689 Special Topics in Ecological Genomics. Spring January 20, 2015
|
|
- Sydney Watkins
- 6 years ago
- Views:
Transcription
1 689 Special Topics in Ecological Genomics Spring 2015 January 20, 2015
2 Dr. Claudio Casola, Assistant Professor in Forest Genomics, Department of Ecosystem Science and Management Phone: (979) Office hours: Monday or by appointment Office: HFSB 317
3 Course Topics, Calendar of AcJviJes, Major Assignment Dates Readings and discussions: Except for the computer demonstranons, each session will consist in the discussion of an assigned book chapter or papers. Papers discussion will be led by students, with exact dates to be determined at the beginning of the semester. When leading the discussion, students will prepare a PowerPoint presentanon with informanon about the background, methodological approach and main findings of the arncle, including tables/ figures in the main text and supplementary online material or other material if deemed interesnng. The presennng student is encouraged to prompt the discussion with quesnons to the audience. MeeNng with the instructor a week or a few days before presennng the paper is recommended. Online resources to help put together an effecnve presentanon and leading a discussion will also be provided. Requirement: 3 presentajons per student
4 Resources to present a paper UC Davies Graduate Studies h\p://gradstudies.ucdavis.edu/professional- development/gradpathways/ presentanon- skills Towson University- Guidelines For Student PresentaNons In Class h\p://grad.towson.edu/program/master/hurd- hrdg- ms/files/guidelines %20For%20Student%20PresentaNons%20In%20Class.pdf UNC poster and presentanon resources (lots of links) h\p://gradschool.unc.edu/academics/resources/posternps.html#prez
5 Course Topics, Calendar of AcJviJes, Major Assignment Dates Homework: Wri\en homework will be assigned in class and/or on the course website, usually about once a month. The objecnve of the homework is to help students pracnce the nuts- and- bolts computanons of populanon genencs, populanon genomics and transcriptomics, using available data sets. Answers to the homework will be available on the course website within 1-2 days aeer the class session at which the homework is due. Late assignment submissions will not be accepted, unless prearranged with the instructor or in an emergency situanon.
6 Course Topics, Calendar of AcJviJes, Major Assignment Dates WriTen Paper and final presentajon: Students will write a literature review of a topic of choice in ecological genomics. The subject of the review will be discussed with the instructor no later then March 12 th. This assignment will be graded on the basis of the quality of the points presented, the skill with which the arguments are made, as well as the quality of the wrinng. [ ] The main points of the review will be presented by each student in a 15 minutes talk toward the end of the course. This assignment can also be a project by a single person or a group
7 Grading Overall course percentage grade will be determined from a weighted average of: ParNcipaNon in discussions (20%) Leading discussions (20%) 4 homework (30% total) Wri\en paper and final presentanon (30%)
8 QuesJons about the reading assignments?
9 A Timeline of Genomics NHGRI National Human Genome Research Institute h\p://
10
11
12 The human genome project(s) February 2001
13 First sequenced genomes: viruses 1976, Fiers et al.: bacteriophage MS2, first sequenced genome, RNA genome (3,569 base pairs, Accession NC_001417). 1977, Sanger et al.: bacteriophage φx174 genome, DNA genome. 11 genes. (5,386 base pairs Accession J02482; NC_001422) David T. Denhardt 0.5 µm h"p://users.rcn.com/jkimball.ma.ultranet/ BiologyPages/PPhiX.html
14 Genomes and Databases Sequence Accession numbers are IDs that allow sequences to be easily deposited in and retrieved from online databases DDBJ, EMBL, GenBank The three main sequence databases. They are redundant and work in concert GenBank is the NIH genenc sequence database, an annotated collecnon of all publicly available DNA sequences GenBank is maintained by the NCBI (NaNonal Center for Biotechnology InformaNon)
15 The Structure of DNA
16 April, 1953
17 NucleoNdes
18
19 The double helix DNA normally consists of two annparallel polynucleonde chains sugar phosphate backbone phosphodiester bonds 5 to 3 connecnon complementary base pairs A T G C hydrogen bonds 2 per A T 3 per G C 5 3 chain polarity Major and minor grooves (see model) AATTGGCCGATC-3 3 -TTAACCGGCTAG-5
20
21 DNA features ReplicaNon: each strand serves as template for synthesis of complement, using rules of base pairing InformaNon: specified by sequence of nucleondes; may be copied into RNA MutaNon: replacement, insernon, delenon of nucleonde results in altered sequence
22 The Structure of Genes
23 Gene: definijons Molecular Cell Biology. 4th edijon (2000) h\p:// In molecular terms, a gene commonly is defined as the en@re nucleic acid sequence that is necessary for the synthesis of a func@onal polypep@de. [AND ALSO MANY TYPES OF RNAs WITH STRUCTURAL OR REGULATORY FUNCTIONS] What is a gene, post- ENCODE? History and updated definijon (2007) h\p://genome.cshlp.org/content/17/6/669.full A gene is a union of genomic sequences encoding a coherent set of potennally overlapping funcnonal products. The term "gene" is shared by many disciplines, including classical genetics, molecular genetics, evolutionary biology and population genetics. Because each discipline models the biology of life differently, the usage of the word gene varies between disciplines. It may refer to either material or conceptual entities.
