Where do we stand on Projection NMR Spectroscopy? Thomas Szyperski Chianti Workshop 06/05/07
|
|
- Gervais Sanders
- 5 years ago
- Views:
Transcription
1 Where do we stand on Projection NMR Spectroscopy?
2 Definition: Projection Mapping an N dimensional vector space onto an N-K dimensional sub-space Associated Definitions Specify field over which vector space is defined Dimensionality N of vector space Dimensionality N-K of sub-space Mapping associated with projection Retrieval of N dimensional information
3 Definition: GFT Projection NMR (early 2002) Mapping an N > 2 dimensional conventional spectrum onto 2 K N t 2 dimensional projected spectra Associated Definitions Vector space: complex Dimensionality of conventional spectrum: N arbitrary Dimensionality of projected spectra: N > N t 2 Mapping associated with projection: linear combinations of shifts measured phase-sensitively sensitively in pure absorption mode Retrieval of N dimensional spectral information: Unambiguous identification of chemical shift multiplets: Central peak detection ( orthogonal( projections ) ) and/or differential scaling of jointly ( radially( radially ) ) sampled shift evolution periods Calculation of shifts from a system of equations derived from the e linear combinations of chemical shifts Validation of retrieval of N dimensional spectral information
4 4D FT NMR spectrum (Ω 1, Ω 2, Ω 3, Ω 4 ) ω 1 ω 2 ω 3 ω 4
5 (4,2)D GFT NMR experiment Ω 1 + Ω 2 + Ω 3 Ω 1 + Ω 2 - Ω 3 Ω 1 - Ω 2 + Ω 3 Ω 1 - Ω 2 - Ω 3 ω 1 (GFT) Ω 1 + Ω 2 Ω 1 - Ω 2 measurement of linear combinations of shifts in different sub-spectra spectra phase-sensitivelysensitively and in pure absorption mode challenge: unambiguous identification of shift multiplets Ω 1 ω 2
6 Key challenge: Phase sensitive - Pure absorption mode Projected spectra (4,2)D GFT NMR
7 In general:
8 Validation: Dimensionality of N D spectrum was retrieved intensities scaling central peaks
9
10
11 Definition: 3D->2D Projection in space Mapping an N = 3 dimensional object onto an 2 dimensional projection plane Associated Definitions Vector space: real Dimensionality of object: 3 Dimensionality of projection: 2 Mapping associated with projection: e.g., integral along projection direction Retrieval of 3D information Reconstruction (e.g., Radon Transformation)
12 Methodology Transfer for NMR
13 Projection Reconstruction (PR) NMR (Kupce & Freeman, JACS 2004, 126, 6429)
14 Projection component in Projection-reconstruction reconstruction (PR) NMR is equivalent to GFT projection NMR
15 (4,2)D GFT NMR
16 G-matrix transformation standard hyper-complex FT
17 Scaling of shift evolution periods tilt angles of plane projection
18
19
20 tilted projected spectrum
21 Role of G-matrix G transformation in Projection NMR spectroscopy Phase-sensitive sensitive detection of linear of combinations of chemical shifts combined with (time domain) editing into pure absorption mode sub-spectra spectra
22 Major developments in the s 1980s (Richard Ernst and coworkers) Skewed projections of homo-nuclear 2D J-spectra were calculated using the projection cross-section section theorem to obtain decoupled 1D 1 H NMR spectra; No o joint incrementation of shift evolution periods or phase- sensitive signal detection No pure absorption mode spectra Accordion NMR : joint sampling of chemical shift evolution period and mixing time in EXSY -> Reduction in dimensionality
23
24 The Projection cross section theorem is a blunt weapon in Projection NMR: was derived for N to N-1 N 1 dimensional projections (Bracewell( Bracewell,, 1956); does not imply how to edit components of shift multiplets into sub-spectra; spectra; does not imply how to implement phase sensitive detection; does not imply how to obtain pure absorption mode sub-spectra; spectra;
25
26 A major challenge for future development of Projection NMR: Demand for a generally accepted nomenclature
27
28
29
30
31
32
33 Classification of Projected NMR spectra Which chemical shifts are jointly sampled? Dimensionality of the spectral information? Are the projected sub-spectra spectra used to reconstruct conventional ND spectra?
