The Genetic Epidemiology of Antibiotic Resistance
|
|
- Damian Kelly
- 6 years ago
- Views:
Transcription
1 The Genetic Epidemiology of Antibiotic Resistance Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright
2 The forensics of AMR Resistance involves emergence of mutations spread of resistance genes spread of resistant strains Genes Gene carriers IS, In, Tn, plasmids Tracking and characterizing the resistant strains their resistance genes Host species Strains, clones, phylogenetic groups, virulence traits, co-resistance Patients Hospital / community setting; risk factors 2 Sydney, 20th November 2014 Crown Copyright
3 The molecular epidemiology of resistance The resistant isolates molecular methods define strains relevant to hospital epidemiology 1. inter-patient or inter-hospital spread of strains 2. identifying new strains with the same resistance 3. on a national & global scale, the strains are highly diverse Their resistance genes / elements horizontal transfer of transposons or plasmids fundamental units of resistance characterization needed for the bigger picture origins and evolution of resistance 3 Sydney, 20th November 2014 Crown Copyright
4 Can you distinguish TEM-1 from CTX-M-15? Enzyme Examples Confer resiatance to Penicilllinases ESBLs pampc TEM-1/-2, SHV-1, OXA- 1/-30 TEM-, SHV-, OXA-, CTX- M, VEB, PER CMY, ACC, DHA, FOX, MOX, ENT / EBC Penicillins; early cephalosporins; overexpression affects penicillininhibitor combinations All generation cephalosporins (not cephamycins) 3 rd gen cephs (not 4 th ); cephamycins Carbapenems remain active against producers of these enzymes and are increasingly used for treatment 4 Sydney, 20th November 2014 Crown Copyright
5 Multiple escape events for the CTX-M family K. georgiana- related CTX-M-9 group K. georgiana- related K. ascorbata- related K. ascorbata- related The most successful variant: CTX-M-15 5 Sydney, 20th November 2014 Crown Copyright
6 followed by spread and global domination 6 Sydney, 20th November 2014 Crown Copyright Hawkey and Jones. JAC 2009; 64 (Suppl. 1), i3-i10
7 Travel destination influences risk and type of resistance 7 Sydney, 20th November 2014 Crown Copyright Ostholm-Balkhed et al. JAC 2013; 68:
8 ST131 dominates among ESBL-positive E. coli 8 Sydney, 20th November 2014 Crown Copyright
9 Geom. mean MICs (mg/l), CTX-M-15 +ve E. coli Epidemic A Other CTX-M- 15 Cefotaxime Ceftazidime Pip/taz Ciprofloxacin Trimethoprim Gentamicin Amikacin Nitrofurantoin Sydney, 20th November 2014 Crown Copyright Woodford et al., JAC 2004, 54, 735
10 Disruption of ISEcp1-bla CTX-M in ST131 strain A Most strains : ISEcp1 bla CTX-M bp Strain A : ISEcp1 IS26 bla CTX-M-15 IS26 between the bla gene and its usual promoter lower cephalosporin MICs 10 Sydney, 20th November 2014 Crown Copyright
11 Bacteria don t keep resistance genes to themselves 11 Sydney, 20th November 2014 Crown Copyright
12 Neat packages of multi-resistance Antibiotic classes Aminoglycosides Genes aac6 -Ib-cr aada5 Mechanism Modify drug β-lactams bla CTX-M-15 bla OXA-1 Destroy drug bla TEM-1 Chloramphenicol catb4 Modify drug Macrolides mph(a) Efflux Fluoroquinolones aac6 -Ib-cr Modify drug Sulfonamides suli By-pass Trimethoprim dhfr XVII By-pass Tetracycline tet(a) Efflux 12 Sydney, 20th November 2014 Crown Copyright Woodford, Carattoli et al. AAC
13 IncFII plasmids are spreading CTX-M-15 globally (Canada) UK Strain D UK Strain A 13 Sydney, 20th November 2014 Crown Copyright Woodford & Carattoli, AAC, 2009: 53:
14 but not all CTX-M plasmids in ST131 confer MDR UK strain C 96 kb, IncI1 encodes CTX-M-3 and TEM-1 no other resistance genes 14 Sydney, 20th November 2014 Crown Copyright Woodford & Carattoli, unpublished
15 Closely related CTX-M ESBLs have different origins related genes usually on distinct plasmid types CTX-M-3 : IncL/M (Poland), IncA/C, IncHI2, IncI1 CTX-M-15 (Asp240Gly) : IncF (IA, IB, II) ISEcp1-bla CTX-M-3 /-15 linking sequences often vary 48-bp (CTX-M-15) or 128-bp (CTX-M-3) separate escape events, rather than mutation after escape global CTX-M-15 explosion repeated mutation of bla CTX-M-3 it s horizontal plasmid spread and clonal expansion 15 Sydney, 20th November 2014 Crown Copyright
16 Putting it all together in the real world: ESBLs in nursing homes in Northern Ireland 40% patients colonized 134 / 135 isolates phylogenetic group B2, ST131 1) Strain spread: Strain A with CTX-M-15 on IncFII/FIA plasmid pek499 2) Plasmid spread: 3 strains with IncI1 plasmids (pek204-like) 3) Gene / Transposon spread: CTX-M-3 encoded by IncI1, IncFIA-B, IncN, and IncY plasmids 16 Sydney, 20th November 2014 Crown Copyright
17 Transposition has facilitated spread of bla CTX-M-3 to other plasmids ISEcp1-mediated mobilization of: bla CTX-M-3 only bla CTX-M-3 and bla TEM-1 Latter structure is identical to structures on IncFIA, IncFIA-FIB, IncN and IncY plasmids in Belfast 17 Sydney, 20th November 2014 Crown Copyright Dhanji et al. JAC 2011; 66:
18 Hospital antibiotic sales (kg; IMS data) 3000 Carbapenems use of carbapenems new selective pressures..., but what consequences? 18 Sydney, 20th November 2014 Crown Copyright
19 Acquired carbapenemases Class Carbapenemase Enterobacteriaceae Non-fermenters A (non-metallo) KPC BIC, GES, IMI, NMC, SME + +/- B (metallo) IMP*, VIM* NDM AIM, DIM, GIM, SIM, SPM, TMB - ++ D (non-metallo) OXA-48-like +++ +/- OXA-23, -40, -58, -143, /- +++ IMP- & VIM- types are integron-associated IMP-types described first, but have been overtaken by other types 19 Sydney, 20th November 2014 Crown Copyright
20 Strain dynamics: a dominant international KPC +ve K. pneumoniae clone, but... ST258 ST258 ST258 One KPC outbreak: 11, 25, , (258 - Col-R) , 491 plus Enterobacter + E. coli 20 Sydney, 20th November 2014 Crown Copyright Nordmann et al. TLID 2009; 9:
21 A KPC cluster: spread of strains and plasmids Isolate Patient Bacterial ID VNTR profile KPC Plasmid n=6 A, B, C, D, E, H K. pneumoniae 6, 4, 2, 0, -, 2, 2, 3, 1 pkpqil-d2 3 C E. cloacae n.a. pkpqil-d2 7 F Klebsiella oxytoca n.a. pkpqil-d2 8 G Citrobacter freundii n.a. Not pkpqil-like* 9 G K. pneumoniae 1, -, 4, 1, -, 1, 3, 5, 1 Not pkpqil-like* Patients A, B, C, D, E & H spread of the same K. pneumoniae strain Patients C and F spread of pkpqil plasmid into two other species Patient G Separate introduction (distinct strains and plasmids) 21 Sydney, 20th November 2014 Crown Copyright
22 International plasmid epidemic : OXA-48 in Klebsiella, Enterobacter and E. coli OXA-181 (c. 7kb) OXA-48 (c. 62 kb) OXA Sydney, 20th November 2014 Crown Copyright
23 OXA-48 and its known relatives: (ex-shewanella spp.) OXA Shewanella piezotolerans WP3 OXA Shewanella baltica OS223 OXA Shewanella putrefaciens CN-32 OXA-181 Shewanella xiamenensis S12 OXA-163 OXA-48 OXA-162 OXA-54 Shewanella oneidensis MR-1 OXA-55 Shewanella algae KB-1 OXA Shewanella loihica PV-4 OXA Shewanella pealeana ATCC OXA Shewanella halifaxensis HAW-EB4 A 23 Gram-negative Sydney, 20th November genus 2014 isolated Crown Copyright from lake sediments
24 All this yet we still can t answer some questions H H E. coli K. pneumoniae E. coli + K. pneumoniae, same patient similar NDM plasmids Do they indicate: transfer in the patient, or that patient was colonized by two strains already possessing related plasmids? 24 Sydney, 20th November 2014 Crown Copyright
