Visualization of multiple alignments, phylogenies and gene family evolution
|
|
- Hubert Golden
- 5 years ago
- Views:
Transcription
1 nature methods Visualization of multiple alignments, phylogenies and gene family evolution James B Procter, Julie Thompson, Ivica Letunic, Chris Creevey, Fabrice Jossinet & Geoffrey J Barton Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 BLAST results for the human aryl sulfatase sequence as viewed in VectorNTI and Geneious Annotated visualization of the Pfam alignment for the sulfatase family and linked view of PDB structure 1fsu Visualizing the NCBI taxonomy Tree-based alignment analysis Annotating phylogenetic trees with complex data
2 Supplementary Figure 1 Blast results for the human aryl sulfatase sequence as viewed in VectorNTI (a), and Geneious (b). See main text for details. a Hierarchical hit list for further details. Hit distribution and consensus profile on query positions Alignment Trace showing context of aligned segments. Birds-eye view of hits on query sequence. b Alignment of Query and Hit Slider sets threshold to grey out clades in hitlist distance tree for hits in clade Top Hit
3 Supplementary Figure 2 Annotated visualization of the Pfam alignment for the sulfatase family and linked view of PDB structure 1fsu. Sulfatases are a highly conserved enzyme family. They hydrolyze sulfate ester bonds in a variety of structurally diverse compounds but have similar overall folds, mechanisms of action, and bivalent metal ion-binding sites 1, 2. (a) Pfam family alignment rendered with Jalview. Knowledge of the substrate specificity for each sequence allows the alignment to be divided into 6 functional subfamilies (names on the left were added manually). Conserved sequence regions calculated by MACSIMS are indicated by colored shapes. Regions 1-4 (above the alignment) are shown to be shared by all the sub-families. Within these, highlighted single residues correspond to known functionally active sites. Secondary structure annotation from PDB structure 1fsu (ARSB_HUMAN) is shown below the alignment, above the Livingstone and Barton conservation score.conserved sequence regions (Regions 1 and 2 above the alignment) were detected by MACSIMS and shared by all sub-families. Disulphide bond annotation above the alignment was obtained from PDB sequence 1n2l (ARSA_HUMAN). Secondary structure annotation from PDB structure 1fsu (ARSB_HUMAN) is below the alignment, above the Livingstone and Barton conservation score. (b) Image taken from Jalview s linked Jmol view of 1fsu, showing the structural context of regions 1-4 in a. (c). Close up of region underscored in red in (a) with annotated regions of sequences colored according to type and origin, locating PROSITE motifs and known mutations in the alignment. Inset box shows close up of Jalview tooltip conveying additional annotation information. The sequence annotations that were obtained from public databases (Uniprot 2, PDB 3 or Interpro 4 ), are colored using a dark shade. The features shown in a lighter shade were inferred by MACSIMS, which propagates these known properties to the uncharacterized sequences.
4 Supplementary Figure 2 Annotated visualization of the Pfam alignment for the sulfatase family and linked view of PDB structure 1fsu. a Region 1 Region 2 Region 3 Region 4 ARSA ARSG ARS STS/ ARSE/F ARSB ARSI/J b c Region 1 Region 2 disulphide bond ARSA ARSG ARS STS/ ARSE/F ARSB ARSI/J PROSITE sulfatase1 sulfatase2 metal binding active site glycosylation NAG binding hydrophobic mutation
5 Supplementary Figure 3 Visualizing the NCBI taxonomy. Perhaps, the closest we can get to the visualisation of the entire tree of life. In this figure, taken from Hughes et. al., 5 Walrus and Phylo3D were used to visualize the complete NCBI taxonomy, containing close to species, in a hyperbolic 3D space. Bacteria are focused in the image, and shown in orange. Eukaryotes are shown in yellow, in the left hand side. Archaea are represented with the red colored nodes shown in the top and background of the image.
6 Supplementary Figure 4 Tree Based Alignment Analysis. (a) Tree based alignment analysis of the sulfatase family using JevTrace, applied to the Pfam family alignment and tree. The panel on the left shows the algorithm s automatically generated tree partition. The alignment, shown adjacent to the leaves, is annotated with regions found to exhibit sub-family conservation. A view of the associated PDB structure (1fsu) is shown on the right, colored according to sub-family specific mutations. (b) Snapshot from Jalview showing same region of sulfatase alignment as in Figure S2C, with Clustal conservation based shading and colouring applied to each subgroup. This rendering style reveals subfamily specific conservation patterns that generally contain the residues known to be involved in substrate binding (c.f. annotation in figure S2c). (c) Neighbor-joining tree for the alignment in S2A calculated with Jalview, with sub-trees corresponding to each sub-family highlighted with different colors.
