SUPPLEMENTARY TABLES Table S1 Gene Primer Sequence Position (Size)

Size: px
Start display at page:

Download "SUPPLEMENTARY TABLES Table S1 Gene Primer Sequence Position (Size)"

Transcription

1 SUPPLEMENTARY TABLES Table S1 Primers used for gdna and mrna analyses Gene Primer Sequence Position (Size) mga F: 5 -TGGTTATATTACAATCTGGTACCATC (208) R: 5 -GGTATGCGTCAAATAGGCATTGG emm23 F: 5'-GCTTTGACAGTTTTAGGGACAGG (331) R: 5'-GTGCTCCATCAAGCGTTGTATTC scpa F: 5 -GCAGGCAAAGGAGCTGGGACT (307) R: 5 -GCATCGCACCTTCTAGGCGGT sfb1 F: 5 -GGCGATTTGCTGTCACTTTAGTGG (454) R: 5 -GGTTCTAAACCCTCCATGATTCCA fbp54 F: 5 -CGGTCATATCCAAAAGGTCAATC (344) R: 5 -CTGCACGGTCCACCAAGATGATA speb F: 5'-CAGCAGCTATCAAAGCAGGTGCAC (284) R: 5'-CTCAGCGGTACCAGCATAAGTAG spd3 F: 5'-ACAAGTACTGTTACGGCAGCCAG (307) R: 5'-GGTAACCAACTAAATGGCCACGG hasa F: 5 -GAGCCATTTAAAGGAAATCCACATG (295) R: 5'-CGTCAGCGTCAGATCTTTCAAATGC sk F: 5 -GGAACAGTCAAGCCTGTCCAAGCT (209) R: 5 -GGTTTTGATTTTGGACTTAAGCC slo F: 5 -GCTAGTACAGAAACCACAACGAC (409) R: 5 -GATAGGTCCTATCAGTGACAGAGTC spd F: 5'-GGCTGTAACAACAGTCACACTTG (294) R: 5'-GATTGTCTAACACCGTAGCTACC plr (gaphdh) F: 5 -GACGGTACTGAAACAGTTATCTC (234) R: 5 -GATAGCTTTAGCAGCACCAGTTG a The positions of the primers are relative to the A 1 TG of the particular gene. The size of the amplicon for each gene is also listed in parentheses.

2 Gene TABLE S2 Known virulence genes encoded by phage and chromosomes in 21 sequenced GAS strains a A20 SF370 M M3 315 M3 SSI-1 M M5 Manfredo a +/- represents the presence/absence of the specified gene in each strain. M Phage sda slaa spd spd spea spec speh spei spek spel spem ssa Chromosomal cfa dlta dltc endos eno grab hasa hyla ides lbp nga plr prts saga scla scpa sfb sic sk slo smez speb spd speg spej spya

3 Gene TABLE S2 (cont'd) Known virulence genes encoded by phage and chromosomes in 21 sequenced GAS strains a HKU16 4 HSC M23ND M28 N6180 M49 NZ131 M53 Alab49 Phage sda slaa spd spd spea spec speh spei spek spel spem ssa Chromosomal cfa dlta dltc endos eno grab hasa hyla ides lbp nga plr prts saga scla scpa sfb sic sk slo smez speb spd speg spej spya a +/- represents the presence/absence of the specified gene in each strain. M M

4 Supplementary Figures FIG S1 FIG S1 Genome comparisons of fully sequenced S. pyogenes strains. (A-D) Pair-wise genome comparison of the 21 fully-sequenced GAS strains derived from the NCBI database. The four subfigures (A-D) can be concatenated. The red and blue lines represent forward and reverse alignments, respectively. The genomes of the first 17 strains are highly syntenic, except for small gaps induced by prophages and short mobile elements. The genomes of the last four strains, M23ND, M5 Manfredo, 2 HKU16, and M3 SSI-1, exhibit complex rearrangements, including inversions and translocations. An extra short inversion within the last 100 kb of the chromosome occurred specifically in the genome of S. pyogenes M23ND.

