schimmoller and Riezman, 1993). It suppressed both zinc and calcium sensitivity and in addition restored the wild-type vacuole morphology and to a certain extent the ability of ccz1 /ccz1 diploid to sporulate (6-7% of cell population as

9 Ccz1p functions in cooperation with Ypt7p 4309 compared to 60% of CCZ1/CCZ1 diploid). Control experiments revealed that none of the isolated genes functioned as a ccz1 suppressor when expressed from a low copy centromeric plasmid (data not shown). Loss of Ypt7p function has the same phenotypic effects as the deletion of CCZ1 The ras-like GTPase Ypt7p functions in the endocytic pathway and is involved in two processes: late endosome-to-vacuole transport and vacuole-vacuole fusion (for a review see Lazar et al., 1997). Cells lacking either Ypt7p or Ccz1p function share an identical set of phenotypes. Ypt7p, like Ccz1p, is not essential for cell viability; vacuoles of ypt7 cells, like those of ccz1 cells, are fragmented and vacuolar hydrolases are partially secreted to the medium (Wichmann et al., 1992; Schimmoller and Riezman, 1993; Haas et al., 1995). Since increased gene dosage of YPT 7 suppressed the growth defect of ccz1 mutants on both high Zn 2+ and high Ca 2+ medium, and restored the vacuolar morphology and ability to sporulate of the ccz1 /ccz1 homozygous diploid, it seemed possible that Ccz1p and Ypt7p act in the same stage of the transport pathway. To investigate the specificity of the CCZ1-YPT7 functional interaction we tested the growth phenotypes of the ccz1 mutant transformed with multicopy plasmids bearing the genes YPT31, YPT51, YPT53 and SEC4, encoding guanine nucleotide-binding proteins whose products are involved in different steps of vesicular traffic. Ypt31p is a component of the intra-golgi transport system, and Ypt51p and Ypt53p function between the early endosome and prevacuolar compartment. Sec4p takes part in the transport between Golgi and plasma membrane and in exocytosis (for a review see Lazar et al., 1997). It appeared that none of them abolished the effects of the CCZ1 deletion (Table 3). By tetrad analysis of the heterozygous diploid ccz1::kanmx4 +/+ ypt7::his3 we obtained double mutants ccz1 ypt7, which together with the ypt7 haploid and ypt7 /ypt7 diploid strains were subjected to phenotypic tests under the same conditions as for the ccz1 mutant. The data presented in Table 3 demonstrate that both mutants are identical with respect to ion sensitivity. Deletion of YPT7 also caused increased sensitivity to caffeine, and the homozygous diploid ypt7 /ypt7 failed to sporulate. The phenotype of the double mutant ccz1 ypt7 did not differ from that of ccz1 and ypt7 parents (Table 3). Increased dosage of ZRC1, PMC1 and PMR1 but not CCZ1 suppresses the ion-mediated growth defect of the ypt7 mutant Since the increased gene dosage of YPT7 compensated for the loss of CCZ1 function we expected that increased dosage of CCZ1 might be able to compensate for the loss of YPT7 function. Therefore we transformed both the ypt7 /ypt7 diploid and ypt7 haploid strains with multicopy plasmid prk11 bearing the CCZ1 gene and transformants were tested for growth on medium containing 500 mm CaCl 2 or 5 mm ZnCl 2. The diploid strain was checked for ability to sporulate. It appeared that none of the defects found for the ypt7 mutant were suppressed by high dosage of Ccz1p, whereas the genes found as multicopy suppressors of ccz1, ZRC1, PMC1 and PMR1, suppressed the ypt7 growth defect. The picture obtained for the ypt7 strain transformed with the plasmids prk101, prk107, prk109 and prk111 harbouring genes ZRC1, PMC1 and PMR1, respectively, was identical to that presented in Fig. 7 for the ccz1 strain transformed with the same plasmids. The overexpressed ZRC1 gene restored the growth of the mutant exclusively on Zn 2+ medium while PMC1 and PMR1 restored the growth of ypt7 only on Ca 2+ medium (data not shown). As was the case for the ccz1 mutant, neither of the tested genes functioned as a ypt7 suppressor when expressed from a centromeric plasmid. DISCUSSION In Saccharomyces cerevisiae, genetic and biochemical studies along with data obtained by computational analysis of the genome have led to the identification of 445 ORFs whose products are, or could be, directly or indirectly involved in intracellular transport (Munich Information Centre for Protein Sequences, MIPS, An increasing number of proteins are currently being identified as associated with cellular organisation and the intracellular transport machinery, which indicates that those 445 ORFs do not comprise a complete list of genes belonging to this functional category. The ORF YBR131w (CCZ1) is an example of a gene encoding a protein whose