25 Whole genome sequencing and resistance prediction Will it solve our problems, or just create new ones? Need an iterative catalogue of all resistance determinants By species? Need algorithm(s) for fast processing Will need high sensitivity and specificity low numbers of very major errors (resistant, but no R gene found so called susceptible) and major errors (susceptible, but R gene found and so called resistant) Will need to be validated to be equivalent or superior to routine susceptibility testing 25 Sydney, 20th November 2014 Crown Copyright
26 Concordance of genotypic vs. phenotypic antibiograms for E. coli (n=74) 26 Sydney, 20th November 2014 Crown Copyright J. Antimicrob. Chemother. (2013)
27 Can WGS eventually (ever?) replace some AST? All rapid tests for mechanisms = surrogates for rapid AST Absence of a resistance mechanism doesn t confirm susceptibility cannot indicate appropriate empiric therapy Presence of a resistance mechanism used to infer likely resistance indicates potentially inappropriate empiric therapy (Confirming susceptibility = prime criterion for appropriate therapy) Challenge is to replace surveillance in e.g. surveys first Likely to be problematic antibiotic classes with poor concordance 27 Sydney, 20th November 2014 Crown Copyright
By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD
By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)
More informationResistance to third-generation cephalosporins in human non-typhoidal Salmonella enterica isolates from England and Wales,
Royal College of Surgeons in Ireland e-publications@rcsi Clinical Microbiology Articles Department of Clinical Microbiology 1-4-2014 Resistance to third-generation cephalosporins in human non-typhoidal
More informationAntibiotic Resistance in Enterobacteriaceae
Antibiotic Resistance in Enterobacteriaceae Prof. P. Nordmann 16 es JNI, Nancy, du 10 au 12 juin 2015 1 16 es JNI, Nancy, du 10 au 12 juin 2015 16 es JNI, Nancy, du 10 au 12 juin 2015 16 es JNI, Nancy,
More informationWhy the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method
Why the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method Peter Newton Medical Microbiologist Wollongong Hospital, Wollongong, NSW Where do I come from? SEALS
More informationReceived 1 November 2011; returned 25 November 2011; revised 30 November 2011; accepted 1 December 2011
J Antimicrob Chemother 2012; 67: 878 885 doi:10.1093/jac/dkr553 Advance Access publication 29 December 2011 Characterization of plasmids encoding extended-spectrum b-lactamases and their addiction systems
More informationCharacteristics of Plasmids in Multi-Drug-Resistant Enterobacteriaceae Isolated during Prospective Surveillance of a Newly Opened Hospital in Iraq
Characteristics of Plasmids in Multi-Drug-Resistant Enterobacteriaceae Isolated during Prospective Surveillance of a Newly Opened Hospital in Iraq Xiao-Zhe Huang 1 *., Jonathan G. Frye 2., Mohamad A. Chahine
More informationPhenotypic and Molecular Characteristics of Carbapenem-Non-Susceptible Enterobacteriaceae from a Teaching Hospital in Wenzhou, Southern China
Jpn. J. Infect. Dis., 66, 96-102, 2013 Original Article Phenotypic and Molecular Characteristics of Carbapenem-Non-Susceptible Enterobacteriaceae from a Teaching Hospital in Wenzhou, Southern China Tieli
More informationIan Morrissey, 1 Samuel K. Bouchillon, 2 Meredith Hackel, 2 Douglas J. Biedenbach, 2 Stephen Hawser, 1 Daryl Hoban 2 and Robert E.