34 GFT Projection NMR records
35 Pilot study (3.2004): Structure of 14 kda YqfB 16.9 hrs GFT spectra for resonance assignment and 9.1 hrs for simultaneous 3D NOESY (1 mmol solution at 25 o C and 600 MHz w/cryogenic probe)
36
37 Highest-dimensional spectral Information for a protein: 6D H αβ C αβ C α CONHN in 29 hours
38 Expansion of the GFT NMR arsenal..
39 Longitudinal relaxation optimized GFT NMR: L-GFT SoFast,, Best NMR Ultrasofast NMR: Frydman, Brutscher et al.
40 L-GFT NMR for aromatic rings
41 Ring flipping and functional dynamics in the 21 kda protein HR41
42 (4,3)D [HN/H 13 C ali ]-NOESY-[NH/ 13 H]: 13 C ali H]: Rapid acquisition of highly resolved 4D NOESY information
43 NOEs directly assigned in 3D NOESY based on shifts only: without with (4,3)D NOESY
44 G 2 FT NMR: a contribution to establish NMR-based structural genomics of membrane proteins and to study (partially) unfolded proteins
45 (5,3)D HN{N,CO CO}{ }{C αβ C α }
46 GFT NMR applied for structural genomics
47 Approaches for rapid NMR data collection
48 PSI-1: NMR based structural genomics works and is often the only choice
49 NESGC NMR Program Five experimental research groups 15 FTE Ph.D. level researchers 88 NMR structures in PSI-2 (84 in PSI-1) Strong methodology development component Publications in PSI-2: 41
50 NESG NMR Structures from Szyperski Lab: MW distribution MW [Da] ER75 TT212 QR6 MR19 GR2 PfR13 flua CcR19 ET99 HR532 VT1 PfR14 MaR11 SR215 ET95 BcR68 BhR29 XcR50 MrR16 PaT85 HR41 SR220 HR2106 NeT3 ER226 HdR14 SoR39 StR70 PaT89 SR482 ER415 SR213 PaT90 SR355 TT821A GR101 Str106 GR83 StR109 CgR3 CgR1 SsR105 Sr500a SsR10 rpt8 MR32 BcR54 VcR36 NESG ID
51 OR9 - tetramer 2g9j MW 16,108 MONTELIONE HR dimer 2b MW 21,844 SZYPERSKI SR450 - dimer 2dsm MW 14,152 KENNEDY StR109 - dimer 2jna MW 20,606 SZYPERSKI OR1 - dimer 1ihg MW 8,646 MONTELIONE GR83 - dimer 2nwt MW 14,152 SZYPERSKI
52 Protein yjbr from E. coli -ER226 Li N, Sickmier E A, Zhang R, Joachimiak A, White S W. Mol. Microbiol 2002; III 43:1079. N I B F A E C D C II IV C I I C B A N C N B A III C D F F IV E II E III D II PF04237 with 122 proteins without functional assignment Five β-strands A( ), B( ), C( ), D( ), F( ) and E( ) Dali: C-terminal domain (1kaf) of the bacteriophage T4 transcription factor MotA Recently discovered DNAbinding motif : "double wings" Sequence conservation within Pfam04237: all 122 members are DNA binding domains with double wing motif High leverage value Singarapu, Liu, Xiao, Bertonati, Honig, Montelione, Szyperski (2007) Proteins 65,
53 J-GFT NMR for Precise Measurement of Mutually Correlated Nuclear Spin-spin Couplings Residual Dipolar Couplings (RDCs): orientational constraints Structure validation and refinement (Homo-dimers, e.g. GR83) Determination of relative domain orientation Fold determination with sparse NOE networks Support of resonance assignment Identification of secondary structure Investigation of protein dynamics Complement of in silico structure prediction Simultaneous, correlated measurement of different types of RDCs Single NMR experiment: no variation of r.f. duty cycles Resolve chemical shift degeneracy RDCs are grouped according to spin system even if no sequential resonance assignments are available
54 J-GFT (6,2)D (HA-CA-CO)-N-HN K = D + J K C α H α H α C α K C α C C K C N H N N K NH N
55 J-GFT NMR: concept Spin-spin couplings are real numbers Chemical shifts are represented by complex numbers pseudo phase sensitive detection: cos(ωt) ) + i sin(ωt) J-GFT requires detection of cos(πκt) + i sin(πκt) no additional evolution periods Extension of GFT NMR formalism / new approach for sampling J-evolution in time domain
56
57
58 Phase correction of real component only
59
60 8 KDa protein Z-domain non-aligned (blue), aligned with Pf1 phages (red)
61 Summary J-GFT NMR Approach for simultaneous, correlated and precise measurement of RDCs and scalar nuclear spin-spin couplings RDCs are grouped independent of the availability of resonance assignments -> more reliable fold recognition based on statistical analysis of RDC distributions Extended GFT NMR formalism / sampling protocol relaxes constraints thus far encountered for the design of GFT NMR experiments
62 Recent developments / projects Hi-fi NMR Automated Projection Spectroscopy Variations of FT for reconstruction Combination of GFT NMR with MEM, MDD Combination of GFT NMR with ultrafast NMR GFT solid state NMR
63 Frydman and Szyperski, 2003 From: NSF application submitted
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationPrinciples of Nuclear Magnetic Resonance in One and Two Dimensions
Principles of Nuclear Magnetic Resonance in One and Two Dimensions Richard R. Ernst, Geoffrey Bodenhausen, and Alexander Wokaun Laboratorium für Physikalische Chemie Eidgenössische Technische Hochschule
More informationLongitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy
Longitudinal-relaxation enhanced fast-pulsing techniques: New tools for biomolecular NMR spectroscopy Bernhard Brutscher Laboratoire de Résonance Magnétique Nucléaire Institut de Biologie Structurale -