amino acid sequence is by no means indicative of its function and therefore is not included in the MIPS repertoire. It was originally identified by sensitivity of the null mutant to caffeine and elevated levels of the divalent cations: Ca 2+ and Zn 2+ (Kucharczyk et al., 1999). The results presented in this study clearly show that Ccz1p is required for efficient vesicular transport into vacuoles, and is essential for maintaining the intact structure of this compartment. The loss of CCZ1 function results in fragmented vacuoles, randomly dispersed through the cells in a manner reminiscent of that of vps class B mutants. As for the vps B class, these vacuole-like structures share several characteristic features with wild-type vacuoles. They are stained by an endogenous ade2 fluorophore (Fig. 1) and FM4-64 (Fig. 3) (Weisman et al., 1987; Vida and Emr, 1995), and the morphological abnormalities are associated with pleiotropic defects in vacuolar protein targeting. This aberrant morphology accounts for increased sensitivity of ccz1 cells to divalent cations, as vacuolar function and integrity is essential for ion homeostasis. The vacuole serves as a reservoir for divalent cations. It can sequester high concentrations of ions, including Ca 2+, Mg 2+ and Zn 2+, reaching the vacuole via fluid-phase endocytosis (reviewed in Jones et al., 1997). The system that delivers Ca 2+ to the vacuole, where over 95% of the total cell calcium is accumulated, is the best-characterised. From the numerous genes identified as being involved in calcium homeostasis, two genes, PMR1 and PMC1, both encoding Ca 2+ -ATPases, were isolated as multicopy suppressors that could specifically alleviate the calcium sensitivity of the ccz1 null mutant. Pmr1p functions in the Golgi apparatus as a P-type ion pump sequestering Ca 2+ and Mn 2+, whereas Pmc1p, an integral vacuole membrane protein, transports Ca 2+ from the cytosol into the vacuole (Antebi and Fink, 1992; Rudolph et al., 1993; Cunningham and Fink, 1996; Durr et al., 1998). The only gene that, when overexpressed, suppressed the Zn 2+ but not Ca 2+ sensitivity, was ZRC1, which conferred resistance to zinc and

10 4310 R. Kucharczyk and others cadmium (Kamizono et al., 1989; Conklin et al., 1994). The fact that PMR1 and PMC1 did not suppress the Zn 2+ sensitivity of CCZ1 and YPT7 null mutants indicates that Ca 2+ and Zn 2+ reach the vacuole by different routes. Further experiments on calcium metabolism in the ccz1 mutant are underway. From the genetic studies the most interesting observation was that overexpression of Ypt7p suppresses all defects of Ccz1p-depleted cells. The function of Ypt7p is known. It belongs to the superfamily of ras-like GTP binding proteins, which play an essential role in the regulation of vesicular protein transport. The Ypt/Rab individual proteins act on specific steps of the secretion pathway, ensuring the proper delivery of cargo (Pryer et al., 1992; Lazar et al., 1997; Gerrard et al., 2000 and references therein). Ypt7p, localised in the vacuolar membrane, controls transport from late endosomes to the vacuole and homotypic vacuole fusion. The ypt7 mutants were classified as class B vps (Wichmann et al., 1992; Haas et al., 1995). The functional linkage of Ccz1p and Ypt7p was further revealed by results showing that growth phenotypes of ccz1 cells are shared with the ypt7 null mutation (Table 3, Fig. 6). This indicates that Ccz1p and Ypt7p mediate a common transport step, although Ccz1p is located in the membrane of endosome like small vesicles and in the late endosomal compartment (Fig. 2). The specificity of the YPT7- CCZ1 functional interaction is strengthened by the observation that other Ypt-GTPases, when overexpressed, did not alleviate the growth defect of the ccz1 mutant. Assuming that Ccz1p and Ypt7p cooperate, the function of Ypt7p seems to be superior to that of Ccz1p since neither the CCZ1 overexpression nor the deletion were able to suppress the growth phenotype displayed by the ypt7 mutant. The involvement of Ccz1p in endocytosis was confirmed by following the fate of two endocytic markers, uracil permease (Fur4p) and the styryl dye FM4-64, in ccz1 cells. It appeared that internalisation of both markers (Figs 4 and 3, respectively) was not affected in Ccz1p-depleted cells but the mutant cells were severely inhibited in Fur4p degradation. This inhibition, observed in ccz1 cells (Fig. 4), parallels the picture of inhibition of α factor degradation in ypt7 null mutant (Wichmann et al., 1992). Although the degradation of Fur4p was used as an assay for vacuolar delivery of endocytosed proteins (Volland et al., 1994; Galan et al., 1996), impairment in its degradation could be