NMR for studying biomolecular recognition and dynamics

Size: px
Start display at page:

Download "NMR for studying biomolecular recognition and dynamics"

Transcription

1 NMR for studying biomolecular recognition and dynamics Michael Sattler Outline Biomolecular NMR Tools for studying protein ligand interactions and macromolecular complexes Example Multi-domain proteins and complexes in splicing regulation

2 Structure/imaging from molecules to animals MRI Animal Static picture, snapshots Light microscopy EM tomography Cryo EM SAXS, SANS X-ray NMR Size, spatial resolution Cell Protein complexes Molecular machines 10 3 [s] Proteins, domains Dynamics, timescales Chemical Biology Small molecules Dynamics: regulation NMR Light microscopy MRI Biomolecular NMR Structure determination of biomacromolecules no crystal needed, native-like conditions: solution, macromolecular crowding, in cell NMR (Xenopus oocyctes) transient regulatory interactions, flexible linkers Ligand binding and molecular interactions in solution NMR fingerprint: macromolecular and small molecule interactions Dynamics and mobility (ps days) conformational dynamics enzyme turnover, kinetics, folding Multidisciplinary approaches combine NMR and X-ray with SAXS/SANS, EPR, FRET, free 250 bound 200 T2 [ms] SANS SAXS RDCs residue

3 Nuclear spins, Magnetic moments & Resonance precession frequency B 0 B 0 NMR Magnet Magnetic field nuclear magnetic dipole Nuclear spin Resonance = B 0 Apply radio frequency at resonance to measure the nuclear precession frequencies Fourier transformation frequency NMR spectrum time t 900 MHz Historischer NMR-Magnet (Eisen, 1.4 Tesla, 60 MHz) 60 MHz 250 MHz

4 800 MHz 900 MHz 750 MHz 600 MHz 250MHz Ribonuklease 40 MHz M. Saunders et al. J.Amer.Chem.Soc. 1957, 79, 3289 Lysozym 900 MHz München ppm

5 A 1D NMR spectrum of a protein H H H Is my protein folded? Unfolded 20 kda protein Folded 20 kda protein CH3 aliphatic CH3 CH2 backbone HN backbone HN side chain NH2 aromatic CH Trp H side chain NH2 aromatic CH CH ppm ppm ppm ppm

6 NMR sample Sample preparation and isotope labeling ( 15 N, 13 C, 2 H) overexpression of recombinant proteins in E.coli using minimal media Sample conditions: NMR fingerprint spectra H 2D 1 H, 15 N correlation (HSQC, TROSY) C O N C 15 N 15 N 1 H 1 H Side view Contour plot

7 Chemical exchange A B NMR time scale (chemical shift) slow exchange k ex << coalescence k ex ~ k 1 A B k -1 k ex = k 1 k -1 fast exchange k ex >> Chemical or conformational exchange: Line widths and Larmor frequencies depend on the exchange rates and the chemical shifts of the interconverting states behaves similar to NOE cross peaks in 2D NOESY rate constants can be determined, e.g. 2-state binding equilibrium, chemical reaction, or conformational exchange Dynamics - NMR time scales A B NMR time scale (chemical shift) slow exchange k ex << coalescence k ex ~ k 1 A B k -1 k ex = k 1 k -1 fast exchange k ex >> Chemical or conformational exchange can be analyzed by NMR Rate constants can be determined, e.g. for a 2-state binding equilibrium, chemical reaction, or conformational exchange

8 NMR time scales and dynamics in biology T1, T2 relaxation NOE T1ρ, CPMG exchange spectroscopy Residual dipolar and scalar couplings (RDCs, J) real time rates s s s s -1 1 s -1 time 1 ps 1 ns 1 s 1 ms 1 s molecular tumbling folding internal motion enzyme kinetics, exchange ligand binding bond vibrations side chain rotations domain motion ligand binding enzyme kinetics folding, H/D exchange Ligand binding in NMR titrations - fast exchange Binding in fast exchange on the NMR chemical shift time scale Dissociation constant K D from binding isotherm free bound [P] < K D Fraction bound [PL] ~ obs - free = f([l tot ]) Selenko et al (2001) Nature Struct. Biol. 8, k on P L PL k off K d = [P][L] / [PL] = k B /k A k A = k on [L]; k B = k off B = protein-ligand complex PL A = free protein P

