Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins

Transcription

1 Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins Jacek P. Dworzanski Geo-Centers, Inc., Aberdeen Proving Ground, MD Samir Deshpande 1 ; Rui Chen 2 ; A. Peter Snyder 3 ; Liang Li 2 and Charles H. Wick 3 1 Science and Technology Corporation, Edgewood, MD 214; 2 Department of Chemistry, University of Alberta, Edmonton, Alberta T6G 2G2; 3 U.S. Army Edgewood Chemical Biological Center, Aberdeen Proving Ground, MD Joint Service Scientific Conference on Chemical & Biological Defense Research November 24; Hunt Valley, Maryland

2 Report Documentation Page Form Approved OMB No Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 124, Arlington VA Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE 17 NOV REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Science and Technology Corporation, Edgewood, MD PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 1. SPONSOR/MONITOR S ACRONYM(S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release, distribution unlimited 11. SPONSOR/MONITOR S REPORT NUMBER(S) 13. SUPPLEMENTARY NOTES See also ADM1849, 24 Scientific Conference on Chemical and Biological Defense Research. Held in Hunt Valley, Maryland on November 24., The original document contains color images. 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU a. REPORT unclassified b. ABSTRACT unclassified c. THIS PAGE unclassified 18. NUMBER OF PAGES 27 19a. NAME OF RESPONSIBLE PERSON Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18

3 National Institute of Allergy and Infectious Diseases National Institute of Health Category A, B & C Priority Bacterial Pathogens Category A 1. Clostridium botulinum 2. Bacillus anthracis (anthrax) 3. Francisella tularensis (tularemia) 4. Yersinia pestis Category C 1. Mycobacterium tuberculosis (multiple drug resistant) 2. Rickettsias (other) Category B 1. Brucella species (brucellosis) 2. Burkhoderia pseudomallei 3. Burkholderia mallei (glanders) 4. Campylobacter jejuni 5. Clostridium perfringens (epsilon toxin) 6. Coxiella burnetti (Q fever) 7. Escherichia coli (diarrheagenic) 8. Listeria monocytogenes 9. Rickettsia prowazekii (typhus fever) 1. Salmonella 11. Shigella species 12. Staphylococcus aureus (enterotoxin B) 13. Vibrios (pathogenic) 14. Yersinia enterocolitica Genomes of all above organisms have been sequenced

4 5/12/24 versus {11/12/24} Number of Fully Sequenced Genomes of Eubacteria: 145 {178} (From 1995) Number of Fully Sequenced Genomes During Last 12 Months: 55 {68} Prokaryotic Ongoing Genome Projects: 489 {528} Archaeal: 28 {27} Bacterial: 461 {499} Example of Ongoing Genome Projects Bacillus anthracis A155 (Group C) TIGRNIAID Bacillus anthracis Ames Ancestor TIGRNIAID / NSF Bacillus anthracis Ames Florida TIGRNSF Bacillus anthracis Austrailia 94 (GT55, Group A3a) TIGRNIAID Bacillus anthracis CNEVA-966 (GT79 Group B2) TIGRNIAID Bacillus anthracis Kruger B (GT87 Group B1) TIGRNIAID Bacillus anthracis Vollum (GT77 Group A4) TIGRNIAID Bacillus anthracis Western N. America (GT3 Group A1a)TIGRNIAID Bacillus anthracis STN DOE/JGI Bacillus anthracis ZK DOE/JGI

5 First, some terminology Taxonomy - the science of naming and classifying organisms; Classification - placement of an organism within a scheme relating different groups of organisms; Identification - the determination of whether an organism should be placed within a group of organisms known to fit within some classification scheme; (the practical use of classification criteria) Phylogenetics - focuses on evolutionary relationships between organisms or genes/proteins Phylogenetic Approach The ideal means of identifying and classifying bacteria would be to compare each gene sequence in a given strain with the gene sequences for every known species.