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationFast reconstruction of four-dimensional NMR spectra from plane projections
Journal of Biomolecular NMR 28: 391 395, 2004. KLUWER/ESCOM 2004 Kluwer Academic Publishers. Printed in the Netherlands. 391 Fast reconstruction of four-dimensional NMR spectra from plane projections Eriks
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationChristopher Pavlik Bioanalytical Chemistry March 2, 2011
Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationIntroduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations
Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationSpin-spin coupling I Ravinder Reddy
Spin-spin coupling I Ravinder Reddy Spin-interactions External interactions Magnetic field Bo, RF field B1 Internal Interactions Molecular motions Exchange Chemical shifts J-coupling Spin Diffusion Dipolar
More informationGFT NMR, a New Approach To Rapidly Obtain Precise High-Dimensional NMR Spectral Information
Published on Web 01/10/2003 GFT NMR, a New Approach To Rapidly Obtain Precise High-Dimensional NMR Spectral Information Seho Kim and Thomas Szyperski* Contribution from the Department of Chemistry, UniVersity
More informationCOPYRIGHTED MATERIAL. Production of Net Magnetization. Chapter 1
Chapter 1 Production of Net Magnetization Magnetic resonance (MR) is a measurement technique used to examine atoms and molecules. It is based on the interaction between an applied magnetic field and a
More informationEasy, Robust and Accurate NMR Analysis of Biomolecules using BioPack
Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have
More informationSlow symmetric exchange
Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks
More informationTwo Dimensional (2D) NMR Spectroscopy
The two important parameters obtained from NMR spectra are; Two Dimensional (2D) NMR Spectroscopy py Correlation NMR a. Chemical shift b. Spin-spin coupling constant Large molecules with numerous atoms
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationSupplementary Material
Supplementary Material 4D APSY-HBCB(CG)CDHD experiment for automated assignment of aromatic amino acid side chains in proteins Barbara Krähenbühl 1 Sebastian Hiller 2 Gerhard Wider 1 1 Institute of Molecular
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationBCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE
BCMB / CHEM 8190 Biomolecular NMR GRADUATE COURSE OFFERING IN NUCLEAR MAGNETIC RESONANCE "Biomolecular Nuclear Magnetic Resonance" is a course intended for all graduate students with an interest in applications
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationSpectroscopy of Polymers
Spectroscopy of Polymers Jack L. Koenig Case Western Reserve University WOMACS Professional Reference Book American Chemical Society, Washington, DC 1992 Contents Preface m xiii Theory of Polymer Characterization
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationAssignment of Heme Resonances and. High- and Low-Spin Nitrophorin 2 by 1 H and. Order of Heme Methyl Resonances in High- Spin Ferriheme Proteins
Supplementary Material for: Assignment of Heme Resonances and Determination of the Electronic Structures of High- and Low-Spin Nitrophorin 2 by 1 H and 13 C NMR Spectroscopy: An Explanation of the Order
More informationCode Course name CFU Year G6403B Info not available 3 1
Basic aims The aim of the course is an in-depth discussion of the structureactivity relationships of the main classes of biological molecules. Strategies for synthesis, isolation and structural characterization
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Lecturer: Gabriele Varani Biochemistry and Chemistry Room J479 and
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationONE AND TWO DIMENSIONAL NMR SPECTROSCOPY
ONE AND TWO DIMENSIONAL NMR SPECTROSCOPY Atta-ur-Rahman H.E.J. Research Institute of Chemistry, University ofkarachi, Karachi 32, Pakistan ELSEVIER Amsterdam Oxford New York Tokyo 1989 IX CONTENTS Chapter-l
More informationNMR Spectroscopy. Guangjin Hou
NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationHigh-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE
High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE Foreword Preface Acknowledgements V VI I X Chapter 1. Introduction 1.1. The development of high-resolution NMR 1 1.2. Modern
More informationAmino Acid Structures from Klug & Cummings. 10/7/2003 CAP/CGS 5991: Lecture 7 1
Amino Acid Structures from Klug & Cummings 10/7/2003 CAP/CGS 5991: Lecture 7 1 Amino Acid Structures from Klug & Cummings 10/7/2003 CAP/CGS 5991: Lecture 7 2 Amino Acid Structures from Klug & Cummings
More informationFile: {ELS_REV}Cavanagh X/Revises/Prelims.3d Creator: / Date/Time: /9:29pm Page: 1/26 PREFACE
PREFACE The second edition of Protein NMR Spectroscopy: Principles and Practice reflects the continued rapid pace of development of biomolecular NMR spectroscopy since the original publication in 1996.