5 FIG S2 FIG S2 Phylogenetic relationships among the fully sequenced S. pyogenes genomes. The sequences of the 20 previously sequenced GAS genomes were obtained from the NCBI database and compared using using SplitsTree. (A) Phylogenetic trees were based on pair-wise distances from whole genome comparisons and constructed using BLAST tree method of Fast Minimum Evolution. (B) The phylogenetic network was based on MLST of seven commonly used housekeeping genes (gki, gtr, muri, muts, recp, xpt, yqil) using SplitDecomposition for network construction and uncorrected p-distance for distance estimation. The phylogenetic relationships represented by the network were concordant with the tree diagram from whole-genome comparison (A). It showed that M23ND shares the common ancestor, , with M5 Manfredo and M , but experienced a distinct evolutionary path. (C) Phylogenetic network based on SNP profiling of chromosomally-inherited virulence genes, excluding the divergent genes, sfb1, sic, grab, endos, ides, and ska using NeighborNet for network construction and uncorrected p-distance for distance estimation. The network was topologically similar to the primary evolutionary structure inferred from the pair-wise whole-genome comparisons (A) and the MLST of seven housekeeping genes (B). M23ND is most closely related to strains M5 Manfredo and M , and they may also share a common ancestor with , which diverged more recently.

6

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

Figure A1. Phylogenetic trees based on concatenated sequences of eight MLST loci. Phylogenetic trees were constructed based on concatenated sequences

Figure A1. Phylogenetic trees based on concatenated sequences of eight MLST loci. Phylogenetic trees were constructed based on concatenated sequences A. B. Figure A1. Phylogenetic trees based on concatenated sequences of eight MLST loci. Phylogenetic trees were constructed based on concatenated sequences of eight housekeeping loci for 12 unique STs

More information

I519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB

I519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB I519 Introduction to Bioinformatics, 2015 Genome Comparison Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Whole genome comparison/alignment Build better phylogenies Identify polymorphism

More information

Comparative Genomics Background and Strategies. Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee

Comparative Genomics Background and Strategies. Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee Comparative Genomics Background and Strategies Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee Introduction Why comparative genomes? h"p://www.ensembl.org/info/about/species.html

More information

Multiple Whole Genome Alignment

Multiple Whole Genome Alignment Multiple Whole Genome Alignment BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 206 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by

More information

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species. Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four

More information

Comparative Genomics Background & Strategy. Faction 2

Comparative Genomics Background & Strategy. Faction 2 Comparative Genomics Background & Strategy Faction 2 Overview Introduction to comparative genomics Salmonella enterica subsp. enterica serovar Heidelberg Comparative Genomics Faction 2 Objectives Genomic

More information

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:

More information

The Contribution of Bioinformatics to Evolutionary Thought

The Contribution of Bioinformatics to Evolutionary Thought The Contribution of Bioinformatics to Evolutionary Thought A demonstration of the abilities of Entrez, BLAST, and UCSC s Genome Browser to provide information about common ancestry. American Scientific

More information

Session 5: Phylogenomics

Session 5: Phylogenomics Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions

More information

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group

More information

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral

More information

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,

More information

Phylogenetics: Building Phylogenetic Trees

Phylogenetics: Building Phylogenetic Trees 1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should

More information

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot

More information

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University

Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi) Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to

More information

Heterozygous BMN lines

Heterozygous BMN lines Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30

More information

Genomics and bioinformatics summary. Finding genes -- computer searches

Genomics and bioinformatics summary. Finding genes -- computer searches Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence

More information

Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment

Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Introduction to Bioinformatics online course : IBT Jonathan Kayondo Learning Objectives Understand

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure

More information

Genomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,

Genomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography, 1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1*