9 The NMR band shift and binding site mapping Chemical shift perturbation upon ligand binding Mapping of the ligand binding site onto the structure Protein Protein-RNA Lingel et al (2003) Nature 426, Lingel et al (2004) Nat Struct Mol Biol 11, Ligand binding by NMR - slow exchange 1:1 B2 dimer:dsrna stoichiometry binding affinity: K d ~ nm (slow exchange) non-sequence specific dsrna contacts (one set of NMR signals, non-palindromic ligand) Binding in slow exchange on the NMR chemical shift time scale [P] > K D 5 GCAGCACGACUUCUUCAAGTT 3 3 TTCGUCGUGCUGAAGAAGUUC 5 Lingel et al. (2005) EMBO Rep. 6,

10 Folding upon ligand binding seen by NMR NMR spectrum of a novel RNA binding domain when bound to an RNA oligonucleotide Protein ProteinRNA (misfolded) Mourao et al. RNA. (2010) Structure-based drug design Targeting protein-protein interactions by small molecules: Structure of protein-peptide complex available Starting point for structure based ligand design In silico screen => NMR hit validation OH N Cl Cl OH Crystal structure of protein-peptide complex In silico screen NMR titrations with small molecule inhibitors

11 SAR by NMR Nature (2005) Peptide binding Bcl-2 inhibitor binding Science (1997) Structural modules at the 3 splice site Selenko et al Mol. Cell. (2003) Kielkopf et al. Cell (2001) Liu, Luyten et al. Science (2001) SF1 P RRM3 U2AF 65 U2AF 35 QUA2 KH RRM 5 UACUAAC UUUUUUU AG 3 Ito et al. EMBO J. (1999); Sickmier et al Mol.Cell (2006)

12 U2AF65 - form a compact structure U2AF65 - necessary and sufficient for Py tract RNA binding Two structural domains, connected by a flexible linker SF1 U2AF 65 U2AF 35 U2AF 65 U2AF 65 UACUAAC UUUUUUU AG Transverse relaxation T2 [ms] Flexibility U2AF 65 - U 9 RNA UUUUUUU flexible linker MHz, T=295K c 12 ns MW 20 kda Residue Number NMR approaches for studying large complexes 3D structure of subunits available (X-ray, NMR, homology model) Subunit-selective labeling, optimized 2 H-labeling Domain interfaces PRE (spin label) Chemical shift perturbations upon binding Interdomain NOEs Saturation transfer PREs (spin labeling) Solvent PREs Solvent PRE Domain arrangement, orientatio Residual dipolar couplings (RDCs) Pseudo contact shifts (PCSs) Small angle scattering (SAS) RDCs Domain orientation Structure calculation Joint refinement against all restraints: CSP, (NOE), PRE, RDC,SAS SAXS/SANS Simon, et al Angew. Chem (2010) ; Madl et al JACS (2010); Madl et al Angew. Chem (2011); Madl et al J Struct Biol (2011)

13 Interdomain distance restraints from spin labels PRE (paramagnetic relaxation enhancement) Long-range distance restraints (<20 Å) Multiple single-cys mutants molecular biology Distance calibration: transverse PRE Reference Spin label RNA spin labeling: Chemically synthesize thiouracil RNA oligo Protein spin labeling: CH 3 CH 3 N O CH 3 CH 3 O NH C CH 2 S N R N 4-thiouracil proxyl Varani JACS (1998) O Recombinant single Cys mutant proteins MTSL IPSL 3-[2-iodoacetamido]-proxyl Global structure from NMR data Individual domain structures available Spin labeling paramagnetic relaxation enhancements (PRE) PRE-derived distance restraints to define interdomain arrangement Interdomain distance restraints IPSL Simon, et al (2010) Angew. Chem; Madl, et al (2010) JACS