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationBand-Selective Homonuclear 2D Correlation Experiments
Band-Selective Homonuclear 2D Correlation Experiments Application Note Authors Péter Sándor Agilent Technologies GmbH D76337 Waldbronn Germany Abstract This application note demonstrates the utility of
More informationQuantification of Dynamics in the Solid-State
Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationSupporting information for. Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data
Supporting information for Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data Shengqi Xiang 1, Veniamin Chevelkov 1,2, Stefan Becker 1, Adam Lange 1,2,3 * 1 Max
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationProtein NMR spectroscopy
Protein NMR spectroscopy Perttu Permi National Biological NMR Center, Institute of Biotechnology, University of elsinki Protein NMR spectroscopy course, 19th January 2009 1 spectrum of 20 kda Ca-binding
More informationChem 325 NMR Intro. The Electromagnetic Spectrum. Physical properties, chemical properties, formulas Shedding real light on molecular structure:
Physical properties, chemical properties, formulas Shedding real light on molecular structure: Wavelength Frequency ν Wavelength λ Frequency ν Velocity c = 2.998 10 8 m s -1 The Electromagnetic Spectrum
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationSupplementary Materials belonging to
Supplementary Materials belonging to Solution conformation of the 70 kda E.coli Hsp70 complexed with ADP and substrate. Eric B. Bertelsen 1, Lyra Chang 2, Jason E. Gestwicki 2 and Erik R. P. Zuiderweg
More informationMagnetic Nuclei other than 1 H
Magnetic Nuclei other than 1 H 2 H (Deuterium): I = 1 H,D-Exchange might be used to simplify 1 H-NMR spectra since H-D couplings are generally small; - - - -O- - - -D 2 -O- triplet of triplets slightly
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationIntroduction to NMR! Ravinder Reddy!
Introduction to NMR! Ravinder Reddy! Brief History of NMR! First detection of NMR! MSNMR! FT NMR! 2D NMR! 2D-NMR and protein structure! Development of MRI! Outline! Concept of SPIN! Spin angular momentum!
More informationSolid state and advanced NMR
Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationIntroduction. Introduction. Introduction. Chem Experiment 4 NMR & Mass Spectroscopy and Biomolecular Structure. Fall, 2011
hem 43 - Experiment 4 MR & Mass pectroscopy and Biomolecular tructure Fall, 2 What does MR measure? Introduction What information does MR provide us about the structures of biological macromolecules -
More informationMagnetic Resonance Spectroscopy
INTRODUCTION TO Magnetic Resonance Spectroscopy ESR, NMR, NQR D. N. SATHYANARAYANA Formerly, Chairman Department of Inorganic and Physical Chemistry Indian Institute of Science, Bangalore % I.K. International
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationNMR BMB 173 Lecture 16, February
NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationLinear and nonlinear spectroscopy
Linear and nonlinear spectroscopy We ve seen that we can determine molecular frequencies and dephasing rates (for electronic, vibrational, or spin degrees of freedom) from frequency-domain or timedomain
More information8.2 The Nuclear Overhauser Effect
8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used
More informationStudying conformational dynamics and molecular recognition using integrated structural biology in solution Michael Sattler
Studying conformational dynamics and molecular recognition using integrated structural biology in solution Michael Sattler http://www.nmr.ch.tum.de http://www.helmholtz-muenchen.de/stb/ Outline Dynamics
More informationContents. xiii. Preface v
Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak
More informationNMR FACILITY NEWSLETTER
NMR Newsletter NMR FACILITY NEWSLETTER Department of Chemistry and Biochemistry Matt Revington-Facility Coordinator mrevingt@uwindsor.ca Ext 3997 500 MHz NMR upgraded The 500 MHz NMR has received a $250,000
More informationAlgorithms for analysis of NMR projections: Design, implementation and applications
Thesis for the degree of doctor of Philosophy Algorithms for analysis of NMR projections: Design, implementation and applications Jonas Fredriksson Department of Chemistry University of Gothenburg Sweden
More informationProteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability
Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med
More informationChapter 15 Lecture Outline