7 Supplementary Figure 4 Tree Based Alignment Analysis. a b c ARSA ARSG ARS STS/ ARSE/F ARSB ARSI/J
8 Ureaplasma parvum Brucella melitensis Tropheryma whipplei str Twist Streptomyces coelicolor Streptomyces avermitilis Supplementary Figure 5 Annotating phylogenetic trees with complex data. itol 6 was used to annotate an automatically generated Tree of life. 7 Blue barcharts represent the genome sizes, defined as number of predicted protein coding genes. Piecharts show the distribution of preferred habitats for various taxa identified in several metagenomics sequencing projects. 8 Thalassiosira pseudonana CCMP1335 Cryptosporidium hominis Giardia lamblia ATCC Methanothermobacter thermautotrophicus str Delta H Thermoplasma volcanium Thermoplasma acidophilum Sulfolobus solfataricus Sulfolobus tokodaii Aeropyrum pernix Methanocaldococcus jannaschii Methanopyrus kandleri Pyrococcus horikoshii Pyrococcus abyssi Pyrococcus furiosus Methanosarcina mazei Methanosarcina acetivorans Halobacterium sp NRC 1 Archaeoglobus fulgidus Plasmodium falciparum 3D7 Leishmania major Methanococcus maripaludis Cyanidioschyzon merolae Schizosaccharomyces pombe Dictyostelium discoideum Arabidopsis thaliana Oryza sativa Eremothecium gossypii Caenorhabditis elegans Saccharomyces cerevisiae Anopheles gambiae str PEST Drosophila melanogaster Caenorhabditis briggsae Takifugu rubripes Danio rerio Gallus gallus Mus musculus Rattus norvegicus Homo sapiens Thermoanaerobacter tengcongensis Pan troglodytes Clostridium acetobutylicum Clostridium tetani Clostridium perfringens Onion yellows phytoplasma Mycoplasma mycoides subsp mycoides SC Mycoplasma mobile 163K Mycoplasma pulmonis Mycoplasma penetrans Mycoplasma gallisepticum Mycoplasma pneumoniae Mycoplasma genitalium Staphylococcus epidermidis Staphylococcus aureus subsp aureus MW2 Staphylococcus aureus subsp aureus N315 Staphylococcus aureus subsp aureus Mu50 Listeria innocua Listeria monocytogenes str 4b F2365 Listeria monocytogenes Bacillus halodurans Oceanobacillus iheyensis Bacillus subtilis Bacillus anthracis str Ames Bacillus cereus ATCC Bacillus cereus ATCC Lactobacillus plantarum Lactobacillus johnsonii Enterococcus faecalis Lactococcus lactis subsp lactis Streptococcus pneumoniae R6 Streptococcus pneumoniae Streptococcus mutans Streptococcus agalactiae serogroup III Streptococcus agalactiae serogroup V Streptococcus pyogenes Streptococcus pyogenes MGAS8232 Streptococcus pyogenes MGAS315 Streptococcus pyogenes SSI 1 Fibrobacter succinogenes subsp succinogenes S85 Chlorobaculum tepidum Porphyromonas gingivalis Bacteroides thetaiotaomicron Chlamydia muridarum Chlamydia trachomatis Chlamydophila caviae Chlamydophila pneumoniae TW 183 Chlamydophila pneumoniae J138 Chlamydophila pneumoniae CWL029 Chlamydophila pneumoniae AR39 Gemmata obscuriglobus UQM 2246 Pirellula sp Leptospira interrogans serovar Copenhageni Leptospira interrogans Borrelia burgdorferi Treponema denticola Pyrobaculum aerophilum Treponema pallidum Nanoarchaeum equitans Bifidobacterium longum Tropheryma whipplei TW0827 Corynebacterium diphtheriae Shigella flexneri Shigella flexneri 2a str 2457T Escherichia coli Escherichia coli O6 Escherichia coli O157:H7 Escherichia coli O157:H7 EDL Yersinia pestis Yersinia pestis KIM Salmonella enterica subsp enterica serovar Typhi str Ty2 Yersinia pestis biovar Microtus str Photorhabdus luminescens subsp laumondii Buchnera aphidicola (Schizaphis graminum) Buchnera aphidicola (Acyrthosiphon pisum) Buchnera aphidicola (Baizongia pistaciae) Haemophilus influenzae Pasteurella multocida Candidatus Blochmannia floridanus Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis Vibrio vulnificus Haemophilus ducreyi Vibrio vulnificus YJ016 Vibrio parahaemolyticus Vibrio cholerae Shewanella oneidensis Photobacterium profundum Pseudomonas aeruginosa Pseudomonas putida KT2440 Pseudomonas syringae pv tomato Xylella fastidiosa Temecula1 Xylella fastidiosa Xanthomonas axonopodis pv citri Xanthomonas campestris pv campestris Coxiella burnetii Bordetella parapertussis Bordetella bronchiseptica Bordetella pertussis Ralstonia solanacearum Neisseria meningitidis serogroup A Neisseria meningitidis serogroup B Chromobacterium violaceum Nitrosomonas europaea Brucella suis Mesorhizobium loti Sinorhizobium meliloti Bradyrhizobium japonicum Rhodopseudomonas palustris