6 Taxonomy of Bacteria (Linnaean System) Examples: Bacillus subtilis & Escherichia coli Kingdom Phylum Class Order Family Genus Species Bacteria Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus subtilis Bacteria Proteobacteria γ-proteobacteria Enterobacteriales Enterobacteriaceae Escherichia Escherichia coli

7 Universal Phylogenetic Tree of Bacteria Based on SSU rrna Sequences Spirochaetes Deinococcus-Thermus Chlamydiae Bacteroidetes/Chlorobi Proteobacteria Planctomycetes Fusobacteria Cyanobacteria Firmicutes Actinobacteria Termotogae Reepresentatives Reepresentatives of of Marked Marked Phylogenetic Phylogenetic Divisions Divisions (Phyla) (Phyla) of of Bacteria Bacteria Are Are Included Included in in the the Database Database Archaea, Eucarya Aquificae.1 base substitution per nucleotide

8 Approach: (1) Bacterial Sample Processing Bacteria Lysis Proteins Digestion (trypsin) Peptides Flow of Genetic Information DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE The The relation relation between between the the sequence sequence of of bases bases in in DNA DNA and and the the sequence sequence of of amino amino acids acids in in a a protein protein

9 Approach: (2) Tandem Mass Spectrometry of Peptide Ions Electrospray Ionization Mass Spectrometry Peptide Ions In m 7 m 6 m 5 m 4 m 3 m 2 m 1 m 7 m 6 Fragment Ions Out Power Supply _ PEPTIDE

10 Approach: (3) Sequencing of Peptide Ions MS/MS Spectra of Peptide Ions Intensity Intensity P PE Intensity PEPTIDE PEPTIDE PEPTIDE PEPTI PEPTI PEPTI PE PEPT PEPTID PE PEPT PEPTID PEPT PEPTID PPEP P #1 P #2 P #3 P PEP PEP PEPTIDR PEPTIDK PEPTIDE Unknown Bacterium P #1 P #2 P #3 m 1 m 1 m 2 m 3 m m 3 m m 4 m 5 m 6 m 5 m 6 Mass/Charge Mass/Charge Mass/Charge m 6 m m 2 m m 1 m m 7 m 7

11 Approach: (4) Matching of Identified Tryptic Peptides to Theoretical Peptides of Database Bacterial Proteomes Database Unknown Bacterium B. anthracis Y. pestis V. cholerae P #1 P #1 P #2 P #3 Matching P #2 P #3 P #3 Identified agent Y. pestis

12 Virtual Array of Peptide Sequences Bacterial Proteomes n = 17 Tryptic Peptides X 1 X 2 X 3 K X 1 X 2 X 3 R ORF 1 ORF 2 ORF 3 X 1 X 2 X 3 K X 1 X 2 X 3 R ORF m Translated Protein Sequences Matching m = 5 to 7,5 Total Number of Protein Coding Sequences: 5,

13 Classification and Identification of Unknown Bacterium Sequences.. b 1.. X 1 X 2 X 3 K s 1 X 1 X 2 X 3 R s X 1 X 2 X 3 K s Tryptic peptides.. X 1 X 2 X 3 R Matrix of Assignments.. s m Bacterial Proteomes u b 2 b 3 b n u b 1 b 2 b 3 b 4 b 5 Cluster Analysis F3 1 SIM-Score b 1 b 2 b.. 3 b n Affinity Histogram F2 F1 Principal Component Analysis

14 Screen Capture Image Displaying Raw LC-MS/MS Data SEQUEST Output Data Discriminant Analysis Parameters Filters Assignment Matrix L. lactis SIM-Score Bacterium Number