Journal of Medical Microbiology (2014), 63, 556 561 DOI 10.1099/jmm.0.068981-0 Evaluation of the Clinical and Laboratory Standards Institute phenotypic confirmatory test to detect the presence of extended-spectrum
More informationImplementation of Public Health Surveillance of Carbapenemase- Producing Enterobacteriaceae in Victoria, Australia
Implementation of Public Health Surveillance of Carbapenemase- Producing Enterobacteriaceae in Victoria, Australia C.R. Lane*, J. Brett, M.B. Schultz, K. Stevens, A. van Diemen, S.A. Ballard, N.L. Sherry,
More informationESCMID Online Lecture Library
E. coli producing extendedspectrum β lactamases Luis Martínez Martínez Dept. Molecular Biology, University of Cantabria Service of Microbiology Hosp. Univ. Marqués de Valdecilla Santander, Spain Barcelona
More informationWhole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) as a tool for monitoring purposes Henrik Hasman DTU - Food The Challenge Is to: Continue to increase the power of surveillance and diagnostic using molecular tools Develop
More informationMost common dose (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1. Maximum dose schedule (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1
Ertapenem Rationale for the EUCAST clinical breakpoints, version 1.3 1 st June 2009 Introduction Ertapenem is a carbapenem, available only for parenteral use. Ertapenem is relevant for therapy of septicaemia,
More informationCharacterization of plasmids encoding bla ESBL and surrounding genes in Spanish clinical isolates of Escherichia coli and Klebsiella pneumoniae
Journal of Antimicrobial Chemotherapy (2009) 63, 60 66 doi:10.1093/jac/dkn453 Advance Access publication 6 November 2008 Characterization of plasmids encoding bla ESBL and surrounding genes in Spanish
More informationTwo novel Salmonella genomic island 1 variants in Proteus mirabilis
AAC Accepted Manuscript Posted Online 27 April 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.00120-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Two novel Salmonella
More informationNew Delhi Metallo-Beta-Lactamase- Producing Enterobacteriaceae in. South Korea Between 2010 and 2015 INTRODUCTION
ORIGINAL RESEARCH published: 29 March 2018 doi: 10.3389/fmicb.2018.00571 New Delhi Metallo-Beta-Lactamase- Producing Enterobacteriaceae in South Korea Between 2010 and 2015 Eun-JeongYoon 1,DaYoungKang
More informationRapid detection of extended-spectrum ß-lactamase-producing. Enterobacteriaceae
JCM Accepts, published online ahead of print on 3 July 2012 J. Clin. Microbiol. doi:10.1128/jcm.00859-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Rapid detection of extended-spectrum
More informationGentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009
Gentamicin Rationale for the EUCAST clinical breakpoints, version 1.2 16 th February, 2009 Introduction The aminoglycosides are a group of naturally occurring or semi-synthetic compounds with bactericidal
More informationReport: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014
CODA-CERVA Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014 Vicky Jasson and Pierre Wattiau Veterinary and Agrochemical Research Centre 1 Introduction
More informationWhole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes
More informationEscherichia coli O26 9
15 Vero b- (ESBL) Escherichia coli O26 1 1) 1) 2) 2) 2) 2) 3) 3) 1) 1) 2) 2 3) 16 10 18 16 12 17 Vero b- (Extended-spectrum b-lactamase: ESBL) Escherichia coli O26 9 2004 6 14 16 E. coli O O26 Vero VT1
More informationComparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK hospitals
Journal of Antimicrobial Chemotherapy (2003) 51, 1191 1202 DOI: 10.1093/jac/dkg234 Advance Access publication 14 April 2003 Comparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK
More informationCharacteristics of extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from horses
Veterinary Microbiology 124 (2007) 248 255 www.elsevier.com/locate/vetmic Characteristics of extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from horses An
More informationResistance plasmid families in Enterobacteriaceae
AAC Accepts, published online ahead of print on March 00 Antimicrob. Agents Chemother. doi:0./aac.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationAAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi: /aac
AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.00614-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.