14 Solution conformation differs from crystal structure NMR Importance of using solution methods for studying multidomain proteins RDC exp [Hz] X-ray RNA RDC calc [Hz] 2 linker RDC exp [Hz] Sickmier et al Mol. Cell (2006) RDC calc [Hz] Distinct domain arrangement Bound to U9 RNA No RNA residue residue open closed Mackereth et al Nature (2011)

15 U2AF65 - adopts a closed conformation The RNA-binding surface of in free U2AF 65 is partially shielded RNA Chemical shift /ppm K D = 160 M () K D > 3 mm () [U(4)RNA] /μm C305 () G154 () U(4) U2AF 65 U(9) U(13) Model Py-tracts : vs binding Py tract 3 ss Human U2 introns K D /μm 33 UUUU U4 Py tract strength UUUUAAAA U4A4 UUUUAAAAAAAAUUUU U4A8U4 UUUUAAAAUUUU U4A4U4 1.3 UUUUUUUUU U UUUUUUUUUUUUU U13 always binds variable binding

16 Population shift between distinct domain arrangements Kd /μm unbound UUUU U4 UUUUAAAA U4A4 UUUUAAAAAAAAUUUU U4A8U4 UUUUAAAAUUUU U4A4U4 UUUUUUUUU U9 Py tract strength spliceosome assembly In vitro splicing assays in nuclear extract Py tract strength RNA 3 ss MINX ATP NE titration A complex K d - 4 U 4 A 8 U μm 16 μm 7.1 μm 1.3 μm U 4 A 4 U 4 A 4 U WT Sophie Bonnal, Juan Valcarcel

17 Population shift closed/open regulates splicing Population open (bound) conformation Py tract strength Pre-existing bound conformations in free - PRE calculated free RNA bound PRE measured Consistent with free structure Consistent with population of bound form

18 Locked closed mutant (D215R/G319R) shifts the equilibrium Mutations remote from RNA binding interface impair RNA binding and complex A formation destabilize 'open' conformation stabilize 'closed' conformation G319R G319R wt mutant D215R G319R D215R G319R D215R D215R Multi-domain conformational selection

19 Why two distinct domain arrangements? Exposure of conserved surface: additional regulation by protein binding U2AF35, DEK, A1,? - -/ RNA conservation Conclusions NMR is a powerful technique for studying the structure, molecular interactions and dynamics of protein complexes in solution transient interactions, flexible linkers, Label-free, native-like solution conditions in buffer or even in cell or in cell extracts residue-level structural resolution of binding and dynamics! Large complexes can be studied in solution by using optimized methods ( 2 H labeling, TROSY) and integrated structural biology approaches (NMR SAXS/SANS) Multi-domain conformational selection for Py tract RNA recognition by U2AF65

20 Acknowledgements Cameron Mackereth Tobias Madl Bernd Simon Katia Zanier Alexander Gasch Frank Gabel Kostas Tripsianes Helge Meyer Peijian Zou Andre Mourao Anders Friberg Fatiha Kateb Malgosia Duszczyk Lorenzo Corsini Collaborations Sophie Bonnal, Juan Valcarcel (Barcelona) Michael Nilges (Paris) Dmitri Svergun (EMBL Hamburg) Vladimir Rybin (EMBL Heidelberg) Dirk Görlich, Thomas Güttler (Göttingen) Gabi Schramm (Borstel) Jochen Müller-Dieckmann (EMBL Hamburg)

Studying conformational dynamics and molecular recognition using integrated structural biology in solution Michael Sattler

Studying conformational dynamics and molecular recognition using integrated structural biology in solution Michael Sattler Studying conformational dynamics and molecular recognition using integrated structural biology in solution Michael Sattler http://www.nmr.ch.tum.de http://www.helmholtz-muenchen.de/stb/ Outline Dynamics

