SUPPLEMENTARY TABLES Table S1 Gene Primer Sequence Position (Size)
|
|
- Derek Summers
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY TABLES Table S1 Primers used for gdna and mrna analyses Gene Primer Sequence Position (Size) mga F: 5 -TGGTTATATTACAATCTGGTACCATC (208) R: 5 -GGTATGCGTCAAATAGGCATTGG emm23 F: 5'-GCTTTGACAGTTTTAGGGACAGG (331) R: 5'-GTGCTCCATCAAGCGTTGTATTC scpa F: 5 -GCAGGCAAAGGAGCTGGGACT (307) R: 5 -GCATCGCACCTTCTAGGCGGT sfb1 F: 5 -GGCGATTTGCTGTCACTTTAGTGG (454) R: 5 -GGTTCTAAACCCTCCATGATTCCA fbp54 F: 5 -CGGTCATATCCAAAAGGTCAATC (344) R: 5 -CTGCACGGTCCACCAAGATGATA speb F: 5'-CAGCAGCTATCAAAGCAGGTGCAC (284) R: 5'-CTCAGCGGTACCAGCATAAGTAG spd3 F: 5'-ACAAGTACTGTTACGGCAGCCAG (307) R: 5'-GGTAACCAACTAAATGGCCACGG hasa F: 5 -GAGCCATTTAAAGGAAATCCACATG (295) R: 5'-CGTCAGCGTCAGATCTTTCAAATGC sk F: 5 -GGAACAGTCAAGCCTGTCCAAGCT (209) R: 5 -GGTTTTGATTTTGGACTTAAGCC slo F: 5 -GCTAGTACAGAAACCACAACGAC (409) R: 5 -GATAGGTCCTATCAGTGACAGAGTC spd F: 5'-GGCTGTAACAACAGTCACACTTG (294) R: 5'-GATTGTCTAACACCGTAGCTACC plr (gaphdh) F: 5 -GACGGTACTGAAACAGTTATCTC (234) R: 5 -GATAGCTTTAGCAGCACCAGTTG a The positions of the primers are relative to the A 1 TG of the particular gene. The size of the amplicon for each gene is also listed in parentheses.
2 Gene TABLE S2 Known virulence genes encoded by phage and chromosomes in 21 sequenced GAS strains a A20 SF370 M M3 315 M3 SSI-1 M M5 Manfredo a +/- represents the presence/absence of the specified gene in each strain. M Phage sda slaa spd spd spea spec speh spei spek spel spem ssa Chromosomal cfa dlta dltc endos eno grab hasa hyla ides lbp nga plr prts saga scla scpa sfb sic sk slo smez speb spd speg spej spya
3 Gene TABLE S2 (cont'd) Known virulence genes encoded by phage and chromosomes in 21 sequenced GAS strains a HKU16 4 HSC M23ND M28 N6180 M49 NZ131 M53 Alab49 Phage sda slaa spd spd spea spec speh spei spek spel spem ssa Chromosomal cfa dlta dltc endos eno grab hasa hyla ides lbp nga plr prts saga scla scpa sfb sic sk slo smez speb spd speg spej spya a +/- represents the presence/absence of the specified gene in each strain. M M
4 Supplementary Figures FIG S1 FIG S1 Genome comparisons of fully sequenced S. pyogenes strains. (A-D) Pair-wise genome comparison of the 21 fully-sequenced GAS strains derived from the NCBI database. The four subfigures (A-D) can be concatenated. The red and blue lines represent forward and reverse alignments, respectively. The genomes of the first 17 strains are highly syntenic, except for small gaps induced by prophages and short mobile elements. The genomes of the last four strains, M23ND, M5 Manfredo, 2 HKU16, and M3 SSI-1, exhibit complex rearrangements, including inversions and translocations. An extra short inversion within the last 100 kb of the chromosome occurred specifically in the genome of S. pyogenes M23ND.