More information«Minor» ESBLs T. NAASN AAS, Microbiology department (P. Nordmann) Bicêtre hospital, South Paris Medical School France CENTRE HOSPITALIER
CENTRE HOSPITALIER UNIVERSITAIR E BICÊTRE «Minor» ESBLs T. NAASN AAS, Microbiology department (P. Nordmann) Bicêtre hospital, South Paris Medical School France ß-lactamases Serine b-lactamases Metallo
More informationValue of the Modified Hodge test for detection of emerging. carbapenemases in Enterobacteriaceae
JCM Accepts, published online ahead of print on 23 November 2011 J. Clin. Microbiol. doi:10.1128/jcm.05247-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationToronto General Hospital ANTIBIOGRAM Emergency Department January 1, December 31, 2016
IV (meningitis) IV (non-meningitis) (meningitis) (non-meningitis) Blood Isolates % Susceptible 644 18 36 70 78 74 59 69 75 262 100 19 64 75 100 92 54 72 78 76 68 89 86 99 Escherichia coli 153 58 30 67
More informationCharacterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan
Jpn. J. Infect. Dis., 60, 250-256, 2007 Original Article Characterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan Chien-Fang
More informationACCEPTED. *Corresponding author. Mailing address: Faculdade de Medicina Veterinária, Av. da
AAC Accepts, published online ahead of print on 10 November 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.00896-08 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationDetection of carbapenemase producers in Enterobacteriaceae. using a novel screening medium
JCM Accepts, published online ahead of print on 22 February 2012 J. Clin. Microbiol. doi:10.1128/jcm.06477-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Detection of carbapenemase
More informationIncreasing Carbapenem-Resistant Gram-Negative Bacilli and Decreasing Metallo-β-Lactamase Producers over Eight Years from Korea
Brief Communication http://dx.doi.org/10.3349/ymj.2015.56.2.572 pissn: 0513-5796, eissn: 1976437 Yonsei Med J 56(2):572-577, 2015 Increasing Carbapenem-Resistant Gram-Negative Bacilli and Decreasing Metallo-β-Lactamase
More informationEUCAST Expert Rules Version 3.1. Intrinsic Resistance and Exceptional Phenotypes Tables
EUCAST Expert s Version 3.1 Intrinsic Resistance and Exceptional Phenotypes Tables EUCAST Expert s version 2.0 was published on 29 October 2011(http://www.eucast.org/expert_rules). The expert rules have
More informationGenomic characteristics of NDM-producing Enterobacteriaceae in
AAC Accepted Manuscript Posted Online 19 October 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.01243-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 Genomic characteristics
More informationINRA, UR1282, Infectiologie Animale et Santé Publique, IASP, Nouzilly, F-37380, France 1 ;
AAC Accepts, published online ahead of print on 1 July 0 Antimicrob. Agents Chemother. doi:./aac.000- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationGenetic characterization of IncI2 plasmids carrying bla CTX-M-55. spreading in both pets and food animals in China
AAC Accepts, published online ahead of print on 11 March 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.02155-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Genetic
More informationMINIREVIEW. Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes. R. Bonnet*
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Jan. 2004, p. 1 14 Vol. 48, No. 1 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.1.1 14.2004 MINIREVIEW Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes
More informationPrevalence and molecular epidemiology of plasmidmediated fosfomycin resistance genes among blood and urinary Escherichia coli isolates