Caulobacter vibrioides Rickettsia prowazekii Rickettsia conorii Wolbachia sp wmel Helicobacter pylori Helicobacter pylori J99 Corynebacterium efficiens Corynebacterium glutamicum Corynebacterium glutamicum ATCC Mycobacterium avium subsp paratuberculosis Mycobacterium leprae Mycobacterium bovis Mycobacterium tuberculosis CDC1551 Mycobacterium tuberculosis H37Rv Fusobacterium nucleatum subsp nucleatum Thermotoga maritima Aquifex aeolicus Dehalococcoides ethenogenes 195 Thermus thermophilus HB27 Deinococcus radiodurans Gloeobacter violaceus Synechococcus elongatus Nostoc sp PCC 7120 Synechocystis sp PCC 6803 Prochlorococcus marinus Prochlorococcus marinus str MIT 9313 Synechococcus sp WH 8102 Acidobacterium capsulatum ATCC Candidatus Solibacter usitatus Ellin6076 Desulfovibrio vulgaris str Hildenborough Geobacter sulfurreducens Bdellovibrio bacteriovorus Campylobacter jejuni Wolinella succinogenes Helicobacter hepaticus Prochlorococcus marinus subsp pastoris str CCMP1986
9 References 1. Ghosh, D. Human sulfatases: a structural perspective to catalysis. Cell Mol Life Sci 64, (2007). 2. The UniProt Consortium. The Universal Protein Resource (UniProt) Nucleic Acids Res 37, D (2009). 3. Berman, H.M. et al. The Protein Data Bank. Nucleic Acids Res 28, (2000). 4. Hunter, S. et al. InterPro: the integrative protein signature database. Nucleic Acids Res 37, D211-5 (2009). 5. Hughes, T., Hyun, Y. & Liberles, D.A. Visualising very large phylogenetic trees in three dimensional hyperbolic space. BMC Bioinformatics 5, 48 (2004). 6. Letunic, I. & Bork, P. Interactive Tree Of Life (itol): an online tool for phylogenetic tree display and annotation. Bioinformatics 23, (2007). 7. Ciccarelli, F.D. et al. Toward automatic reconstruction of a highly resolved tree of life. Science 311, (2006). 8. von Mering, C. et al. Quantitative phylogenetic assessment of microbial communities in diverse environments. Science 315, (2007).
Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana
Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana Table S1 The species marked with belong to the Proteobacteria subset and those marked
More informationPBL: INVENT A SPECIES
PBL: INVENT A SPECIES Group directions Group Name Group Members Project Prompt Invent a species. Task As a group you have the opportunity to invent a new species. Where did your species come from and how
More informationGene Family Content-Based Phylogeny of Prokaryotes: The Effect of Criteria for Inferring Homology
Syst. Biol. 54(2):268 276, 2005 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150590923335 Gene Family Content-Based Phylogeny of Prokaryotes:
More informationBiased biological functions of horizontally transferred genes in prokaryotic genomes
Biased biological functions of horizontally transferred genes in prokaryotic genomes Yoji Nakamura 1,5, Takeshi Itoh 2,3, Hideo Matsuda 4 & Takashi Gojobori 1,2 Horizontal gene transfer is one of the main
More informationProkaryotic phylogenies inferred from protein structural domains
Letter Prokaryotic phylogenies inferred from protein structural domains Eric J. Deeds, 1 Hooman Hennessey, 2 and Eugene I. Shakhnovich 3,4 1 Department of Molecular and Cellular Biology, Harvard University,
More informationABSTRACT. As a result of recent successes in genome scale studies, especially genome
ABSTRACT Title of Dissertation / Thesis: COMPUTATIONAL ANALYSES OF MICROBIAL GENOMES OPERONS, PROTEIN FAMILIES AND LATERAL GENE TRANSFER. Yongpan Yan, Doctor of Philosophy, 2005 Dissertation / Thesis Directed
More informationOrganisation of the S10, spc and alpha ribosomal protein gene clusters in prokaryotic genomes
FEMS Microbiology Letters 242 (2005) 117 126 www.fems-microbiology.org Organisation of the S10, spc and alpha ribosomal protein gene clusters in prokaryotic genomes Tom Coenye *, Peter Vandamme Laboratorium
More informationIncreasing biological complexity is positively correlated with the relative genome-wide expansion of non-protein-coding DNA sequences
Increasing biological complexity is positively correlated with the relative genome-wide expansion of non-protein-coding DNA sequences Ryan J. Taft 1, 2 * and John S. Mattick 3 1 Rowe Program in Genetics,
More informationEvolutionary Analysis by Whole-Genome Comparisons