24 Structure of genes Gene = transcripnonal unit Gene encodes coding RNA (mrna) or non- coding RNA (trna, rrna,mirna...) regulatory region DNA encoding funcnonal RNA RNA primary transcript Gene is a funcnonal element of the chromosome and is transcribed into RNA at the correct Nme and place in development or cell cycle To some researchers, gene actually includes its adjacent regulatory region(s)
25 EukaryoNc genes: introns and exons Intron: noncoding region of gene, excised by processing from primary transcript (=splicing) zero to many per eukaryonc gene variable length, may account for most of gene length FuncNon of introns poorly understood (no generic funcnon known, but they oeen contain regulatory sequences) Exon: coding region of gene (exon sequence is included in mature transcript) transcript E1 I1 E2 I2 E3 I3 E4 nuclear processing steps mature transcript E1 E2 E3 E4
26
27 The Structure of Genomes
28 What is a genome? The genome represents the whole hereditary informanon of an organism It is physically formed by DNA, except in some viruses where it is consntuted by RNA
29 The nature of genomes Prokaryotes One circular chromosome Zero- many plasmids Eukaryotes One nuclear genome, usually several chromosomes mitochondrial genomes chloroplast genomes in plants/algae
30 ProkaryoNc genome Usually circular double helix Gene- dense: genes are close together with li\le intergenic spacer Genes are oeen organized in operon tandem cluster of coordinately regulated genes Several genes transcribed as single mrna No spliceosomal introns
31 Prokaryotes: one genome per cell plus plasmids
32 Circle representanon of the genome of E. coli K- 12
33 Figure 1 The overall structure of thee. coli genome. F R Blattner et al. Science 1997;277: Published by AAAS
34 Eukaryotes: 2 or 3 different genomes per cell
35 The Mitochondrial Genome A map of the human mitochondrial genome - Circular, 2-10 copies per mitochondrion - Resembles a reduced prokaryonc genome in terms of organizanon and gene numbers - The human mitochondrion genome encodes 37 genes: 13 protein- coding genes involved in the producnon of energy (oxydanve phosphorylanon) and 24 non- coding genes involved in mrna translanon (trnas, rrna) - Maternally inherited
36 Mitochondrial genomes can vary in size between species Human (mammal) 16.5 kb MarchanJa (moss) 186 kb Yeast (fungus) 75 kb
37 The Chloroplast Genome (plants) MarchanJa (moss) CpDNA 121 kb - Circular - Resembles a reduced prokaryonc genome in terms of organizanon and gene numbers - Encodes genes mostly involved in photosynthesis and electron transport - Maternally inherited (transmi\ed through the seed) - Do not vary much in size
38 mitochondrion chloroplast Lack mitochondria (?)