15 Screen Capture Image Displaying Accepted Peptide Assignments (P = 9%) L. lactis

16 Screen Capture Image Displaying Accepted Peptide Assignments After Removal of Degenerate Peptide Sequences L. lactis

17 Firmicutes Proteobacteria SIM-Score Phylum Phylum Firmicutes ID-Score Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides 1 F 2 2 (Lactococcus lactis) 8 Bacilli 1 Class level Bacilli Class Class 6 Phylum level SIM-Score ID-Score 2 F Mollicutes Clostridia 1 Bacillales 1 Order level Bacillales SIM-Score ID-Score Order 6 F Order 1 8 Lactobacillales SIM-Score ID-Score Family 6 F 2 1 Streptococcaceae 4 2 Family level Enterococcaceae Lactobacillaceae Streptococcaceae Genus Family SIM-Score ID-Score Lactococcus F Genus level SIM-Score Lactococcus Streptococcus Genus 6 4 L. lactis Species level Species Species ID-Score F 2 L. lactis S. mutans S. pneumoniae R6 S. pneumoniae RT4 S. pyogenes S. agalactiae

18 ID-Score Proteobacteria γ-proteobacteria Analysis of Bacterial Mixture [E. coli (K-12) and B. subtilis (2:1), w:w] ID-Score Phylum Level Proteobacteria Firmicutes Phylum (Division) Spirochaetes ID-Score Firmicutes Bacilli Class Class Enterobacteriales Enterobacteriaceae Bacillales Bacillaceae 1 8 Escherichia E. coli K Bacillus B. subtilis ID-Score 6 4 ID-Score Strain Species

19 Prote oba cte ria SIM Score Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides (Bacillus cereus) ID Score Phylum (Division) 1 Firmicute s Firmicute s F Bacteroidete s/ Chlorobi Grou p Classes Phylum level Firmicutes Phylum (Division) Genomic Similarities Score ID Score Bacilli Mollicutes Clostridia Bacillales F 2 Class level Bacilli Classes Genomic Similarities Score ID Score 2 Lactobacillales 1 Bacillaceae 1 Family level Bacillaceae F 2 Order level Bacillales Order Family 1 2 Order ID Score Family 2 Staphylococcaceae Listeriaceae Genomic Similarities Score Species F 2 Genomic Similarities Score B. cereus group F ID Score 4 2 B.halodurans Species level B. cereus group O. iheyensis B. subtilis Species Genomic Similarities Score a Subspecies level (B. cereus group) a a a c c t ID Score Species h s i F B. Cereus ATCC Species

20 Principal Component Analysis of Peptide Assignments.6 B. cereus ATCC Unknown.4 PC 3.2 B. cereus Group B. subtilis/ other Bacilli PC PC 1 Representation of the database Bacillaceae species and unknown organism in the principal component space (PC 1, PC 2, PC 3) reflecting 8 % of the total information included in the assignment matrix of 125 amino acid peptide sequences to bacterial proteomes.

21 Cluster Analysis of Peptide Assignments Unknown B. cereus ATCC14579 B. anthracis Ame s B. anthracis Ame s ancestor B. anthracis Sterne B. anthracis A212 B. cereus ZK B. thuringiensis B. cereus ATCC1987 B. cereus group Error Bacillaceae B. halodurans O. iheyensi s B. licheniformis B. subtilis Linkage Distance Hierarchical clustering of Bacillaceae species in 125-dimensional space of peptide sequences. (Complete linkage; squared Euclidean distances)

22 Differences in Proteome Composition Between an Unknown Sample and Database Bacteria Blue Line( ) absent; Yellow ( )present Peptide Number B. cereus ATCC B. anthracis Sterne B. anthracis Ames B. anthracis Ames ancestor B. anthracis A212 B. cereus ATCC 1987 B. cereus ZK B. thuringiensis VGSPQPGDLVFFQGTYK LVSLAEQQLGGYQK EYEVPITAAQADQIVLLMK STDTLGAQILGNTMEGLYR TNTPMLLQVLEDEVFK TGDAALGSISNILLR GDTLTAVDNDLSAWFWDEK ESYAAVQADTASK DVNEHTLEEEELPVNIEAYK IEDALNSTR Unknown sample: correctly identified as B. cereus ATCC 14789

