SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 VOLUME: 1 ARTICLE NUMBER: 0010 In the format provided by the authors and unedited. Multicopy plasmids potentiate the evolution of antibiotic resistance in bacteria Alvaro San Millan 1,2,*, Jose Antonio Escudero 3,4Ψ, Danna R Gifford 1,Ψ, Didier Mazel 3,4, R Craig MacLean 1. 1 Department of Zoology, University of Oxford. OX1 3PS, Oxford, United Kingdom. 2 Department of Microbiology, Hospital Universitario Ramon y Cajal (IRYCIS) , Madrid, Spain. 3 Institut Pasteur, Unité de Plasticité du Génome Bactérien, Département Génomes et Génétique, 28 Rue du Dr. Roux, 75015, Paris, France. 4 CNRS, UMR3525, 28 Rue du Dr. Roux, 75015, Paris, France. Ψ These authors contributed equally to this study. * Correspondence: alvaro.sanmillan@hrc.es NATURE ECOLOGY & EVOLUTION DOI: /s

2 Supplementary Figure 1. Ampicillin resistance level of the strains analysed in this study log2 fold-change MIC (relative to MG) 14 (65.5 g/l) AMP 12 (16.4 g/l) 10 (4.1 g/l) 8 (1.02 g/l) 6 (256 mg/l) 4 (64 mg/l) 2 (16 mg/l) 0 (4 mg/l) Strains MG (wild-type) MG::bla TEM-1 MG/pBGT MG::bla TEM-1 R164S MG/pBGT R164S MG/pBGT G54U MG/pBGT G55U MG/pBGT R164S G54U MG/pBGT R164S G55U Strains Level of ampicillin (AMP) resistance of each strain analysed in this study represented as the log 2 of the fold-increase in MIC compared to the parental MG1655. The MIC of ampicillin in the wild-type MG1655 strain is 4 mg/l. NATURE ECOLOGY & EVOLUTION DOI: /s

3 Supplementary Figure 2. Amplification of a beneficial mutation carried on a multicopy plasmid. Fitness + wild type plasmid mutant plasmid Time _ Slow growth Rapid growth Schematic representation of the amplification of a beneficial mutation carried on a small multi-copy plasmid over time. The fitness of the different plasmid-carrying bacteria is colour-coded using the scale represented in the figure. The increase in frequency of the plasmid carrying the beneficial mutation is driven by the random partition of the plasmid copies between the daughter cells and the fitness advantage associated to the beneficial gene dosage. The number of copies of the mutant plasmid carrying the beneficial mutation correlates with fitness. NATURE ECOLOGY & EVOLUTION DOI: /s

4 Supplementary table 1. Strains used in this study SUPPLEMENTARY INFORMATION Strain name 1 Strain number Relevant genotype Reference F030 E. coli MG1655 pkobeg. Parental strain. 1 MG E020 F030 curated This work MG::bla TEM-1 D987 F030 attb::bla TEM-1 This work E580 E020/p3655 This work MG/pBGT E581 E020/pE582 This work MG/pBGT R164S E581-2 E020/pE582-2 This work MG::bla TEM-1 R146 F025 F030 attb::bla TEM-1(R164S) This work MG/pBGT G54U F074 E020/pF074 This work MG/pBGT G55U F076 E020/pF076 This work MG/pBGT R164S E581-3 E020/pE582-3 This work G54U MG/pBGT R164S G55U E581-4 E020/pE582-4 This work 1 Names used for the strains in the paper. NATURE ECOLOGY & EVOLUTION DOI: /s

5 Supplementary table 2. Plasmids used in this study SUPPLEMENTARY INFORMATION Plasmid name 1 Plasmid number Relevant properties p3655 psu18t-pbadgfp2 2 pbgt pe582 p3655::bla TEM-1 pbgt R164 pe582-2 pe582 with R164S mutation in TEM1 pbgt G54U pf074 pe582 with G54U mutation in RNAI pbgt G55U pf076 pe582 with G55U mutation in RNAI pbgt R164 G54U pe582-3 pe582 with R164S mutation in TEM1 and G54U mutation in RNAI pbgt R164 G55U pe582-4 pe582 with R164S mutation in TEM1 and G55U mutation in RNAI 1 Names used for the plasmids in the paper. NATURE ECOLOGY & EVOLUTION DOI: /s