39 Databases: NCBI Organelle genomes (NaNonal Center for Biotechnology InformaNon) htp://
40 Eukaryotes: 2 or 3 different genomes per cell
41 EukaryoNc nuclear genome: chromosomes Linear structure Chromosome number is conserved within species but greatly varies between species Ploidy refers to number of complete sets of chromosomes haploid (1n): one complete set of genes (e.g. yeast) diploid (2n) (e.g. most animals) polyploid ( 3n) (e.g. many plants, a few animals) In diploids, chromosomes come in homologous pairs (homologs) structurally similar same sequence of genes may contain different alleles
42 Structure of eukaryonc chromosomes Telomere Telomere
43 Chromosome # in eukaryotes Adders- tongue Ophioglossum re@culatum 1200 or 1260 Highest known chr # Jack jumper ant Myrmecia pilosula 2 2 for females, 1 for males (haploid) Fruit fly Drosophila melanogaster 8 6 autosomal, and 2 sexual Baker yeast Saccharomyces cerevisiae 32 THE NUMBER OF CHROMOSOMES DOES NOT CORRELATE WITH THE NUMBER OF GENES!! # of genes: human ~22,000 chicken ~18,000 fruit fly ~14,000 baker yeast ~6,000
44 Very different genome landscapes in prokaryotes and eukaryotes In prokaryotes, genes are compactly arranged, with li\le or no spacer sequences in between (short intergenic regions) = most of the genome is coding DNA In eukaryotes, there is considerable spacer DNA between genes (large intergenic regions) and within genes (introns) = most of the genome is non- coding DNA
45 Genome Size Units of measurement base pair (bp) kilobase (kb) = 1,000 bp megabase (Mb) = 1,000,000 bp Gigabase (Gb) = 1,000,000,000 bp
46 Genome Size Prokaryotes One circular chromosome ( Mb) Zero- many plasmids (1-1,000 Kb) Eukaryotes One nuclear genome, usually several chromosomes (10 Mb- 150 Gb) mitochondrial genomes (15-11,300 kb) chloroplast genomes in plants/algae ( kb)
47 Genome Size Prokaryotes One circular chromosome ( Mb) Zero- many plasmids (1-1,000 Kb) Eukaryotes One nuclear genome, usually several chromosomes (10 Mb- 150 Gb) mitochondrial genomes (15-11,300 kb) chloroplast genomes in plants/algae ( kb)
48 Genome Size Eukaryotes
49 Genome Size Eukaryotes mimiviruses
50 Some giant viruses are infected by other viruses! Giant viral genomes
51 Gene number and genome size in prokaryotes
52 Gene number and genome size in eukaryotes Protein- coding 21,000 21,000 28,000
53 The non- coding DNA of eukaryonc nuclear genomes Non-coding DNA: introns intergenic regions centromeric regions telomeric regions Most non-coding DNA is formed by identical or nearly identical repeated units (repetitive DNA) - two types of repetitive DNA: Tandem repeats (e.g. satellite DNA at centromeres and telomeric repeats at telomeres) Interspersed repeats (mostly transposable elements or TEs)
54 Differences in amount of repejjve DNA (TEs) explain differences in genome size in eukaryotes Mb 3000 Genomic DNA TE DNA Protein-coding DNA
55 ComparaNve genomics The study of the relanonship of genome structure and funcnon across different biological species or strains - Improve gene annotanon - IdenNfy funcnonal (conserved) sequences (genes, regulatory sequences, etc.) - Recognize species- specific features (novel genes, genomic rearrangements) - Describe the evolunon of genes and other funcnonal sequences and possibly how this relates to phenotypic evolunon - Improve our esnmates of fundamental genenc paramenters, i.e.: subsntunon rates - Obtain be\er phylogenenc trees of living organisms
56 Genome projects (not viruses, organelles or plasmids) (Jan 2015) complete and ongoing genome projects # species 1118 PopulaJon genomics: Thousands genomes/species 45, h\p://
The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA
The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationIntroduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationReview of Mitosis and Meiosis
Review of Mitosis and Meiosis NOTE: Since you will have already had an introduction to both mitosis and meiosis in Biol 204 & 205, this lecture is structured as a review. See the text for a more thorough
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationBiology I Fall Semester Exam Review 2014
Biology I Fall Semester Exam Review 2014 Biomolecules and Enzymes (Chapter 2) 8 questions Macromolecules, Biomolecules, Organic Compunds Elements *From the Periodic Table of Elements Subunits Monomers,
More informationPLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons
PLNT2530 (2018) Unit 5 Genomes: Organization and Comparisons Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationNumber of questions TEK (Learning Target) Biomolecules & Enzymes
Unit Biomolecules & Enzymes Number of questions TEK (Learning Target) on Exam 8 questions 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationThe Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationFrequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the
More informationAlgorithms in Computational Biology (236522) spring 2008 Lecture #1
Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: 15:30-16:30/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office hours:??
More informationEVOLUTION ALGEBRA Hartl-Clark and Ayala-Kiger
EVOLUTION ALGEBRA Hartl-Clark and Ayala-Kiger Freshman Seminar University of California, Irvine Bernard Russo University of California, Irvine Winter 2015 Bernard Russo (UCI) EVOLUTION ALGEBRA 1 / 10 Hartl
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationADVANCED PLACEMENT BIOLOGY
ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationTopic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
More informationUpdated: 10/11/2018 Page 1 of 5
A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,
More informationBIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
More informationDesigner Genes C Test
Northern Regional: January 19 th, 2019 Designer Genes C Test Name(s): Team Name: School Name: Team Number: Rank: Score: Directions: You will have 50 minutes to complete the test. You may not write on the
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationWelcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationInstructor: Dr. Darryl Kropf 203 S. Biology ; please put cell biology in subject line
Biology 2020 PRINCIPLES OF CELL BIOLOGY Spring 2004 In Principles of Cell Biology, we will explore the structure, function, and evolution of living cells, including prokaryotes (archae and eubacteria)
More informationHonors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationContra Costa College Course Outline
Contra Costa College Course Outline Department & Number: BIOSC 110 Course Title: Introduction to Biological Science Pre-requisite: None Corequisite: None Advisory: None Entry Skill: None Lecture Hours:
More informationCo-ordination occurs in multiple layers Intracellular regulation: self-regulation Intercellular regulation: coordinated cell signalling e.g.