5 FIG S2 FIG S2 Phylogenetic relationships among the fully sequenced S. pyogenes genomes. The sequences of the 20 previously sequenced GAS genomes were obtained from the NCBI database and compared using using SplitsTree. (A) Phylogenetic trees were based on pair-wise distances from whole genome comparisons and constructed using BLAST tree method of Fast Minimum Evolution. (B) The phylogenetic network was based on MLST of seven commonly used housekeeping genes (gki, gtr, muri, muts, recp, xpt, yqil) using SplitDecomposition for network construction and uncorrected p-distance for distance estimation. The phylogenetic relationships represented by the network were concordant with the tree diagram from whole-genome comparison (A). It showed that M23ND shares the common ancestor, , with M5 Manfredo and M , but experienced a distinct evolutionary path. (C) Phylogenetic network based on SNP profiling of chromosomally-inherited virulence genes, excluding the divergent genes, sfb1, sic, grab, endos, ides, and ska using NeighborNet for network construction and uncorrected p-distance for distance estimation. The network was topologically similar to the primary evolutionary structure inferred from the pair-wise whole-genome comparisons (A) and the MLST of seven housekeeping genes (B). M23ND is most closely related to strains M5 Manfredo and M , and they may also share a common ancestor with , which diverged more recently.
6
Comparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationFigure A1. Phylogenetic trees based on concatenated sequences of eight MLST loci. Phylogenetic trees were constructed based on concatenated sequences
A. B. Figure A1. Phylogenetic trees based on concatenated sequences of eight MLST loci. Phylogenetic trees were constructed based on concatenated sequences of eight housekeeping loci for 12 unique STs
More informationI519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics, 2015 Genome Comparison Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Whole genome comparison/alignment Build better phylogenies Identify polymorphism
More informationComparative Genomics Background and Strategies. Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee
Comparative Genomics Background and Strategies Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee Introduction Why comparative genomes? h"p://www.ensembl.org/info/about/species.html
More informationMultiple Whole Genome Alignment
Multiple Whole Genome Alignment BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 206 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by
More informationPhylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.
Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class
More informationNature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
More informationComparative Genomics Background & Strategy. Faction 2
Comparative Genomics Background & Strategy Faction 2 Overview Introduction to comparative genomics Salmonella enterica subsp. enterica serovar Heidelberg Comparative Genomics Faction 2 Objectives Genomic
More informationCREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
More informationThe Contribution of Bioinformatics to Evolutionary Thought
The Contribution of Bioinformatics to Evolutionary Thought A demonstration of the abilities of Entrez, BLAST, and UCSC s Genome Browser to provide information about common ancestry. American Scientific
More informationSession 5: Phylogenomics
Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationMolecular Evolution & the Origin of Variation
Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants
More informationInferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT
Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions
More informationAnatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses
Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationOutline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer
Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,
More informationPhylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More informationPhylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University
Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationPhylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to
More informationHeterozygous BMN lines
Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationModule: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment
Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Introduction to Bioinformatics online course : IBT Jonathan Kayondo Learning Objectives Understand
More informationSUPPLEMENTARY INFORMATION
Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.
Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure
More informationGenomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,
1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1*
More informationPhylogenetic Tree Generation using Different Scoring Methods
International Journal of Computer Applications (975 8887) Phylogenetic Tree Generation using Different Scoring Methods Rajbir Singh Associate Prof. & Head Department of IT LLRIET, Moga Sinapreet Kaur Student
More information"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
More informationSupplementary Information
Supplementary Information A versatile genome-scale PCR-based pipeline for high-definition DNA FISH Magda Bienko,, Nicola Crosetto,, Leonid Teytelman, Sandy Klemm, Shalev Itzkovitz & Alexander van Oudenaarden,,
More informationWarm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
More informationOverview of IslandPick pipeline and the generation of GI datasets
Overview of IslandPick pipeline and the generation of GI datasets Predicting GIs using comparative genomics By using whole genome alignments we can identify regions that are present in one genome but not
More informationCourse: Visual Analytics of largescale biological data. Kay Nieselt Center for Bioinformatics Tübingen University of Tübingen
Course: Visual Analytics of largescale biological data Kay Nieselt Center for Bioinformatics Tübingen University of Tübingen THE SUPERGENOME AND GENOMERING Overview A revolution in genomics Flood of genomes:
More informationHomology and Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The
More informationA Methodological Framework for the Reconstruction of Contiguous Regions of Ancestral Genomes and Its Application to Mammalian Genomes
A Methodological Framework for the Reconstruction of Contiguous Regions of Ancestral Genomes and Its Application to Mammalian Genomes Cedric Chauve 1, Eric Tannier 2,3,4,5 * 1 Department of Mathematics,
More informationTHEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationEvolutionary Tree Analysis. Overview
CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationTools and Algorithms in Bioinformatics
Tools and Algorithms in Bioinformatics GCBA815, Fall 2015 Week-4 BLAST Algorithm Continued Multiple Sequence Alignment Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationI519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB
I519 Introduction to Bioinformatics, 2011 Genome Comparison Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Whole genome comparison/alignment Build better phylogenies Identify polymorphism
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationBINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
More informationDr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
More informationToday's project. Test input data Six alignments (from six independent markers) of Curcuma species
DNA sequences II Analyses of multiple sequence data datasets, incongruence tests, gene trees vs. species tree reconstruction, networks, detection of hybrid species DNA sequences II Test of congruence of
More informationGenome Rearrangements In Man and Mouse. Abhinav Tiwari Department of Bioengineering
Genome Rearrangements In Man and Mouse Abhinav Tiwari Department of Bioengineering Genome Rearrangement Scrambling of the order of the genome during evolution Operations on chromosomes Reversal Translocation
More informationComparing Genomes! Homologies and Families! Sequence Alignments!
Comparing Genomes! Homologies and Families! Sequence Alignments! Allows us to achieve a greater understanding of vertebrate evolution! Tells us what is common and what is unique between different species
More informationInstitute for Molecular Bioscience, The University of Queensland, Brisbane, QLD 4072,
JB Accepts, published online ahead of print on 27 May 2011 J. Bacteriol. doi:10.1128/jb.01524-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationC.DARWIN ( )
C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships
More informationQuantifying sequence similarity
Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity
More informationSupporting Information
Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E
More informationPyrobayes: an improved base caller for SNP discovery in pyrosequences
Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The
More informationA Phylogenetic Network Construction due to Constrained Recombination
A Phylogenetic Network Construction due to Constrained Recombination Mohd. Abdul Hai Zahid Research Scholar Research Supervisors: Dr. R.C. Joshi Dr. Ankush Mittal Department of Electronics and Computer
More informationPhylogenetics in the Age of Genomics: Prospects and Challenges
Phylogenetics in the Age of Genomics: Prospects and Challenges Antonis Rokas Department of Biological Sciences, Vanderbilt University http://as.vanderbilt.edu/rokaslab http://pubmed2wordle.appspot.com/
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More informationHow should we organize the diversity of animal life?
How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)
More informationSUPPLEMENTARY INFORMATION
Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)
More informationDatabase and Comparative Identification of Prophages
Database and Comparative Identification of Prophages K.V. Srividhya 1, Geeta V Rao 1, Raghavenderan L 1, Preeti Mehta 1, Jaime Prilusky 2, Sankarnarayanan Manicka 1, Joel L. Sussman 3, and S Krishnaswamy
More informationSimilarity searching summary (2)
Similarity searching / sequence alignment summary Biol4230 Thurs, February 22, 2016 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 What have we covered? Homology excess similiarity but no excess similarity
More informationA PARSIMONY APPROACH TO ANALYSIS OF HUMAN SEGMENTAL DUPLICATIONS
A PARSIMONY APPROACH TO ANALYSIS OF HUMAN SEGMENTAL DUPLICATIONS CRYSTAL L. KAHN and BENJAMIN J. RAPHAEL Box 1910, Brown University Department of Computer Science & Center for Computational Molecular Biology
More informationComparative Bioinformatics Midterm II Fall 2004
Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans
More informationNJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees
NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Erin Molloy and Tandy Warnow {emolloy2, warnow}@illinois.edu University of Illinois at Urbana
More informationSara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)
Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline
More informationBioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
More informationBioinformatics. Proteins II. - Pattern, Profile, & Structure Database Searching. Robert Latek, Ph.D. Bioinformatics, Biocomputing
Bioinformatics Proteins II. - Pattern, Profile, & Structure Database Searching Robert Latek, Ph.D. Bioinformatics, Biocomputing WIBR Bioinformatics Course, Whitehead Institute, 2002 1 Proteins I.-III.