JOURNAL OF BACTERIOLOGY, Apr. 2002, p. 2260 2272 Vol. 184, No. 8 0021-9193/02/$04.00 0 DOI: 184.8.2260 2272.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Evolutionary Analysis
More informationStabilization against Hyperthermal Denaturation through Increased CG Content Can Explain the Discrepancy between Whole Genome and 16S rrna Analyses
11458 Biochemistry 2005, 44, 11458-11465 Stabilization against Hyperthermal Denaturation through Increased CG Content Can Explain the Discrepancy between Whole Genome and 16S rrna Analyses T. E. Meyer*,
More informationApplication of tetranucleotide frequencies for the assignment of genomic fragments
Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology 1462-2912Society for Applied Microbiology and Blackwell Publishing Ltd, 20046Original ArticleTetras for metagenomicsh. Teeling et al. Environmental
More information2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
More informationProduct Catalogue 2015 Clinical and Industrial Microbiology
Acinetobacter baumannii ATCC BAA-747 * 89141 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aggregatibacter aphrophilus ATCC 7901 * 89091 Aspergillus brasiliensis ATCC
More informationMicrobial Typing by Machine Learned DNA Melt Signatures
Microbial Typing by Machine Learned DNA Melt Signatures Nadya Andini 1, Bo Wang 2, Pornpat Athamanolap 3, Justin Hardick 4, Billie J. Masek 5, Simone Thair 1, Annie Hu 1, Gideon Avornu 5, Stephen Peterson
More informationProkaryotic Utilization of the Twin-Arginine Translocation Pathway: a Genomic Survey
JOURNAL OF BACTERIOLOGY, Feb. 2003, p. 1478 1483 Vol. 185, No. 4 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.4.1478 1483.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Prokaryotic
More informationDeposited research article Short segmental duplication: parsimony in growth of microbial genomes Li-Ching Hsieh*, Liaofu Luo, and Hoong-Chien Lee
This information has not been peer-reviewed. Responsibility for the findings rests solely with the author(s). Deposited research article Short segmental duplication: parsimony in growth of microbial genomes
More informationSupplementary material
Table 1: The number of protein sequences listed for the BacelLo training data set according to each origin and localization. Localization Plants Animal Fungi chloroplast (ch) 204 - - cytoplasm (cy) 58
More informationSolution structure of Cox11: a novel type of immunoglobulin-like. cytochrome c oxidase
SUPPLEMENTARY MATERIAL Solution structure of Cox11: a novel type of immunoglobulin-like fold involved in Cu B site formation of cytochrome c oxidase Lucia Banci *, Ivano Bertini *, Francesca Cantini *,
More informationMultifractal characterisation of complete genomes
arxiv:physics/1854v1 [physics.bio-ph] 28 Aug 21 Multifractal characterisation of complete genomes Vo Anh 1, Ka-Sing Lau 2 and Zu-Guo Yu 1,3 1 Centre in Statistical Science and Industrial Mathematics, Queensland
More informationProduct Catalogue 2016 Clinical and Industrial Microbiology
Acinetobacter baumannii ATCC BAA-747 * 89141 Acinetobacter baumannii ATCC 19606 * 89174 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aeromonas hydrophila ATCC 35654
More informationStructural Proteomics of Eukaryotic Domain Families ER82 WR66
Structural Proteomics of Eukaryotic Domain Families ER82 WR66 NIH Protein Structure Initiative Mission Statement To make the three-dimensional atomic level structures of most proteins readily available
More informationPseudogenes are considered to be dysfunctional genes
Pseudogenes and bacterial genome decay Jean O Micks Contrary to the evolutionary idea of junk DNA, many pseudogenes still have function in the genomes of archaea, bacteria, and also eukaryotes, such as
More informationThe genomic tree of living organisms based on a fractal model
Physics Letters A 317 (2003) 293 302 www.elsevier.com/locate/pla The genomic tree of living organisms based on a fractal model Zu-Guo Yu a,b,,voanh a, Ka-Sing Lau c, Ka-Hou Chu d a Program in Statistics
More informationCcpA-Dependent Carbon Catabolite Repression in Bacteria
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Dec. 2003, p. 475 490 Vol. 67, No. 4 1092-2172/03/$08.00 0 DOI: 10.1128/MMBR.67.4.475 490.2003 Copyright 2003, American Society for Microbiology. All Rights
More informationMidterm Exam #1 : In-class questions! MB 451 Microbial Diversity : Spring 2015!