Gene Expression- Overview Differentiating cells Achieved through changes in gene expression All cells contain the same whole genome A typical differentiated cell only expresses ~50% of its total gene Overview
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationSCALE: LEVEL 1 LACK OF EVIDENCE
Instructor: J. Lamboo Room: 228 Email: jlamboo@retsd.mb.ca Website: Please visit the River East Collegiate home page. If you follow the link About Us and Staff Directory students will have access to the
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationBiology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
More informationPeddie Summer Day School
Peddie Summer Day School Course Syllabus: BIOLOGY Teacher: Mr. Jeff Tuliszewski Text: Biology by Miller and Levine, Prentice Hall, 2010 edition ISBN 9780133669510 Guided Reading Workbook for Biology ISBN
More informationHonors Biology 9. Dr. Donald Bowlin Ext. 1220
Honors Biology 9 Instructor Dr. Donald Bowlin Phone 412-571-6000 Ext. 1220 Email bowlin@kosd.org Classroom Location Room 220 Mission Statement The KOSD s mission is to provide a safe learning environment
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationName: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
More informationEukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More informationLassen Community College Course Outline
Lassen Community College Course Outline BIOL-1 Principles of Molecular and Cellular Biology 4.0 Units I. Catalog Description A course in principles of biology, with special emphasis given to molecular
More informationAP BIOLOGY SUMMER ASSIGNMENT
AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of
More informationBig Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationTE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
More informationExtranuclear Inheritance. Dr.Shivani Gupta, PGGCG-11, Chandigarh
Extranuclear Inheritance Dr.Shivani Gupta, PGGCG-11, Chandigarh Commonly defined as transmission through the cytoplasm (or things in the cytoplasm, including organelles) rather than the nucleus Generally
More informationGENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationBIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:
Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding
More informationChapter 2 Lecture. Copyright 2009 Pearson Education, Inc.
Chapter 2 Lecture Mitosis Click to and edit Meiosis Master tit Copyright 2009 Pearson Education, Inc. 2.1 Cell Structure Is Closely Tied to Genetic Function Copyright 2009 Pearson Education, Inc. Copyright
More informationWest Windsor-Plainsboro Regional School District AP Biology Grades 11-12
West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels
More informationweek: 4 Date: Microscopes Cell Structure Cell Function Standards None 1b, 1h 1b, 1h, 4f, 5a 1a, 1c, 1d, 1e, 1g, 1j
July, 2004 week: 1 Topics Course introduction Lab Safety week: 2 Introduction to chemistry Chapter summarizing Note Taking week: 3 Biochemistry: Compounds of life week: 4 Microscopes Cell Structure Cell
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationRegulation of Transcription in Eukaryotes
Regulation of Transcription in Eukaryotes Leucine zipper and helix-loop-helix proteins contain DNA-binding domains formed by dimerization of two polypeptide chains. Different members of each family can
More informationX-Sheet 3 Cell Division: Mitosis and Meiosis
X-Sheet 3 Cell Division: Mitosis and Meiosis 13 Key Concepts In this session we will focus on summarising what you need to know about: Revise Mitosis (Grade 11), the process of meiosis, First Meiotic division,
More informationIntroduction to Biology
Introduction to Biology Course Description Introduction to Biology is an introductory course in the biological sciences. Topics included are biological macromolecules, cell biology and metabolism, DNA
More informationNATS 104 LIFE ON EARTH SPRING, 2004 FIRST 100-pt EXAM. (each question 2 points)
NATS 104 LIFE ON EARTH SPRING, 2004 FIRST 100-pt EXAM. (each question 2 points) Section: Name: Write your name and section on this page. On the bubble sheet write your name Last (space) First (space) M.I.
More informationMile-stones leading to the concept of nature of the gene: 1. The discovery of discrete units of inheritance in 1860s. - Mendel s pea experiments(
Homework IV. Bioenergetics 1. Calculate the G for ATP hydrolysis in a cell in which the [ATP]/[ADP] ratio had climbed to 100:1 while the P i concentration remained at10 mm. How does this compare to the
More informationECOL/MCB 320 and 320H Genetics
ECOL/MCB 320 and 320H Genetics Instructors Dr. C. William Birky, Jr. Dept. of Ecology and Evolutionary Biology Lecturing on Molecular genetics Transmission genetics Population and evolutionary genetics
More informationAQA Biology A-level. relationships between organisms. Notes.