6 Supplementary table 3. Primers used in this study SUPPLEMENTARY INFORMATION Number Name Sequence Purpose 3652 ybhc-f CCTGTACCGTACAGAGTAAT GCCCGCCACCCTCCGGGCCGGTATAAAAA 3653 attb-r Amplification of AGCAGGCTTCA homology regions AGCGCCCTAGCGCCCGCTCCTTATACTAA 3654 attb-f CTTGAGCGAAA around attb 3655 ybhb-r TGGCGATAATATTTCACCGC 3656 ybhc External F TTTGTGACCAGAAGACCGCA 3657 ybhb External R CTCATCAGTAACGATCTGCG Insertion verification TGAAGCCTGCTTTTTTATACCGGCCCGGA 3658 Tem1 pbad F GGGTGGCGGGC TTTCGCTCAAGTTAGTATAAGGAGCGGGC 3659 Tem1 pbad R GCTAGGGCGCT GTTAGATATTTATCCTCGAGCGGCCCGGA 4304 Tem to pze1r F GGGTGGCGGGC Amplification of bla TEM-1. ACAGGAGTCCAAGCGAGCTCGGAGCGGG 4305 Tem to pze1r R CGCTAGGGCGCT 3086 MV474 CGTTGATCGGCACGTAAGAG Amplification of 738 MV83 AAACGACGGCCAGTGCCAAG p3655 backbone 296 3Orip15A CGTAATCATGGTCATAGCTGTTTCC Amplification of 837 CO57 GTACTGCGATGAGTG orip15a. 737 MV82 CAGCTATGACCATGATTACG Amplification of 1701 Lam_attR_casFw AATTACGCCCCGCCCTGCCACTC p3655 backbone without orip15a pbgt-f ACATTTCCGTGTCGCCCTT Plasmid target for pbgt-r CACTCGTGCACCCAACTGA qpcr dxs-f CGAGAAACTGGCGATCCTTA Chromosomal target dxs-r CTTCATCAAGCGGTTTCACA for qpcr NATURE ECOLOGY & EVOLUTION DOI: /s

7 Supplementary references 1. Chaveroche MK, Ghigo JM, d'enfert C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res 28, E97 (2000). 2. Le Roux F, Binesse J, Saulnier D, Mazel D. Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vector. Appl Environ Microbiol 73, (2007). NATURE ECOLOGY & EVOLUTION DOI: /s

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

Supplementary Material. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with

Supplementary Material. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with Supplementary Material Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata Emine Kaplanoglu

More information

Supplementary Figure 1 Biochemistry of gene duplication

Supplementary Figure 1 Biochemistry of gene duplication Supplementary Figure 1 Biochemistry of gene duplication (a) (b) (c) (d) A B C A (e) Selection (f) reca KO Supplementary Figure 1: Tandem gene duplication: construction, amplification, and stabilization.

More information

The two daughter cells are genetically identical to each other and the parent cell.

The two daughter cells are genetically identical to each other and the parent cell. Prokaryote Growth and Reproduction This micrograph shows a bacillus bacteria (probably E. coli) undergoing binary fission. This is a form of asexual reproduction. During prokaryotic binary fission, as

More information

Investigation 7: Cell Division Part B: Meiosis and Crossing Over

Investigation 7: Cell Division Part B: Meiosis and Crossing Over Background Investigation 7: Cell Division Part B: Meiosis and Crossing Over Ascomycota are a diverse group of fungi including the familiar single-celled baker s yeast, the complex morel mushroom, and the

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,

More information

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information

When one gene is wild type and the other mutant:

When one gene is wild type and the other mutant: Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:

More information

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large

More information

9 Genetic diversity and adaptation Support. AQA Biology. Genetic diversity and adaptation. Specification reference. Learning objectives.