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

Introduction to biomolecular NMR spectroscopy

Introduction to biomolecular NMR spectroscopy Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

K ex. Conformational equilibrium. equilibrium K B

K ex. Conformational equilibrium. equilibrium K B Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

Protein-protein interactions (PPIs) via NMR. Paola Turano

Protein-protein interactions (PPIs) via NMR. Paola Turano Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction

More information

Protein-protein interactions (PPIs) via NMR. Paola Turano

Protein-protein interactions (PPIs) via NMR. Paola Turano Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens

More information

Spin Relaxation and NOEs BCMB/CHEM 8190

Spin Relaxation and NOEs BCMB/CHEM 8190 Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

More information

NMR-spectroscopy in solution - an introduction. Peter Schmieder

NMR-spectroscopy in solution - an introduction. Peter Schmieder NMR-spectroscopy in solution - an introduction 2/92 Advanced Bioanalytics NMR-Spectroscopy Introductory session (11:00 12:30) Basic aspects of NMR-spectroscopy NMR parameter Multidimensional NMR-spectroscopy

More information

TITAN: Two-dimensional lineshape analysis

TITAN: Two-dimensional lineshape analysis TITAN: Two-dimensional lineshape analysis Chris Waudby Christodoulou Group c.waudby@ucl.ac.uk Andres Ramos Lisa Cabrita John Christodoulou Inhibition of fatty acid synthesis for treatment of tularemia

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

NMR Spectroscopy. Guangjin Hou

NMR Spectroscopy. Guangjin Hou NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

Chemical Exchange and Ligand Binding

Chemical Exchange and Ligand Binding Chemical Exchange and Ligand Binding NMR time scale Fast exchange for binding constants Slow exchange for tight binding Single vs. multiple binding mode Calcium binding process of calcium binding proteins

More information

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary

More information

Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy

Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Bernhard Brutscher Laboratoire de Résonance Magnétique Nucléaire Institut de Biologie Structurale -

More information

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07 NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each

More information

- Basic understandings: - Mapping interactions:

- Basic understandings: - Mapping interactions: NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis

More information

NMR-spectroscopy of proteins in solution. Peter Schmieder

NMR-spectroscopy of proteins in solution. Peter Schmieder NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

T 1, T 2, NOE (reminder)

T 1, T 2, NOE (reminder) T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation

More information

Quantification of Dynamics in the Solid-State

Quantification of Dynamics in the Solid-State Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid

More information

Protein NMR spectroscopy

Protein NMR spectroscopy Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding

More information

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer

More information

Filtered/edited NOESY spectra

Filtered/edited NOESY spectra Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Introduction to Relaxation Theory James Keeler

Introduction to Relaxation Theory James Keeler EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

17. Biomolecular Interaction

17. Biomolecular Interaction 17. Biomolecular Interaction Methods for characterizing biomolecular interactions Sequence-specific DNA binding ligands Molecular mechanisms of drug action and drug resistance In silico compound design

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously

More information

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

Basic principles of multidimensional NMR in solution

Basic principles of multidimensional NMR in solution Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra

More information

Macromolecular X-ray Crystallography

Macromolecular X-ray Crystallography Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection

More information

Experimental Techniques in Protein Structure Determination

Experimental Techniques in Protein Structure Determination Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance

More information

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE

BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications

More information

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Lecturer: Gabriele Varani Biochemistry and Chemistry Room J479 and

More information

Slow symmetric exchange

Slow symmetric exchange Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Determining Protein Structure BIBC 100

Determining Protein Structure BIBC 100 Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic

More information

Modelling against small angle scattering data. Al Kikhney EMBL Hamburg, Germany

Modelling against small angle scattering data. Al Kikhney EMBL Hamburg, Germany Modelling against small angle scattering data Al Kikhney EMBL Hamburg, Germany Validation of atomic models CRYSOL Rigid body modelling SASREF BUNCH CORAL Oligomeric mixtures OLIGOMER Flexible systems EOM