Midterm Exam #1 : In-class questions MB 451 Microbial Diversity : Spring 2015 Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Name : Date : TOTAL = 45 points 1.
More informationCorrelations between Shine-Dalgarno Sequences and Gene Features Such as Predicted Expression Levels and Operon Structures
JOURNAL OF BACTERIOLOGY, Oct. 2002, p. 5733 5745 Vol. 184, No. 20 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.20.5733 5745.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Correlations
More informationThe Minimal-Gene-Set -Kapil PHY498BIO, HW 3
The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000
More informationEvolutionary Use of Domain Recombination: A Distinction. Between Membrane and Soluble Proteins
1 Evolutionary Use of Domain Recombination: A Distinction Between Membrane and Soluble Proteins Yang Liu, Mark Gerstein, Donald M. Engelman Department of Molecular Biophysics and Biochemistry, Yale University,
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More informationHonor pledge: I have neither given nor received unauthorized aid on this test. Name :
Midterm exam #2 Take-home questions MB 451 Microbial Diversity The rules: You are free to use any notes, books, or online material while taking this take-home exam. You are NOT allowed to get (or give)
More informationTwo Families of Mechanosensitive Channel Proteins
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 2003, p. 66 85 Vol. 67, No. 1 1092-2172/03/$08.00 0 DOI: 10.1128/MMBR.67.1.66 85.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.
More informationMeasure representation and multifractal analysis of complete genomes
PHYSICAL REVIEW E, VOLUME 64, 031903 Measure representation and multifractal analysis of complete genomes Zu-Guo Yu, 1,2, * Vo Anh, 1 and Ka-Sing Lau 3 1 Centre in Statistical Science and Industrial Mathematics,
More informationTree of Life: An Introduction to Microbial Phylogeny Beverly Brown, Sam Fan, LeLeng To Isaacs, and Min-Ken Liao
Microbes Count! 191 Tree of Life: An Introduction to Microbial Phylogeny Beverly Brown, Sam Fan, LeLeng To Isaacs, and Min-Ken Liao Video VI: Microbial Evolution Introduction Bioinformatics tools allow
More information2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes
1 2 3 4 5 6 7 8 9 10 11 12 Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes Domain Bacteria Proteobacteria From the mythical Greek god Proteus, who could assume many shapes Gram-negative
More informationFigure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)
Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,
More informationMicrobial Taxonomy. Classification of living organisms into groups. A group or level of classification
Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think
More informationarxiv:physics/ v1 [physics.bio-ph] 28 Aug 2001
Measure representation and multifractal analysis of complete genomes Zu-Guo Yu,2, Vo Anh and Ka-Sing Lau 3 Centre in Statistical Science and Industrial Mathematics, Queensland University of Technology,
More informationEZ-COMP EZ-COMP For Training and Proficiency Testing Product Details
EZ-COMP For Training and Proficiency Testing Mixed microorganism populations Identified by codes rather than descriptions Refrigerated storage Traceable to reference culture Product warranty Product Details
More information1. Prokaryotic Nutritional & Metabolic Adaptations
Chapter 27B: Bacteria and Archaea 1. Prokaryotic Nutritional & Metabolic Adaptations 2. Survey of Prokaryotic Groups A. Domain Bacteria Gram-negative groups B. Domain Bacteria Gram-positive groups C. Domain
More informationBuilding Phylogenetic Trees Based on Biochemical Pathways
Building Phylogenetic Trees Based on Biochemical Pathways Research Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in Computer Science Adi Mano Submitted
More informationPurpose. Process. Students will locate the species listed below on the infographic and write down the domain to which they belong:
Purpose This activity gives students practice with interpreting infographics and also supports student understanding of the similarities and differences between humans and other species. Process Students
More informationThe Complement of Enzymatic Sets in Different Species
doi:10.1016/j.jmb.2005.04.027 J. Mol. Biol. (2005) 349, 745 763 The Complement of Enzymatic Sets in Different Species Shiri Freilich 1 *, Ruth V. Spriggs 1,2, Richard A. George 1,2 Bissan Al-Lazikani 2,
More informationINTERPRETATION OF THE GRAM STAIN
INTERPRETATION OF THE GRAM STAIN DISCLOSURE Relevant relationships with commercial entities none Potential for conflicts of interest within this presentation none Steps taken to review and mitigate potential
More informationThe Prokaryotes: Domains Bacteria and Archaea
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 11 The Prokaryotes: Domains Bacteria and Archaea Table 11.1 Classification of Selected Prokaryotes*
More informationGenome-Wide Molecular Clock and Horizontal Gene Transfer in Bacterial Evolution
JOURNAL OF BACTERIOLOGY, Oct. 004, p. 6575 6585 Vol. 186, No. 19 001-9193/04/$08.00 0 DOI: 10.118/JB.186.19.6575 6585.004 Copyright 004, American Society for Microbiology. All Rights Reserved. Genome-Wide
More informationTetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009
Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline
More informationrho Is Not Essential for Viability or Virulence in Staphylococcus aureus
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2001, p. 1099 1103 Vol. 45, No. 4 0066-4804/01/$04.00 0 DOI: 10.1128/AAC.45.4.1099 1103.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved.