Journal of Medical Microbiology (2013), 62, 1707 1713 DOI 10.1099/jmm.0.062653-0 Prevalence and molecular epidemiology of plasmidmediated fosfomycin resistance genes among blood and urinary Escherichia
More informationREVIEW. Extended-spectrum b-lactamases and the permeability barrier
REVIEW Extended-spectrum b-lactamases and the permeability barrier L. Martínez-Martínez Service of Microbiology, University Hospital Marqués de Valdecilla, Santander, Spain ABSTRACT The outer membrane
More informationEfflux Mechanisms of Fluoroquinolones and β-lactams
Efflux Mechanisms of Fluoroquinolones and β-lactams Paul M. Tulkens, MD, PhD Françoise Van Bambeke, PharmD, PhD Cellular and Molecular Pharmacology Unit Catholic University of Louvain, Brussels, Belgium
More informationExpansion of Salmonella Typhimurium ST34 clone carrying multiple. resistance determinants in China
AAC Accepts, published online ahead of print on 24 June 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01174-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Expansion
More informationAntibiotic resistance by efflux: from molecular aspects to cinical impact
16-09-2013 University of Notre-Dame, Notre Dame, IN 1 Antibiotic resistance by efflux: from molecular aspects to cinical impact Françoise Van Bambeke & Paul M. Tulkens Pharmacologie cellulaire et moléculaire
More informationPseudomonas putida 5
Pseudomonas putida 1 1 2 1 2 1 2 14 1 8 14 12 16 1997 1 21 12 5 Pseudomonas putida 8 27 imipenemipm IPM piperacillinceftazidimeamikacin norfloxacin 27 IPM IMP blaimp P. putida blaimp 27 8 9 4 1 MIC P.
More informationEmergence of colistin resistance in Gram-negative bacteria
Emergence of colistin resistance in Gram-negative bacteria Youri GLUPCZYNSKI Daniel Te-Din HUANG Pierre BOGAERTS CHU UCL Namur Dinant-Godinne Clinical Microbiology Laboratory National Reference Centre
More informationBMR nouveaux antibiotiques Dubreuil, PhD, PharmD - LIRIC UMR 995 Inserm/Université Lille France
BMR nouveaux antibiotiques Dubreuil, PhD, PharmD - LIRIC UMR 995 Inserm/Université Lille France Lille Octobre 2016 Bad bugs need new drug MRSA LIRIC UMR 995 Dubreuil L S. pneumoniae SFM Mars 2016 Adverse
More informationValidation of EUCAST zone diameter breakpoints against reference broth microdilution
ORIGINAL ARTICLE BACTERIOLOGY Validation of EUCAST zone diameter breakpoints against reference broth microdilution S. Bengtsson 1, C. Bjelkenbrant 1 and G. Kahlmeter 1,2 1) Department of Clinical Microbiology,
More informationTetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009
Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline
More informationBasma Mnif 1,3,4*, Hela Harhour 1,4, Jihène Jdidi 2, Faouzia Mahjoubi 1,4, Nathalie Genel 3, Guillaume Arlet 3 and Adnene Hammami 1,4
Mnif et al. BMC Microbiology 2013, 13:147 RESEARCH ARTICLE Open Access Molecular epidemiology of extended-spectrum beta-lactamase-producing Escherichia coli in Tunisia and characterization of their virulence
More informationNitroxoline Rationale for the NAK clinical breakpoints, version th October 2013
Nitroxoline Rationale for the NAK clinical breakpoints, version 1.0 4 th October 2013 Foreword NAK The German Antimicrobial Susceptibility Testing Committee (NAK - Nationales Antibiotika-Sensitivitätstest
More informationEpidemiology and genetics of CTX-M extended-spectrum β-lactamases in Gram-negative bacteria
Critical Reviews in Microbiology, 2013; 39(1): 79 101 ISSN 1040-841X print/issn 1549-7828 online DOI: 10.3109/1040841X.2012.691460 REVIEW ARTICLE Epidemiology and genetics of CTX-M extended-spectrum β-lactamases
More informationComparisons of CTX-M-Producing Escherichia coli Isolates from Humans and Animals in South Korea