More informationMolecular evolution 2. Please sit in row K or forward
Molecular evolution 2 Please sit in row K or forward RBFD: cat, mouse, parasite Toxoplamsa gondii cyst in a mouse brain http://phenomena.nationalgeographic.com/2013/04/26/mind-bending-parasite-permanently-quells-cat-fear-in-mice/
More informationExample of Function Prediction
Find similar genes Example of Function Prediction Suggesting functions of newly identified genes It was known that mutations of NF1 are associated with inherited disease neurofibromatosis 1; but little
More informationBMI/CS 776 Lecture #20 Alignment of whole genomes. Colin Dewey (with slides adapted from those by Mark Craven)
BMI/CS 776 Lecture #20 Alignment of whole genomes Colin Dewey (with slides adapted from those by Mark Craven) 2007.03.29 1 Multiple whole genome alignment Input set of whole genome sequences genomes diverged
More informationSEQUENCING NUCLEAR MARKERS IN FRESHWATER GREEN ALGAE: CHARA SUBSECTION WILLDENOWIA
SEQUENCING NUCLEAR MARKERS IN FRESHWATER GREEN ALGAE: CHARA SUBSECTION WILLDENOWIA Stephen D. Gottschalk Department of Biological Sciences, Fordham University, 441 E Fordham Rd, Bronx, NY 10458, USA ABSTRACT
More informationPhylogenetic analysis. Characters
Typical steps: Phylogenetic analysis Selection of taxa. Selection of characters. Construction of data matrix: character coding. Estimating the best-fitting tree (model) from the data matrix: phylogenetic
More informationMartin Bader June 25, On Reversal and Transposition Medians
Martin Bader June 25, 2009 On Reversal and Transposition Medians Page 2 On Reversal and Transposition Medians Martin Bader June 25, 2009 Genome Rearrangements During evolution, the gene order in a chromosome
More informationHomology Modeling. Roberto Lins EPFL - summer semester 2005
Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,
More informationGeneral context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment.
CoCoGen meeting Accuracy of the anchor-based strategy for genome alignment Raluca Uricaru LIRMM, CNRS Université de Montpellier 2 3 octobre 2008 1 / 31 Summary 1 General context 2 Global alignment : anchor-based
More informationChapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics
Chapter 18 Lecture Concepts of Genetics Tenth Edition Developmental Genetics Chapter Contents 18.1 Differentiated States Develop from Coordinated Programs of Gene Expression 18.2 Evolutionary Conservation
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationHMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationPOPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics
POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the
More informationComparative Genomics II
Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods
More informationMichael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D
7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood
More informationOrthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona
Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona (tgabaldon@crg.es) http://gabaldonlab.crg.es Homology the same organ in different animals under
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
More informationHomology. and. Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology
More informationMultiple sequence alignment
Multiple sequence alignment Multiple sequence alignment: today s goals to define what a multiple sequence alignment is and how it is generated; to describe profile HMMs to introduce databases of multiple
More informationBLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010
BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationLecture 8 Multiple Alignment and Phylogeny
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 8 Multiple Alignment and Phylogeny Multiple Alignment & Phylogeny Multiple Alignment Scoring Complexity
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationEVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
More informationCopyright 2000 N. AYDIN. All rights reserved. 1
Introduction to Bioinformatics Prof. Dr. Nizamettin AYDIN naydin@yildiz.edu.tr Multiple Sequence Alignment Outline Multiple sequence alignment introduction to msa methods of msa progressive global alignment
More information3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,
More information1 Abstract. 2 Introduction. 3 Requirements. 4 Procedure
1 Abstract None 2 Introduction The archaeal core set is used in testing the completeness of the archaeal draft genomes. The core set comprises of conserved single copy genes from 25 genomes. Coverage statistic
More information