More informationComparison of 61 E. coli genomes
Comparison of 61 E. coli genomes Center for Biological Sequence Analysis Department of Systems Biology Dave Ussery! DTU course 27105 - Comparative Genomics Oksana s 61 E. coli genomes paper! Monday, 23
More informationCh 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria)
Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) (don t study Concept 27.2) Some phyla Remember: Bacterial cell structure and shapes 1 Usually very small but some are unusually
More informationThe use of gene clusters to infer functional coupling
Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2896 2901, March 1999 Genetics The use of gene clusters to infer functional coupling ROSS OVERBEEK*, MICHAEL FONSTEIN, MARK D SOUZA*, GORDON D. PUSCH*, AND NATALIA
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature464 Table S1: Primers used to amplify a 3 bp part of the Acidianus A1-3 CS 2 gene (CS 2-1bF, 525bR, 40bF and 333bR), as well as the C- and N-terminal ends by inverse PCR (F4inv and R3inv);
More informationDomain Bacteria. BIO 220 Microbiology Jackson Community College
Domain Bacteria BIO 220 Microbiology Jackson Community College John Ireland, Ph.D. 2006 Scientific Nomenclature Domain - Bacteria Phylum Important for gross characteristics Class Intermediate characteristics
More informationTitle. Author(s)Yokono, Makio; Satoh, Soichirou; Tanaka, Ayumi. CitationScientific reports, 8: Issue Date
Title Comparative analyses of whole-genome protein sequenc Author(s)Yokono, Makio; Satoh, Soichirou; Tanaka, Ayumi CitationScientific reports, 8: 6800 Issue Date 28-05- Doc URL http://hdl.handle.net/2115/70684
More informationTaking shape: control of bacterial cell wall biosynthesis
Blackwell Science, LtdOxford, UKMMIMolecular Microbiology0950-382XBlackwell Publishing Ltd, 2005? 200557511771181CommentaryBacterial morphogenesg. C. Stewart Molecular Microbiology (2005) 57(5), 1177 1181
More informationThe impact of the neisserial DNA uptake sequence on genome evolution and stability
The impact of the neisserial DNA uptake sequence on genome evolution and stability Ole Herman Ambur The Tønjum Group Transformation Neisserial transformation requires: DNA uptake sequence (DUS) Transformation
More informationDNA sequence analysis using Markov chain models
DNA sequence analysis using Markov chain models Boris Ryabko Siberian University of Telecommunication an Informatics, Institute of Computational Technologies, Siberian Branch of RAS Novosibirsk E-mail:
More informationFigure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated
Figure S1 Figure S2 Supplementary Figure legends Figure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated genomes. To generate these plots all strains within a species were
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationBATMAS30: Amino Acid Substitution Matrix for Alignment of Bacterial Transporters
PROTEINS: Structure, Function, and Genetics 51:85 95 (2003) BATMAS30: Amino Acid Substitution Matrix for Alignment of Bacterial Transporters Roman A. Sutormin, 1 * Aleksandra B. Rakhmaninova, 2 and Mikhail
More informationCorrections CORRECTIONS. PNAS July 3, 2007 vol. 104 no cgi doi pnas
Corrections BIOPHYSICS, CHEMISTRY. For the article Destruction of long-range interactions by a single mutation in lysozyme, by Ruhong Zhou, Maria Eleftheriou, Ajay K. Royyuru, and Bruce J. Berne, which
More informationAn Evolutionary Analysis of the Helix-Hairpin-Helix Superfamily of DNA Repair Glycosylases
An Evolutionary Analysis of the Helix-Hairpin-Helix Superfamily of DNA Repair Glycosylases Dee R. Denver, Stephanie L. Swenson, and Michael Lynch Department of Biology, Indiana University The helix-hairpin-helix
More informationGenome-Wide Detection and Analysis of Cell Wall-Bound Proteins with LPxTG-Like Sorting Motifs
JOURNAL OF BACTERIOLOGY, July 2005, p. 4928 4934 Vol. 187, No. 14 0021-9193/05/$08.00 0 doi:10.1128/jb.187.14.4928 4934.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Genome-Wide
More information# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp
Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus
More informationBacterial clasification
Bacterial clasification Describe bacterial classification: List taxon levels Define taxonomy and identification Describe principles of taxonomy Explain classification of bacteria Taxonomy the science of
More informationWhere are the pseudogenes in bacterial genomes?