More information

Phylogenetic Tree Generation using Different Scoring Methods

Phylogenetic Tree Generation using Different Scoring Methods International Journal of Computer Applications (975 8887) Phylogenetic Tree Generation using Different Scoring Methods Rajbir Singh Associate Prof. & Head Department of IT LLRIET, Moga Sinapreet Kaur Student

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

Supplementary Information

Supplementary Information Supplementary Information A versatile genome-scale PCR-based pipeline for high-definition DNA FISH Magda Bienko,, Nicola Crosetto,, Leonid Teytelman, Sandy Klemm, Shalev Itzkovitz & Alexander van Oudenaarden,,

More information

Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab

Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How

More information

Overview of IslandPick pipeline and the generation of GI datasets

Overview of IslandPick pipeline and the generation of GI datasets Overview of IslandPick pipeline and the generation of GI datasets Predicting GIs using comparative genomics By using whole genome alignments we can identify regions that are present in one genome but not

More information

Course: Visual Analytics of largescale biological data. Kay Nieselt Center for Bioinformatics Tübingen University of Tübingen

Course: Visual Analytics of largescale biological data. Kay Nieselt Center for Bioinformatics Tübingen University of Tübingen Course: Visual Analytics of largescale biological data Kay Nieselt Center for Bioinformatics Tübingen University of Tübingen THE SUPERGENOME AND GENOMERING Overview A revolution in genomics Flood of genomes:

More information

Homology and Information Gathering and Domain Annotation for Proteins

Homology and Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The

More information

A Methodological Framework for the Reconstruction of Contiguous Regions of Ancestral Genomes and Its Application to Mammalian Genomes

A Methodological Framework for the Reconstruction of Contiguous Regions of Ancestral Genomes and Its Application to Mammalian Genomes A Methodological Framework for the Reconstruction of Contiguous Regions of Ancestral Genomes and Its Application to Mammalian Genomes Cedric Chauve 1, Eric Tannier 2,3,4,5 * 1 Department of Mathematics,

More information

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

Evolutionary Tree Analysis. Overview

Evolutionary Tree Analysis. Overview CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based

More information

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded

More information

Tools and Algorithms in Bioinformatics

Tools and Algorithms in Bioinformatics Tools and Algorithms in Bioinformatics GCBA815, Fall 2015 Week-4 BLAST Algorithm Continued Multiple Sequence Alignment Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and

More information

Processes of Evolution

Processes of Evolution 15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection

More information

I519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB

I519 Introduction to Bioinformatics, Genome Comparison. Yuzhen Ye School of Informatics & Computing, IUB I519 Introduction to Bioinformatics, 2011 Genome Comparison Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Whole genome comparison/alignment Build better phylogenies Identify polymorphism

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

BINF6201/8201. Molecular phylogenetic methods

BINF6201/8201. Molecular phylogenetic methods BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Today's project. Test input data Six alignments (from six independent markers) of Curcuma species

Today's project. Test input data Six alignments (from six independent markers) of Curcuma species DNA sequences II Analyses of multiple sequence data datasets, incongruence tests, gene trees vs. species tree reconstruction, networks, detection of hybrid species DNA sequences II Test of congruence of

More information

Genome Rearrangements In Man and Mouse. Abhinav Tiwari Department of Bioengineering

Genome Rearrangements In Man and Mouse. Abhinav Tiwari Department of Bioengineering Genome Rearrangements In Man and Mouse Abhinav Tiwari Department of Bioengineering Genome Rearrangement Scrambling of the order of the genome during evolution Operations on chromosomes Reversal Translocation

More information

Comparing Genomes! Homologies and Families! Sequence Alignments!