More information

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data

Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data Computational Modeling of Protein Kinase A and Comparison with Nuclear Magnetic Resonance Data ABSTRACT Keyword Lei Shi 1 Advisor: Gianluigi Veglia 1,2 Department of Chemistry 1, & Biochemistry, Molecular

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Structure of the α-helix

Structure of the α-helix Structure of the α-helix Structure of the β Sheet Protein Dynamics Basics of Quenching HDX Hydrogen exchange of amide protons is catalyzed by H 2 O, OH -, and H 3 O +, but it s most dominated by base

More information

Paramagnetic Effects BCMB/CHEM

Paramagnetic Effects BCMB/CHEM Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti

More information

How to study the structure and dynamics of protein-rna complexes by NMR spectroscopy

How to study the structure and dynamics of protein-rna complexes by NMR spectroscopy Biomolecular NMR Spectroscopy A.J. Dingley and S.M. Pascal (Eds.) IOS Press, 2011 2011 The authors and IOS Press. All rights reserved. doi:10.3233/978-1-60750-695-9-249 249 How to study the structure and

More information

Solid state and advanced NMR

Solid state and advanced NMR Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical

More information

Protein-nucleotide interactions detected by solid-state NMR

Protein-nucleotide interactions detected by solid-state NMR 190 Å Protein-nucleotide interactions detected by solid-state NMR Dr. Thomas Wiegand CCPN Meeting 2017, Stirling 15/07/2017 120 Å HpDnaB ATP or ATP-analogues + ssdna? Laboratory of Physical Chemistry Group

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Connecting NMR data to biomolecular structure and dynamics

Connecting NMR data to biomolecular structure and dynamics Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...

More information

Chem 325 NMR Intro. The Electromagnetic Spectrum. Physical properties, chemical properties, formulas Shedding real light on molecular structure:

Chem 325 NMR Intro. The Electromagnetic Spectrum. Physical properties, chemical properties, formulas Shedding real light on molecular structure: Physical properties, chemical properties, formulas Shedding real light on molecular structure: Wavelength Frequency ν Wavelength λ Frequency ν Velocity c = 2.998 10 8 m s -1 The Electromagnetic Spectrum

More information

Introduction to biological small angle scattering

Introduction to biological small angle scattering Introduction to biological small angle scattering Frank Gabel (IBS/ILL) EMBO Practical Course (May 6th 013) F. Gabel (May 6th 013) EMBO Practical Course Length-scales and tools in structural biology small

More information

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07

Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07 Where do we stand on Projection NMR Spectroscopy? Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space

More information

Inorganic Spectroscopic and Structural Methods

Inorganic Spectroscopic and Structural Methods Inorganic Spectroscopic and Structural Methods Electromagnetic spectrum has enormous range of energies. Wide variety of techniques based on absorption of energy e.g. ESR and NMR: radiowaves (MHz) IR vibrations

More information

Nuclear Magnetic Resonance

Nuclear Magnetic Resonance Nuclear Magnetic Resonance Lectures for CCB 538 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu J.A.! 04/21/14! April 21!!!!April 23!! April 28! Outline 1. Introduction / Spectroscopy Overview! 2. NMR

More information

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire

More information

Protein-protein interactions by NMR

Protein-protein interactions by NMR Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off

More information

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR Dmitry M. Korzhnev Department of Molecular, Microbial and Structural Biology University of Connecticut Health Center 263 Farmington

More information

Polarised Nucleon Targets for Europe, 2nd meeting, Bochum 2005

Polarised Nucleon Targets for Europe, 2nd meeting, Bochum 2005 Polarised Nucleon Targets for Europe, nd meeting, Bochum Temperature dependence of nuclear spin-lattice relaxations in liquid ethanol with dissolved TEMPO radicals H. Štěpánková, J. Englich, J. Kohout,

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs. Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations

More information

Protein NMR. Bin Huang

Protein NMR. Bin Huang Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for

More information

Interactions and Dynamics within the Troponin Complex

Interactions and Dynamics within the Troponin Complex Interactions and Dynamics within the Troponin Complex Tharin Blumenschein Steve Matthews Lab - Imperial College London (formerly Brian Sykes Lab, Canada) Striated muscle Thin filament proteins - regulation

More information

Nature Structural & Molecular Biology: doi: /nsmb.3194

Nature Structural & Molecular Biology: doi: /nsmb.3194 Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-

More information

Christopher Pavlik Bioanalytical Chemistry March 2, 2011

Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces

More information

Development of Novel Small- Angle X-ray Scattering Data Analysis Methods for Study of Flexible Proteins. Michael Kachala EMBL-Hamburg, Germany

Development of Novel Small- Angle X-ray Scattering Data Analysis Methods for Study of Flexible Proteins. Michael Kachala EMBL-Hamburg, Germany Development of Novel Small- Angle X-ray Scattering Data Analysis Methods for Study of Flexible Proteins Michael Kachala EMBL-Hamburg, Germany 60 mkl >1 mg/ml Monocromatic X-ray beam Sample Mono- or polydisperse

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

(S)Pinning down protein interactions by NMR

(S)Pinning down protein interactions by NMR REVIEW (S)Pinning down protein interactions by NMR Kaare Teilum,* Micha Ben Achim Kunze, Simon Erlendsson, and Birthe B. Kragelund* Structural Biology and NMR Laboratory, The Linderstrøm-Lang Centre for

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

Microcalorimetry for the Life Sciences

Microcalorimetry for the Life Sciences Microcalorimetry for the Life Sciences Why Microcalorimetry? Microcalorimetry is universal detector Heat is generated or absorbed in every chemical process In-solution No molecular weight limitations Label-free

More information

Magnetic Resonance Spectroscopy EPR and NMR

Magnetic Resonance Spectroscopy EPR and NMR Magnetic Resonance Spectroscopy EPR and NMR A brief review of the relevant bits of quantum mechanics 1. Electrons have spin, - rotation of the charge about its axis generates a magnetic field at each electron.

More information

LineShapeKin NMR Line Shape Analysis Software for Studies of Protein-Ligand Interaction Kinetics

LineShapeKin NMR Line Shape Analysis Software for Studies of Protein-Ligand Interaction Kinetics LineShapeKin NMR Line Shape Analysis Software for Studies of Protein-Ligand Interaction Kinetics http://lineshapekin.net Spectral intensity Evgenii L. Kovrigin Department of Biochemistry, Medical College

More information

Protein-protein interactions and NMR: G protein/effector complexes

Protein-protein interactions and NMR: G protein/effector complexes Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound

More information

Supporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets

Supporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Supporting Information Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Steven L. Swann, Danying Song, Chaohong Sun, Philip J. Hajduk, and Andrew M. Petros Global Pharmaceutical

More information

Targeting protein-protein interactions: A hot topic in drug discovery

Targeting protein-protein interactions: A hot topic in drug discovery Michal Kamenicky; Maria Bräuer; Katrin Volk; Kamil Ödner; Christian Klein; Norbert Müller Targeting protein-protein interactions: A hot topic in drug discovery 104 Biomedizin Innovativ patientinnenfokussierte,

More information

schematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc.

schematic diagram; EGF binding, dimerization, phosphorylation, Grb2 binding, etc. Lecture 1: Noncovalent Biomolecular Interactions Bioengineering and Modeling of biological processes -e.g. tissue engineering, cancer, autoimmune disease Example: RTK signaling, e.g. EGFR Growth responses

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

File: {ELS_REV}Cavanagh X/Revises/Prelims.3d Creator: / Date/Time: /9:29pm Page: 1/26 PREFACE

File: {ELS_REV}Cavanagh X/Revises/Prelims.3d Creator: / Date/Time: /9:29pm Page: 1/26 PREFACE PREFACE The second edition of Protein NMR Spectroscopy: Principles and Practice reflects the continued rapid pace of development of biomolecular NMR spectroscopy since the original publication in 1996.

More information