Opinion TRENDS in Microbiology Vol.9 No. November Where are the pseudogenes in bacterial genomes? Jeffrey G. Lawrence, Roger W. Hendrix and Sherwood Casjens Most bacterial genomes have very few pseudogenes;
More informationA thermophilic last universal ancestor inferred from its estimated amino acid composition
CHAPTER 17 A thermophilic last universal ancestor inferred from its estimated amino acid composition Dawn J. Brooks and Eric A. Gaucher 17.1 Introduction The last universal ancestor (LUA) represents a
More informationOverview of the major bacterial pathogens The major bacterial pathogens are presented in this table:
Practical Microbiology 30/11/2018 University of Sulaimani college of Pharmacy Year2 Lab. 5: Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Major Bacterial
More informationDatabase and Comparative Identification of Prophages
Database and Comparative Identification of Prophages K.V. Srividhya 1, Geeta V Rao 1, Raghavenderan L 1, Preeti Mehta 1, Jaime Prilusky 2, Sankarnarayanan Manicka 1, Joel L. Sussman 3, and S Krishnaswamy
More informationBacteria & Archaea. Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school
Bacteria & Archaea Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school What is the bacteria? http://www.unc.edu/depts/tcf/mycoplasma.gif http://gsbs.utmb.edu/microbook/images/fig37_1.jpg
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationWhat is Microbiology?
Microbiology What is Microbiology? Microbiology is the Science that studies Microorganisms. Microorganisms, roughly, are those living things that are too small to be seen with the naked eye. Microorganisms
More informationOGtree: a tool for creating genome trees of prokaryotes based on overlapping genes
Published online 2 May 2008 Nucleic Acids Research, 2008, Vol. 36, Web Server issue W475 W480 doi:10.1093/nar/gkn240 OGtree: a tool for creating genome trees of prokaryotes based on overlapping genes Li-Wei
More informationQuantitative Exploration of the Occurrence of Lateral Gene Transfer Using Nitrogen Fixation Genes as a Case Study
Lin 1 Quantitative Exploration of the Occurrence of Lateral Gene Transfer Using Nitrogen Fixation Genes as a Case Study by Jason Lin Advisor: Professor Peter Bickel Introduction Under the concept of evolution,
More informationOur product offering. The ATCC Licensed Derivative Program
Our product offering Currently MECCONTI offers three different product lines of lyophilized micro-organisms: MicroSwabs: A MicroSwab consists of a lyophilized pellet of a single micro-organism strain inside
More informationIdentification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins
Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins Jacek P. Dworzanski Geo-Centers, Inc., Aberdeen Proving Ground,
More informationTHE advances of the last decade on genome sequenc- very different compositional bias, as well as different gene
Copyright 2003 by the Genetics Society of America Associations Between Inverted Repeats and the Structural Evolution of Bacterial Genomes Guillaume Achaz,*,1 Eric Coissac,*,2 Pierre Netter* and Eduardo
More informationPhylogenetic tree of prokaryotes based on complete genomes using fractal and correlation analyses
Phylogenetic tree of prokaryotes based on complete genomes using fractal and correlation analyses Zu-Guo Yu, and Vo Anh Program in Statistics and Operations Research, Queensland University of Technology,
More informationUreaplasma Urease Genes have Undergone a Unique Evolutionary Process
The Open Systems Biology Journal, 2009, 2, 1-7 1 Open Access Ureaplasma Urease Genes have Undergone a Unique Evolutionary Process Hiromi Nishida * Agricultural Bioinformatics Research Unit, Graduate School
More informationComparing Genomes! Homologies and Families! Sequence Alignments!