the result of a low level of vacuolar hydrolases. However, the delay in the rate at which the reporter styryl dye FM4-64 was transported from plasma membrane to the aberrant, vacuole-like organelles in ccz1 cells (Fig. 3) strongly supports the presumption that ccz1 cells exhibit a defect in transport to the vacuole. In the vacuolar transport system of Saccharomyces cerevisiae, the endocytic pathway originating in the plasma membrane converges in the late endosome (prevacuolar compartment, PVC) with the CPY pathway originating in the Golgi (Gerrard et al., 2000). It appears that CCZ1 deletion also impairs Golgi-derived transport of CPY to the vacuole. It was demonstrated in the pulse-chase experiment, in which the pronounced delay in processing from p2 to mature CPY in the mutant was observed (Fig. 5). Also the steady state pattern of CPY reveals the presence of the p2 form of CPY together with an appreciable fraction of the mature form mcpy (Fig. 6A). These data show that maturation of soluble hydrolases takes place in ccz1 cells; however, the processing is much slower than in wild-type cells. The missorting of CPY also indicates a defect in the vesicular transport, through the prevacuolar/ endosomal compartment (PVC) (for reviews, see Bryant and Stevens, 1998; Conibear and Stevens, 1998). Loss of Ccz1p also led to accumulation of the premature form of membrane-bound vacuolar alkaline phosphatase, trafficking by the Golgi-to-vacuole pathway and bypassing the prevacuolar endosome (Piper et al., 1997). The disturbances in three transport pathways to the vacuole caused by Ccz1p depletion were the same as those caused by deletion of YPT7 (Wiechmann et al., 1992) although the defect in ALP pathway was more pronounced in ccz1 than in ypt7 strains. Altogether our data indicate that Ccz1p functions at a very late stage of fusion with the vacuole of three different vesicular transport pathways: endocytic, CPY and ALP pathways. The fusion machinery involves functional interaction of Ccz1p with Ypt7p. Experiments to determine precisely whether the two membrane proteins Ccz1p and Ypt7p, which reside in different compartments, interact physically are in progress. This work was partially supported by the State Committee for Scientific Research Poland Grant No. 6PO4A and Centre Franco-Polonais De Biotechnologie des Plantes. R. K. and J. R. are grateful to the Jumelage Franco-Polonais du CNRS for fellowships during their stay in Paris. We thank Dr D. Gallwitz and T. A. Lazar for ypt7 mutants, Ypt7p antibody and for helpful advice, Dr R. Rao for NHX1-GFP construct. We are indebted to Dr H. Riezman for CPY antibody and end13-1 cells, to M.-O. Blondel for pep4 cells, and to C. Volland for critical reading of the manuscript and to A. Migdalski for technical assistance in preparing the manuscript. REFERENCES Adams, A., Gottschling, D. E., Kaiser, C. A. and Stearns, T. (ed.) (1997). Methods in Yeast Genetics. A Cold Spring Harbor Laboratory Course Manual. CSH Laboratory Press. Ammerer, G., Hunter, C. P., Rothman, J. H. Saari, G. C., Valls, L. A. and Stevens, T. H. (1986). PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing vacuolar proteins. Mol. Cell. Biol. 6, Antebi, A. and Fink, G. R. (1992). The yeast Ca 2+ -ATPase homologue, PMR1, is required for normal Golgi function and localizes in a novel Golgilike distribution. Mol. Biol. Cell. 3, Bryant, N. J. and Stevens, T. H. (1998). Vacuole biogenesis in Saccharomyces cerevisiae: protein transport pathways to the yeast vacuole. Microbiol. Mol. Biol. Rev. 62, Conklin, D. S., Culbertson, M. R. and Kung, C. (1994). Interactions between gene products involved in divalent cation transport in Saccharomyces cerevisiae. Mol. Gen. Genet. 244, Conibear, E. and Stevens, T. H. (1998). Multiple sorting pathway between the late Golgi and the vacuole in yeast. Biochim. Biophys. Acta 1404, Cowles, C. R., Snyder, W. B., Burd, C. G. and Emr, S. D. (1997). Novel Golgi to vacuole delivery pathway in yeast: identification of a sorting determinant and required transport component. EMBO J. 16, Cunningham, K. W. and Fink, G. R. (1994). Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca 2+ -ATPases. J. Cell Biol. 124, Cunningham, K. W. and Fink, G. R. (1996). Calcineurin inhibits VCX1- dependent H + /Ca 2+ exchange and induces Ca 2+ ATPases in Saccharomyces cerevisiae. Mol. Cell. Biol. 16, Dunn, T., Gable, K. and Beeler, T. (1994). Regulation of cellular Ca 2+ by yeast vacuoles. J. Biol. Chem. 269, Durr, G., Strayle, J., Plemper, R., Elbs, S., Klee, S. K., Catty, P., Wolf, D. H. and Rudolph, H. K. (1998). The medial-golgi ion pump Pmr1 supplies the yeast secretory pathway with Ca 2+ and Mn 2+ required for glycosylation,