9 Genetic diversity and adaptation Support. AQA Biology. Genetic diversity and adaptation. Specification reference. Learning objectives. Genetic diversity and adaptation Specification reference 3.4.3 3.4.4 Learning objectives After completing this worksheet you should be able to: understand how meiosis produces haploid gametes know how

More information

1 Errors in mitosis and meiosis can result in chromosomal abnormalities.

1 Errors in mitosis and meiosis can result in chromosomal abnormalities. Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.

The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype. Series 1: Cross Diagrams There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome: When both

More information

Chapter 5. Evolution of Biodiversity

Chapter 5. Evolution of Biodiversity Chapter 5. Evolution of Biodiversity I. Earth s tremendous diversity A. life comes in many forms B. Recall 1. we can think of biodiversity in three ways a) genetic diversity b) species diversity c) ecosystem

More information

Supporting Information

Supporting Information 1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG

More information

Genetically Engineering Yeast to Understand Molecular Modes of Speciation

Genetically Engineering Yeast to Understand Molecular Modes of Speciation Genetically Engineering Yeast to Understand Molecular Modes of Speciation Mark Umbarger Biophysics 242 May 6, 2004 Abstract: An understanding of the molecular mechanisms of speciation (reproductive isolation)

More information

Science Unit Learning Summary

Science Unit Learning Summary Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information

Revisiting the biodiversity ecosystem multifunctionality relationship

Revisiting the biodiversity ecosystem multifunctionality relationship In the format provided by the authors and unedited. Revisiting the biodiversity ecosystem multifunctionality relationship Lars Gamfeldt * and Fabian Roger * SUPPLEMENTARY INFORMATION VOLUME: ARTICLE NUMBER:

More information

pglo/amp R Bacterial Transformation Lab

pglo/amp R Bacterial Transformation Lab pglo/amp R Bacterial Transformation Lab Name: Date: Purpose: To gain an understanding of the techniques of culturing E. coli bacteria and transforming E. coli bacteria using genetic engineering. Introduction:

More information

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI

More information

Around the dynamics of bacterial genomes

Around the dynamics of bacterial genomes Around the dynamics of bacterial genomes Eduardo P. C. Rocha erocha@pasteur.fr Unité Génétique des Génomes Bactériens, CNRS URA2171,Institut Pasteur Atelier de BioInformatique, Université Pierre et Marie

More information

#2 How do organisms grow?

#2 How do organisms grow? #2 How do organisms grow? Why doesn t a cell keep growing larger and larger? The larger a cell becomes the more demands the cell places on its DNA. The cell also has trouble moving enough nutrients and

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic

More information

Alleles held at equilibrium by balancing selection

Alleles held at equilibrium by balancing selection Alleles held at equilibrium by balancing selection Alleles held at equilibrium by balancing selection Neutral mutation Alleles held at equilibrium by balancing selection Lost by drift Neutral mutation

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Role of Leucine Zipper Motifs in Association of the Escherichia coli Cell Division Proteins FtsL and FtsB

Role of Leucine Zipper Motifs in Association of the Escherichia coli Cell Division Proteins FtsL and FtsB JOURNAL OF BACTERIOLOGY, Sept. 2011, p. 4988 4992 Vol. 193, No. 18 0021-9193/11/$12.00 doi:10.1128/jb.00324-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Role of Leucine Zipper

More information

Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions

Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions Part 2- Biology Paper 2 Inheritance and Variation Knowledge Questions AQA TRILOGY Biology (8464) from 2016 Topic T4.6 Inheritance, variation and evolution Topic Student Checklist R A G Describe features