Organic Chemistry, First Edition Janice Gorzynski Smith University of Hawaii Chapter 5 Lecture Outline Introduction to NMR Two common types of NMR spectroscopy are used to characterize organic structure:
More informationSolid-state NMR of spin > 1/2
Solid-state NMR of spin > 1/2 Nuclear spins with I > 1/2 possess an electrical quadrupole moment. Anisotropic Interactions Dipolar Interaction 1 H- 1 H, 1 H- 13 C: typically 50 khz Anisotropy of the chemical
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More informationNMR Spectroscopy of Polymers
UNESCO/IUPAC Course 2005/2006 Jiri Brus NMR Spectroscopy of Polymers Brus J 1. part At the very beginning the phenomenon of nuclear spin resonance was studied predominantly by physicists and the application
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationFundamental MRI Principles Module 2 N. Nuclear Magnetic Resonance. X-ray. MRI Hydrogen Protons. Page 1. Electrons
Fundamental MRI Principles Module 2 N S 1 Nuclear Magnetic Resonance There are three main subatomic particles: protons positively charged neutrons no significant charge electrons negatively charged Protons
More informationNMR course at the FMP: NMR of organic compounds and small biomolecules - II -
NMR course at the FMP: NMR of organic compounds and small biomolecules - II - 16.03.2009 The program 2/76 CW vs. FT NMR What is a pulse? Vectormodel Water-flip-back 3/76 CW vs. FT CW vs. FT 4/76 Two methods
More informationSSSC Discovery Series NMR2 Multidimensional NMR Spectroscopy
SSSC Discovery Series NMR2 Multidimensional NMR Spectroscopy Topics: 1. Some Common Experiments 2. Anatomy of a 2D experiment 3. 3D NMR spectroscopy no quantum mechanics! Some Common 2D Experiments Very
More informationAutomated Assignment of Backbone NMR Data using Artificial Intelligence
Automated Assignment of Backbone NMR Data using Artificial Intelligence John Emmons στ, Steven Johnson τ, Timothy Urness*, and Adina Kilpatrick* Department of Computer Science and Mathematics Department
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationDipole Recoupling at High Spinning Frequencies. and. High Magnetic Fields
Dipole Recoupling at High Spinning Frequencies and High Magnetic Fields Stowe, Vermont January 2010 Francis Bitter Magnet Laboratory and Department of Chemistry Massachusetts Institute of Technology Outline
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More information8 NMR Interactions: Dipolar Coupling
8 NMR Interactions: Dipolar Coupling 8.1 Hamiltonian As discussed in the first lecture, a nucleus with spin I 1/2 has a magnetic moment, µ, associated with it given by µ = γ L. (8.1) If two different nuclear
More informationGoals. Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions
Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke 1,2 and Carlos Camacho 3 1 Bioengineering and Bioinformatics Summer Institute,
More informationChapter 7. Nuclear Magnetic Resonance Spectroscopy
Chapter 7 Nuclear Magnetic Resonance Spectroscopy I. Introduction 1924, W. Pauli proposed that certain atomic nuclei have spin and magnetic moment and exposure to magnetic field would lead to energy level
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More informationNMR for studying biomolecular recognition and dynamics
NMR for studying biomolecular recognition and dynamics Michael Sattler http://www.nmr.ch.tum.de http://www.helmholtz-muenchen.de/stb http://www.bnmrz.org Outline Biomolecular NMR Tools for studying protein
More informationUltra-high Resolution in Low Field Tabletop NMR Spectrometers
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Supporting Information Ultra-high Resolution in Low Field Tabletop NMR Spectrometers Experimental
More informationDouble-Resonance Experiments
Double-Resonance Eperiments The aim - to simplify complicated spectra by eliminating J-couplings. omonuclear Decoupling A double resonance eperiment is carried out using a second rf source B 2 in addition
More informationAdvanced Quadrupolar NMR. Sharon Ashbrook School of Chemistry, University of St Andrews
Advanced Quadrupolar NMR Sharon Ashbrook School of Chemistry, University of St Andrews Quadrupolar nuclei: revision single crystal powder ST 500 khz ST ω 0 MAS 1 khz 5 khz second-order broadening Example:
More informationτ 1 > 1/J - if this lifetime is significantly shortened, the coupling (splitting of the signal) will not be observed
It is often advantageous to reverse or remove the splitting caused by spin-spin coupling This is called spin decoupling Spin decoupling (or just decoupling) can be used for several reasons - to simplify
More information