Comparing Genomes! Homologies and Families! Sequence Alignments! Allows us to achieve a greater understanding of vertebrate evolution! Tells us what is common and what is unique between different species
More informationSubsystem: TCA Cycle. List of Functional roles. Olga Vassieva 1 and Rick Stevens 2 1. FIG, 2 Argonne National Laboratory and University of Chicago
Subsystem: TCA Cycle Olga Vassieva 1 and Rick Stevens 2 1 FIG, 2 Argonne National Laboratory and University of Chicago List of Functional roles Tricarboxylic acid cycle (TCA) oxidizes acetyl-coa to CO
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationL Aravind and Eugene V Koonin
http://genomebiology.com/2000/1/4/research/0007.1 Research The a/b fold uracil DNA glycosylases: a common origin with diverse fates L Aravind and Eugene V Koonin Address: National Center for Biotechnology
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationGenes order and phylogenetic reconstruction: application to γ-proteobacteria
Genes order and phylogenetic reconstruction: application to γ-proteobacteria Guillaume Blin 1, Cedric Chauve 2 and Guillaume Fertin 1 1 LINA FRE CNRS 2729, Université de Nantes 2 rue de la Houssinière,
More informationActa Cryst. (2014). D70, doi: /s
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021166 Supporting information Volume 70 (2014) Supporting information for article: Elucidation of the bicarbonate binding site and insights into the carboxylation
More informationWhole Genome based Phylogeny
Whole Genome based Phylogeny Johanne Ahrenfeldt PhD student DTU Bioinformatics Short about me Johanne Ahrenfeldt johah@dtu.dk PhD student at DTU Bioinformatics Whole Genome based Phylogeny Graduate Engineer
More informationObjects of the Medical Microbiology revision a) Pathogenic microbes (causing diseases of human beings or animals) b) Normal microflora (microbes commo
Institute for Microbiology, Medical Faculty of Masaryk University and St. Anna Faculty Hospital in Brno Miroslav Votava MORPHOLOGY AND STRUCTURE OF BACTERIAL CELL The 2nd lecture for 2nd-year students
More informationA Structural Equation Model Study of Shannon Entropy Effect on CG content of Thermophilic 16S rrna and Bacterial Radiation Repair Rec-A Gene Sequences
A Structural Equation Model Study of Shannon Entropy Effect on CG content of Thermophilic 16S rrna and Bacterial Radiation Repair Rec-A Gene Sequences T. Holden, P. Schneider, E. Cheung, J. Prayor, R.
More information! # % & ( &) &) % + % # % ( &) &) % +!, (./ # % ##0 & ( &) % +, /77 2,
MBE Advance Access published November 12, 2008! # % & ( &) &) % + % # % ( &) &) % +!, (./ # % ##0 & ( 1 2 3356733 &) % +, 8 9 37 6./77 2, : ;
More informationGenomic analysis of the histidine kinase family in bacteria and archaea
Microbiology (2001), 147, 1197 1212 Printed in Great Britain Genomic analysis of the histidine kinase family in bacteria and archaea Dong-jin Kim and Steven Forst Author for correspondence: Steven Forst.
More information10ml. Set (4 poly and 17 monovalent, 2ml each)
120314TR Bordetella pertussis Antigen 10ml Contents 1 Bordetella pertussis Antigen 1 Clostridium perfringens Type A 2 Escherichia coli 5 Legionella pneumophila 5 Listeria monocytogenes 6 Pseudomonas aeruginosa
More informationAssessing evolutionary relationships among microbes from whole-genome analysis Jonathan A Eisen
475 Assessing evolutionary relationships among microbes from whole-genome analysis Jonathan A Eisen The determination and analysis of complete genome sequences have recently enabled many major advances
More informationThe origins and early evolution of DNA mismatch repair genes multiple horizontal gene transfers and co-evolution
Published online 26 October 2007 Nucleic Acids Research, 2007, Vol. 35, No. 22 7591 7603 doi:10.1093/nar/gkm921 The origins and early evolution of DNA mismatch repair genes multiple horizontal gene transfers
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationOd vzniku života po evoluci člověka. Václav Pačes Ústav molekulární gene2ky Akademie věd České republiky
Od vzniku života po evoluci člověka Václav Pačes Ústav molekulární gene2ky Akademie věd České republiky Exon 1 Intron (413 nt) Exon 2 Exon 1 Exon 2 + + 15 nt + 4 nt Genome of RNA-bacteriophage
More informationAmino acid composition of genomes, lifestyles of organisms, and evolutionary trends: a global picture with correspondence analysis
Gene 297 (2002) 51 60 www.elsevier.com/locate/gene Amino acid composition of genomes, lifestyles of organisms, and evolutionary trends: a global picture with correspondence analysis Fredj Tekaia a, *,
More informationIntragenomic Variation and Evolution of the Internal Transcribed Spacer of the rrna Operon in Bacteria
J Mol Evol (2007) 65:44 67 DOI: 10.1007/s00239-006-0235-3 Intragenomic Variation and Evolution of the Internal Transcribed Spacer of the rrna Operon in Bacteria Frank J. Stewart, Colleen M. Cavanaugh Department
More informationCONTROL ORGANISMS ss
CONTROL ORGANISMS 032918ss CONTENTS CONTROL ORGANISMS 1 Lyophilized KWIK-STIK & LYFO DISK 29 Epower 32 Epower CRM 34 EZ-Accu Shot 36 EZ-Accu Shot Select 36 EZ-CFU 38 EZ-CFU One Step 41 EZ-Hydro Shot 40
More informationA Specialized Version of the HD Hydrolase Domain Implicated in Signal Transduction
J. Mol. Microbiol. Biotechnol. (1999) 1(2): 303-305. JMMB Correspondence The HD Hydrolase Domain in Signal Transduction 303 A Specialized Version of the HD Hydrolase Domain Implicated in Signal Transduction
More information