More information

Kingdom Bacteria Kingdom Archaea

Kingdom Bacteria Kingdom Archaea Section 5.1 Kingdom Bacteria Kingdom Archaea p. 132-139 Kingdom Bacteria General Characteristics: Cell Type: all are prokaryotic. Body Form: most are unicellular, some are colonial. Three main shapes are:

More information

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt +

m1 m2 m3 m4 m5 m6 m7 m8 wt m m m m m m m m8 - + wt + otherwise, you couldn't grow them!) You perform pairwise infections with each of your mutant bacteriophage strains and get the following results: (+) = pair of phages lysed host cells, (-) = pair of phages

More information

Unit 1: DNA & the Genome. 1.7: Evolution. 1.7 Evolution

Unit 1: DNA & the Genome. 1.7: Evolution. 1.7 Evolution Unit 1: DNA & the Genome 1.7: Evolution 1.7 Evolution What you should already know from National 5 Mutations are random changes to genetic material and are the only source of new alleles. Mutation can

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar

More information

Model plants and their Role in genetic manipulation. Mitesh Shrestha

Model plants and their Role in genetic manipulation. Mitesh Shrestha Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular

More information

LIFE SCIENCES GRADE 12 SESSION 20 ( LEARNER NOTES)

LIFE SCIENCES GRADE 12 SESSION 20 ( LEARNER NOTES) TOPIC: CONSOLIDATION EXAMINATION PAPER 1 Learner Note: Please stick to the time limits. Read the questions carefully and underline the operative words. Make sure that you understand what is being asked.

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

A transcription activator-like effector induction system mediated by proteolysis

A transcription activator-like effector induction system mediated by proteolysis SUPPLEMENTARY INFORMATION A transcription activator-like effector induction system mediated by proteolysis Matthew F. Copeland 1,2, Mark C. Politz 1, Charles B. Johnson 1,3, Andrew L. Markley 1, Brian

More information

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms

Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral

More information

Name: SAMPLE EOC PROBLEMS

Name: SAMPLE EOC PROBLEMS Name: SAMPLE EOC PROBLEMS 1.Bromothymol blue (BTB) is a ph indicator that is also used to detect carbon dioxide (CO2). BTB is blue when ph is basic and CO2 is low. BTB is yellow when ph is acidic and CO2

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Discordance between replicate qpcr reactions. Jan M Ruijter Department of Medical Biology Academic Medical Center Amsterdam, the Netherlands

Discordance between replicate qpcr reactions. Jan M Ruijter Department of Medical Biology Academic Medical Center Amsterdam, the Netherlands Discordance between replicate qpcr reactions Jan M Ruijter Department of Academic Medical Center Amsterdam, the Netherlands qpcr data etc. 0 2 2 4 3 8 cycles N 2 0 2 2 2 2 3 PCR product after n cycles

More information

P. syringae and E. coli

P. syringae and E. coli CHAPTER 6 A comparison of the recd mutant phenotypes of P. syringae and E. coli 6.1 INTRODUCTION The RecBCD complex is essential for recombination mediated repair of double strand breaks (DSBs) of DNA

More information

Involvement of efflux pumps in the resistance to peptidoglycan synthesis

Involvement of efflux pumps in the resistance to peptidoglycan synthesis AAC Accepts, published online ahead of print on January 0 Antimicrob. Agents Chemother. doi:0./aac.0- Copyright 0, American Society for Microbiology. All Rights Reserved. Involvement of efflux pumps in

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)

More information

Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype

Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Kunihiko Kaneko (Univ of Tokyo, Komaba) with Tetsuya Yomo (Osaka Univ.) experiment Akiko

More information

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination. Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial

More information

Diversity of antibiotic-resistance genes in Canadian isolates of Aeromonas salmonicida

Diversity of antibiotic-resistance genes in Canadian isolates of Aeromonas salmonicida Diversity of antibiotic-resistance genes in Canadian isolates of Aeromonas icida subsp. icida: dominance of psn54b and discovery of pasa8 Mélanie V. Trudel 1,,3*, Antony T. Vincent 1,,3*, Sabrina A. Attéré