Comparing Genomes! Homologies and Families! Sequence Alignments! Comparing Genomes! Homologies and Families! Sequence Alignments! Allows us to achieve a greater understanding of vertebrate evolution! Tells us what is common and what is unique between different species

More information

Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD 4072,

Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD 4072, JB Accepts, published online ahead of print on 27 May 2011 J. Bacteriol. doi:10.1128/jb.01524-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

Quantifying sequence similarity

Quantifying sequence similarity Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity

More information

Supporting Information

Supporting Information Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E

More information

Pyrobayes: an improved base caller for SNP discovery in pyrosequences

Pyrobayes: an improved base caller for SNP discovery in pyrosequences Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The

More information

A Phylogenetic Network Construction due to Constrained Recombination

A Phylogenetic Network Construction due to Constrained Recombination A Phylogenetic Network Construction due to Constrained Recombination Mohd. Abdul Hai Zahid Research Scholar Research Supervisors: Dr. R.C. Joshi Dr. Ankush Mittal Department of Electronics and Computer

More information

Phylogenetics in the Age of Genomics: Prospects and Challenges

Phylogenetics in the Age of Genomics: Prospects and Challenges Phylogenetics in the Age of Genomics: Prospects and Challenges Antonis Rokas Department of Biological Sciences, Vanderbilt University http://as.vanderbilt.edu/rokaslab http://pubmed2wordle.appspot.com/

More information

BLAST. Varieties of BLAST

BLAST. Varieties of BLAST BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database

More information

How should we organize the diversity of animal life?

How should we organize the diversity of animal life? How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)

More information

Database and Comparative Identification of Prophages

Database and Comparative Identification of Prophages Database and Comparative Identification of Prophages K.V. Srividhya 1, Geeta V Rao 1, Raghavenderan L 1, Preeti Mehta 1, Jaime Prilusky 2, Sankarnarayanan Manicka 1, Joel L. Sussman 3, and S Krishnaswamy

More information

Similarity searching summary (2)

Similarity searching summary (2) Similarity searching / sequence alignment summary Biol4230 Thurs, February 22, 2016 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 What have we covered? Homology excess similiarity but no excess similarity

More information

A PARSIMONY APPROACH TO ANALYSIS OF HUMAN SEGMENTAL DUPLICATIONS

A PARSIMONY APPROACH TO ANALYSIS OF HUMAN SEGMENTAL DUPLICATIONS A PARSIMONY APPROACH TO ANALYSIS OF HUMAN SEGMENTAL DUPLICATIONS CRYSTAL L. KAHN and BENJAMIN J. RAPHAEL Box 1910, Brown University Department of Computer Science & Center for Computational Molecular Biology

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees

NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Erin Molloy and Tandy Warnow {emolloy2, warnow}@illinois.edu University of Illinois at Urbana

More information

Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)

Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline

More information

Bioinformatics tools for phylogeny and visualization. Yanbin Yin

Bioinformatics tools for phylogeny and visualization. Yanbin Yin Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation

More information

Bioinformatics. Proteins II. - Pattern, Profile, & Structure Database Searching. Robert Latek, Ph.D. Bioinformatics, Biocomputing

Bioinformatics. Proteins II. - Pattern, Profile, & Structure Database Searching. Robert Latek, Ph.D. Bioinformatics, Biocomputing Bioinformatics Proteins II. - Pattern, Profile, & Structure Database Searching Robert Latek, Ph.D. Bioinformatics, Biocomputing WIBR Bioinformatics Course, Whitehead Institute, 2002 1 Proteins I.-III.

More information

Molecular evolution 2. Please sit in row K or forward

Molecular evolution 2. Please sit in row K or forward Molecular evolution 2 Please sit in row K or forward RBFD: cat, mouse, parasite Toxoplamsa gondii cyst in a mouse brain http://phenomena.nationalgeographic.com/2013/04/26/mind-bending-parasite-permanently-quells-cat-fear-in-mice/

More information

Example of Function Prediction

Example of Function Prediction Find similar genes Example of Function Prediction Suggesting functions of newly identified genes It was known that mutations of NF1 are associated with inherited disease neurofibromatosis 1; but little