AQA Biology A-level Topic 4: Genetic information, variation and relationships between organisms Notes DNA, genes and chromosomes Both DNA and RNA carry information, for instance DNA holds genetic information
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More informationCell Structure and Function
Quarter 2 Review Biology Cell Structure and Function Identify the organelles AND give function of each. 1. 1. 2. 2. 3. 3. 4. 4. 5. Looking at the above diagram, what does the structure labeled 1 do? Why
More informationText of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
More information2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW
Name: Period: 2017 DECEMBER BIOLOGY SEMESTER EXAM DISTRICT REVIEW 1. List the characteristics of living things. (p 7) 2. Use the Aquatic Food Web above to answer the following questions (Ch. 2) a. Which
More informationIntroduction to Genetics. Why do biological relatives resemble one another?
Introduction to Genetics Why do biological relatives resemble one another? Heritage Hair color, eye color, height, and lots of other traits are passed down through families. How does that happen? REPRODUCTION
More informationIntroduction to Biology Web Course Informational and Test Schedule
Introduction to Biology Web Course Informational and Test Schedule Spring 2011 Inquiry into Life by Sylvia Mader Introduction to Biological Science (BIO1100AAW1 & 2) Three Hours Credit Nancy Petersen Brian
More informationBiology Semester 1 Study Guide
Name Per Date Biology Semester 1 Study Guide The following Gizmos meet the standards assessed by the Biology EOC and should be reviewed during the first semester: 1. Rabbit Population by Season Gizmo 2.
More information9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationSpecial Topics on Genetics
ARISTOTLE UNIVERSITY OF THESSALONIKI OPEN COURSES Section 9: Transposable elements Drosopoulou E License The offered educational material is subject to Creative Commons licensing. For educational material,
More informationGrade Level: AP Biology may be taken in grades 11 or 12.
ADVANCEMENT PLACEMENT BIOLOGY COURSE SYLLABUS MRS. ANGELA FARRONATO Grade Level: AP Biology may be taken in grades 11 or 12. Course Overview: This course is designed to cover all of the material included
More informationQuiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme
More informationName Date Period Unit 1 Basic Biological Principles 1. What are the 7 characteristics of life?
Unit 1 Basic Biological Principles 1. What are the 7 characteristics of life? Eukaryotic cell parts you should be able a. to identify and label: Nucleus b. Nucleolus c. Rough/smooth ER Ribosomes d. Golgi
More informationGREENWOOD PUBLIC SCHOOL DISTRICT Genetics Pacing Guide FIRST NINE WEEKS Semester 1
FIRST NINE WEEKS Semester 1 1 Aug. 4 1 Introduction to Course Aug. 7 11 5 2 Aug. 14 18 5 Overarching Science Engineering Practices (SEPs) These concepts and skills should be continuously embedded during
More informationStudy Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5
Study Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5 Directions: The list below identifies topics, terms, and concepts that will be addressed on your Fall Final Exam. This list should
More informationGACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More informationCell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
More informationAdvanced Placement Biology
Advanced Placement Biology 2014-2015 Course Description This course is designed to be equivalent to a two-semester college introductory biology course sequence. AP Biology covers topics regularly covered
More informationI. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
More information15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
More informationHow much non-coding DNA do eukaryotes require?
How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics
More information9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
More informationDNA Structure and Function
DNA Structure and Function Nucleotide Structure 1. 5-C sugar RNA ribose DNA deoxyribose 2. Nitrogenous Base N attaches to 1 C of sugar Double or single ring Four Bases Adenine, Guanine, Thymine, Cytosine
More informationMiller & Levine Biology 2014
A Correlation of Miller & Levine Biology To the Essential Standards for Biology High School Introduction This document demonstrates how meets the North Carolina Essential Standards for Biology, grades
More informationConstructing a Pedigree
Constructing a Pedigree Use the appropriate symbols: Unaffected Male Unaffected Female Affected Male Affected Female Male carrier of trait Mating of Offspring 2. Label each generation down the left hand
More informationObjective 3.01 (DNA, RNA and Protein Synthesis)
Objective 3.01 (DNA, RNA and Protein Synthesis) DNA Structure o Discovered by Watson and Crick o Double-stranded o Shape is a double helix (twisted ladder) o Made of chains of nucleotides: o Has four types
More information