23 Product Ion Mass Spectrum of a Peptide Ion Amino Acid Sequence Information Obtained in Less than 1 second y 13 y 12 y 11 y 1 y 9 y 8 y 7 y 6 y 5 y 4 y 3 y L V S L A E Q Q L G G Y Q K b 2 b 3 b 4 b 5 b 6 b 7 b 8 b 9 b 1 b 11 b 12 b 13 1 y 5 17 Relative Abundance 5 y 6 y 9 y 4 b 9 b 5 b 6 y 3 b b 7 b y 3 2 b 4 2 y 7 b 8 y8 y 1 b 1 b 11 b 13 b 12 y 12 y 11 y m/z

24 Discriminative Power of DNA and Protein Sequences Amino Acid Sequence From the MS/MS Spectrum..L V S L A E Q Q L G G Y Q K B.cereus.ATTC GAT CAA AGT GAT CGA CTC GTT GTT AAT CCG CCA ATG GTT TTT B.anthracis A212.GAT CAA AGT GAT CGA CTC GTT GTT AAT CCG CCA AAG GTT TTT SASP L V S L A E Q Q L G G F Q K Amino Acid Sequences of Matching Peptides Found in the Database DNA Sequences Small, Acid-Soluble Spore Proteins Accession LVSLAEQQLGG[ ]YQK [ ] Bacillus cereus ATCC [ ]F.. 65 Bacillus anthracis str. A [.]F.. 65 Bacillus cereus ATCC [G]VTR 69 Bacillus anthracis str. A QM...M..[ ] Bacillus firmus AM...[G]F.. 67 Bacillus halodurans AM...M..[ ]F.Q 67 Bacillus halodurans Q...[G]RSK 66 Bacillus megaterium Q...[G]RF 69 Bacillus megaterium Q...[G]RF 69 Bacillus megaterium AM...[G].TR 64 Bacillus anthracis str.a AM...[G].TR 7 Bacillus cereus ATCC AM...[ ]RANR 7 Bacillus cereus ATCC AM...[ ]RANR 7 Bacillus cereus ATCC AM...[ ]RANR 7 Bacillus anthracis str. A AM...S...[ ]FH. 67 Bacillus anthracis str. A Q...[G]TSF 7 Thermoactinomyces sacchari

25 45 47 Selected Peptide Sequences Discriminating Between an Unknown and Database Bacteria Peptide # Sequence Protein 8 IEDALNSTR 6 kda chaperonin GROEL 12 DVNEHTLEEEELPVNIEAYK Hypothetical protein BC ESYAAVQADTASK Putative transcriptional regulator 29 GDTLTAVDNDLSAWFWDEK Spore coat-associated protein N 45 KQPNFDDSSNFAK Hypothetical protein BA 3347 [Bacillus anthracis Ames] 47 TGDAALGSISNILLR Flagellin 59 TNTPMLLQVLEDEVFK Propionyl-CoA carboxylase biotin-containing subunit 73 STDTLGAQILGNTMEGLYR Oligopeptide-binding protein oppa 93 EYEVPITAAQADQIVLLMK IG hypothetical LVSLAEQQLGGYQK Small acid-soluble spore protein 119 VGSPQPGDLVFFQGTYK N-acetylmuramoyl-L-alanine amidase

26 Genes Encoding Identified Proteins 6 () DNA Strand Protein length (number of codons) (-) DNA Strand Location on the chromosome of Bacillus cereus ATCC (Mbp)

27 CONCLUSIONS The results demonstrate that mass spectrometry-based proteomics approach allows for : High confidence level classification and identification of bacteria based on genome traceable, proteomic similarities and differences between an analyzed microorganism and reference bacteria; Identification of pure cultures as well as mixtures of microorganisms.

28 Thank you!!!