More information

BMI/CS 776 Lecture #20 Alignment of whole genomes. Colin Dewey (with slides adapted from those by Mark Craven)

BMI/CS 776 Lecture #20 Alignment of whole genomes. Colin Dewey (with slides adapted from those by Mark Craven) BMI/CS 776 Lecture #20 Alignment of whole genomes Colin Dewey (with slides adapted from those by Mark Craven) 2007.03.29 1 Multiple whole genome alignment Input set of whole genome sequences genomes diverged

More information

SEQUENCING NUCLEAR MARKERS IN FRESHWATER GREEN ALGAE: CHARA SUBSECTION WILLDENOWIA

SEQUENCING NUCLEAR MARKERS IN FRESHWATER GREEN ALGAE: CHARA SUBSECTION WILLDENOWIA SEQUENCING NUCLEAR MARKERS IN FRESHWATER GREEN ALGAE: CHARA SUBSECTION WILLDENOWIA Stephen D. Gottschalk Department of Biological Sciences, Fordham University, 441 E Fordham Rd, Bronx, NY 10458, USA ABSTRACT

More information

Phylogenetic analysis. Characters

Phylogenetic analysis. Characters Typical steps: Phylogenetic analysis Selection of taxa. Selection of characters. Construction of data matrix: character coding. Estimating the best-fitting tree (model) from the data matrix: phylogenetic

More information

Martin Bader June 25, On Reversal and Transposition Medians

Martin Bader June 25, On Reversal and Transposition Medians Martin Bader June 25, 2009 On Reversal and Transposition Medians Page 2 On Reversal and Transposition Medians Martin Bader June 25, 2009 Genome Rearrangements During evolution, the gene order in a chromosome

More information

Homology Modeling. Roberto Lins EPFL - summer semester 2005

Homology Modeling. Roberto Lins EPFL - summer semester 2005 Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,

More information

General context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment.

General context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment. CoCoGen meeting Accuracy of the anchor-based strategy for genome alignment Raluca Uricaru LIRMM, CNRS Université de Montpellier 2 3 octobre 2008 1 / 31 Summary 1 General context 2 Global alignment : anchor-based

More information

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics Chapter 18 Lecture Concepts of Genetics Tenth Edition Developmental Genetics Chapter Contents 18.1 Differentiated States Develop from Coordinated Programs of Gene Expression 18.2 Evolutionary Conservation

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

Comparative Genomics II

Comparative Genomics II Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods

More information

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D

Michael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D 7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood

More information

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona (tgabaldon@crg.es) http://gabaldonlab.crg.es Homology the same organ in different animals under

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

Homology. and. Information Gathering and Domain Annotation for Proteins

Homology. and. Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology

More information

Multiple sequence alignment

Multiple sequence alignment Multiple sequence alignment Multiple sequence alignment: today s goals to define what a multiple sequence alignment is and how it is generated; to describe profile HMMs to introduce databases of multiple

More information

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010 BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

Lecture 8 Multiple Alignment and Phylogeny

Lecture 8 Multiple Alignment and Phylogeny Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 8 Multiple Alignment and Phylogeny Multiple Alignment & Phylogeny Multiple Alignment Scoring Complexity

More information

Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics

Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

Copyright 2000 N. AYDIN. All rights reserved. 1

Copyright 2000 N. AYDIN. All rights reserved. 1 Introduction to Bioinformatics Prof. Dr. Nizamettin AYDIN naydin@yildiz.edu.tr Multiple Sequence Alignment Outline Multiple sequence alignment introduction to msa methods of msa progressive global alignment

More information

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,

More information

1 Abstract. 2 Introduction. 3 Requirements. 4 Procedure

1 Abstract. 2 Introduction. 3 Requirements. 4 Procedure 1 Abstract None 2 Introduction The archaeal core set is used in testing the completeness of the archaeal draft genomes. The core set comprises of conserved single copy genes from 25 genomes. Coverage statistic

More information