More information

Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments

Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments Horizontal gene transfer from trees to ectomycorrhizal fungi: Lessons from laboratory and host plant liberation experiments Dr. Uwe Nehls 1,2, Dr. Chi Zhang 1, Dr. Mika Tarkka 1, Andrea Bock 1 1: University

More information

Objectives. Announcements. Comparison of mitosis and meiosis

Objectives. Announcements. Comparison of mitosis and meiosis Announcements Colloquium sessions for which you can get credit posted on web site: Feb 20, 27 Mar 6, 13, 20 Apr 17, 24 May 15. Review study CD that came with text for lab this week (especially mitosis

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

Genetic Basis of Variation in Bacteria

Genetic Basis of Variation in Bacteria Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material

More information

2 Salmonella Typhimurium

2 Salmonella Typhimurium 96 2006 Salmonella Typhimurium 2 1) 1) 2) 1) 2) 18 1 10 18 4 27 2 Salmonella Typhimurium 1 7 2 7 (ciprofloxacin (CPFX) MIC 16 mg/ml) S. Typhimurium 2 fosfomycin (FOM) 1 PCR gyra parc RAPD-PCR DNA S. Typhimurium

More information

Evolving Antibiotic Resistance in Bacteria by Controlling Mutation Rate

Evolving Antibiotic Resistance in Bacteria by Controlling Mutation Rate Evolving Antibiotic Resistance in Bacteria by Controlling Mutation Rate Roman V. Belavkin 1 1 School of Science and Technology Middlesex University, London NW4 4BT, UK December 11, 2015, Tokyo University

More information

Why Does DNA Use T Instead of U?

Why Does DNA Use T Instead of U? Why Does D Use Instead of U? deoxycytidine C ~100 per day per cell deoxyuridine U roblem: deaminated C is identical to U (and pairs with ) deamination D repair machinery removes all Us from D C U D repair

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Evolution AP Biology

Evolution AP Biology Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:

More information

The Role of the Horizontal Gene Pool and Lateral Gene Transfer in Enhancing Microbial Activities in Marine Sediments

The Role of the Horizontal Gene Pool and Lateral Gene Transfer in Enhancing Microbial Activities in Marine Sediments The Role of the Horizontal Gene Pool and Lateral Gene Transfer in Enhancing Microbial Activities in Marine Sediments Patricia A. Sobecky School of Biology Georgia Institute of Technology 310 Ferst Drive

More information

Add Up and Cross Over

Add Up and Cross Over Add Up and Cross Over Sordaria Genetics Simulation Introduction SCIENTIFIC BIO FAX! Crossing over occurs during meiosis I. During crossing over, homologous pairs of chromosomes exchange sections of DNA

More information

Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes

Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

www.lessonplansinc.com Topic: Dinosaur Evolution Project Summary: Students pretend to evolve two dinosaurs using genetics and watch how the dinosaurs adapt to an environmental change. This is a very comprehensive

More information

This is DUE: Come prepared to share your findings with your group.

This is DUE: Come prepared to share your findings with your group. Biology 160 NAME: Reading Guide 11: Population Dynamics, Humans, Part I This is DUE: Come prepared to share your findings with your group. *As before, please turn in only the Critical Thinking questions

More information

Chromosome Chr Duplica Duplic t a ion Pixley

Chromosome Chr Duplica Duplic t a ion Pixley Chromosome Duplication Pixley Figure 4-6 Molecular Biology of the Cell ( Garland Science 2008) Figure 4-72 Molecular Biology of the Cell ( Garland Science 2008) Interphase During mitosis (cell division),

More information

that does not happen during mitosis?

that does not happen during mitosis? Review! What is a somatic cell?! What is a sex cell?! What is a haploid cell?! What is a diploid cell?! Why is cell division important?! What are the different types of cell division?! What are these useful

More information

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome J. Gen. Appl. Microbiol., 44, 107 111 (1998) Short Communication Integration and amplification of the Bacillus sp. 79-23 cellulase gene in the Bacillus subtilis 168 chromosome Kyung Hwa Jung, Dae-Hee Lee,

More information

Protocol S1. Replicate Evolution Experiment

Protocol S1. Replicate Evolution Experiment Protocol S Replicate Evolution Experiment 30 lines were initiated from the same ancestral stock (BMN, BMN, BM4N) and were evolved for 58 asexual generations using the same batch culture evolution methodology

More information

Which of these best predicts the outcome of the changes illustrated in the diagrams?

Which of these best predicts the outcome of the changes illustrated in the diagrams? 1. The diagrams below show two different scenarios for a pair of homologous chromosomes, known as a tetrad, undergoing a change where segments of DNA switch on parts of the chromosomes. In each scenario,

More information

A CsgD-Independent Pathway for Cellulose Production and Biofilm Formation in Escherichia coli

A CsgD-Independent Pathway for Cellulose Production and Biofilm Formation in Escherichia coli JOURNAL OF BACTERIOLOGY, Apr. 2006, p. 3073 3087 Vol. 188, No. 8 0021-9193/06/$08.00 0 doi:10.1128/jb.188.8.3073 3087.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. A CsgD-Independent

More information

Structural insights into bacterial flagellar hooks similarities and specificities

Structural insights into bacterial flagellar hooks similarities and specificities Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:

More information

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1. Nature Genetics: doi: /ng.3848 Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

More information

Part II. Agrobacterium rhizogenes-mediated Gene Transfer

Part II. Agrobacterium rhizogenes-mediated Gene Transfer Part II Agrobacterium rhizogenes-mediated Gene Transfer Introduction II Agrobacterium rhizogenes, a Natural Transformation System D. TEPFER Plant-microorganism interactions are based on exchanges of nutritional

More information

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information

Unit B1 Influence on Life. (EdExcel)

Unit B1 Influence on Life. (EdExcel) Unit B1 Influence on Life (EdExcel) Topic 1 - Classification Classification The world is populated by millions of different species of animals and plants Classification How would you construct a key to

More information

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.

Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of

More information

4) Use ATP and Swi.Snf type enzymes to move the histones along the DNA

4) Use ATP and Swi.Snf type enzymes to move the histones along the DNA GENE 603 Exam 2, October 27, 2017 NAME 1. What are histones and how are they involved in regulating gene expression? Describe 3 common modifications and the effect they would be expected to have on the

More information

AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi: /aac

AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi: /aac AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.00614-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Special Topics on Genetics

Special Topics on Genetics ARISTOTLE UNIVERSITY OF THESSALONIKI OPEN COURSES Section 9: Transposable elements Drosopoulou E License The offered educational material is subject to Creative Commons licensing. For educational material,

More information

The Genetic Epidemiology of Antibiotic Resistance

The Genetic Epidemiology of Antibiotic Resistance The Genetic Epidemiology of Antibiotic Resistance Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright The forensics of AMR Resistance

More information

Why do cells divide? Why do cells divide? What would happen if they didn t?

Why do cells divide? Why do cells divide? What would happen if they didn t? 1 of 41 Boardworks Ltd 2007 2 of 41 Boardworks Ltd 2007 Why do cells divide? 3 of 41 Boardworks Ltd 2007 Why do cells divide? What would happen if they didn t? Organisms would only ever exist as single

More information

Final Exam Review. 1. Arrange the 7 levels of Linnaean classification from most general (ie: kingdom) to most specific (ie: species)

Final Exam Review. 1. Arrange the 7 levels of Linnaean classification from most general (ie: kingdom) to most specific (ie: species) SBI 3U1 Final Exam Review Diversity 1. Arrange the 7 levels of Linnaean classification from most general (ie: kingdom) to most specific (ie: species) 2. a) Explain how the structure of prokaryotic cells

More information

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium

More information

Factors involved in the enhanced efficacy against Gram-negative bacteria of fourth generation cephalosporins

Factors involved in the enhanced efficacy against Gram-negative bacteria of fourth generation cephalosporins Journal of Antimicrobial Chemotherapy (1992) 29, Suppl.,4. 1-6 Factors involved in the enhanced efficacy against Gram-negative bacteria of fourth generation cephalosporins Robert E. W. Hancock and Francis

More information

Resistente micro-organismen: Voorkomen en controle met hordentechnologie

Resistente micro-organismen: Voorkomen en controle met hordentechnologie Resistente micro-organismen: Voorkomen en controle met hordentechnologie Prof. Dr. Ir. Chris Michiels Labo Levensmiddelenmicrobiologie Faculteit Bio-ingenieurswetenschappen KU Leuven chris.michiels@kuleuven.be

More information

Add Up and Cross Over Sordaria Genetics Simulation

Add Up and Cross Over Sordaria Genetics Simulation Introduction Add Up and Cross Over Sordaria Genetics Simulation Publication No. Crossing over occurs during metaphase I of meiosis. During crossing over, homologous pairs of chromosomes exchange sections

More information

Inter-Species Population Dynamics Enhance Microbial Horizontal Gene Transfer And Spread Of Antibiotic Resistance

Inter-Species Population Dynamics Enhance Microbial Horizontal Gene Transfer And Spread Of Antibiotic Resistance Inter-Species Population Dynamics Enhance Microbial Horizontal Gene Transfer And Spread Of Antibiotic Resistance Robert Cooper, Lev Tsimring, and Jeff Hasty,,, September, University of California, San

More information

Kingdom Monera(Archaebacteria & Eubacteria)

Kingdom Monera(Archaebacteria & Eubacteria) Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.

More information

Advanced Placement Biology Syllabus

Advanced Placement Biology Syllabus Advanced Placement Biology Syllabus The Advanced Placement (AP) Biology Course is designed to give students a college-level survey course. It emphasizes the biological concepts as specified in the theme

More information

Elastic strings and springs Mixed exercise 3

Elastic strings and springs Mixed exercise 3 Elastic strings and springs Mixed exercise ( )T cosθ mg By Hooke s law 5mgx T 6a a sinθ a + x () () () a 4 5mg Ifcos θ, T from () 5 8 5mg 5mgx so, from () 8 6a a x 4 If cos θ, then sinθ 5 5 a sinθ from

More information

Objectives. Epidemiology of AB resistance in S. pneumoniae. Pasteur Institute (R. Vanhoof) AB resistance evaluation (MIC) & mechanisms

Objectives. Epidemiology of AB resistance in S. pneumoniae. Pasteur Institute (R. Vanhoof) AB resistance evaluation (MIC) & mechanisms Epidemiological survey of susceptibility to β-lactams, macrolides, and fluoroquinolones in a Belgian collection of Streptococcus pneumoniae isolated from patients with CAP A. Lismond, S. Carbonnelle, F.

More information

BACTERIA AND ARCHAEA 10/15/2012

BACTERIA AND ARCHAEA 10/15/2012 BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in

More information

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

More information

NAME: Section A: 20 Multiple Choice Questions /20 Marks. Circle the best alternative on the answer sheet provided.

NAME: Section A: 20 Multiple Choice Questions /20 Marks. Circle the best alternative on the answer sheet provided. NAME: Section A: 20 Multiple Choice Questions /20 Marks Circle the best alternative on the answer sheet provided. Answer all questions. Section B: 8 Short Answer Questions /40 Marks Answer all questions

More information

Gene flow favours local adaptation under habitat choice in ciliate microcosms

Gene flow favours local adaptation under habitat choice in ciliate microcosms SUPPLEMENTARY Brief Communication INFORMATION DOI: 10.1038/s41559-017-0269-5 In the format provided by the authors and unedited. Gene flow favours local adaptation under habitat choice in ciliate microcosms

More information

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics. Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary

More information