Journal of Bacteriology and Virology 2014. Vol. 44, No. 1 p.44 51 http://dx.doi.org/10.4167/jbv.2014.44.1.44 Original Article Comparisons of CTX-M-Producing Escherichia coli Isolates from Humans and Animals
More informationMechanisms of colistin resistance in Gram negative bacteria
Mechanisms of colistin resistance in Gram negative bacteria BARON Sophie Interne en biologie médicale 2 st year PhD student Supervisor: ROLAIN Jean-Marc I. Increase of antibiotic resistance. Introduction
More informationby author ESCMID Online Lecture Library Epidemiological cutoff values (ECOFFs) and Low Level resistance Gunnar Kahlmeter
Epidemiological cutoff values (ECOFFs) and Low Level resistance ECCMID 2010 Gunnar Kahlmeter Sweden Gunnar.Kahlmeter@ltkronoberg.se The epidemiological cutoff value ECOFF When breakpoints fail to detect
More informationAntibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria
Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Unité de Pharmacologie cellulaire et moléculaire F. Van Bambeke Magic bullets need to reach their target
More informationLow intestinal colonization of Escherichia coli clone ST131 producing CTX-M-15 in Jordanian infants
Journal of Medical Microbiology (2016), 65, 137 141 DOI 10.1099/jmm.0.000210 Low intestinal colonization of Escherichia coli clone ST131 producing CTX-M-15 in Jordanian infants E. F. Badran, 1 R. A. Qamer
More informationZoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2007, p. 6686 6690 Vol. 73, No. 20 0099-2240/07/$08.00 0 doi:10.1128/aem.01054-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Zoo
More informationThree Steps to Antibiotic Resistance?
Three Steps to Antibiotic Resistance? The Development of Tigecycline Resistance in the Gram-Negative Bacteria Escherichia coli and Salmonella typhimurium Minna-Maria Neuvonen Degree project in biology,
More informationACCEPTED. from Poultry and Humans in Belgium and France,
AAC Accepts, published online ahead of print on February 00 Antimicrob. Agents Chemother. doi:./aac.0-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationStability. Received for publication 1 August to be fl-lactamase-producing strains.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1978, p. 584-588 0066-4804/78/0013-0584$02.00/0 Copyright X) 1978 American Society for Microbiology Vol. 13, No. 4 Printed in U.S.A. Cefaclor: In Vitro Spectrum
More informationAntimicrobial Activities of Ceftazidime/Avibactam and Comparator Agents against Clinical. Bacteria Isolated from Patients with Cancer.
AAC Accepted Manuscript Posted Online 23 January 2017 Antimicrob. Agents Chemother. doi:10.1128/aac.02106-16 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 Antimicrobial Activities
More informationHo, PL; Yeung, MK; Lo, WU; Tse, H; Li, Z; Lai, ELY; Chow, KH; To, KK; Yam, WC
Title Author(s) Predominance of phk01-like incompatibility group FII plasmids encoding CTX-M-14 among extended-spectrum beta-lactamaseproducing Escherichia coli in Hong Kong, 1996-2008 Ho, PL; Yeung, MK;
More informationPlasmid-Mediated Antimicrobial Resistance in Salmonella enterica
Curr. Issues Mol. Biol. (2003) 5: 113-122. Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica 113 Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica Alessandra Carattoli Lab.
More informationSerotype epidemiology and multidrug resistance patterns of Salmonella enterica infecting humans in Italy
DOI 10.1186/s13099-016-0110-8 Gut Pathogens RESEARCH Serotype epidemiology and multidrug resistance patterns of Salmonella enterica infecting humans in Italy Ilaria Frasson 1, Sabrina Bettanello 2, Ettore
More informationWhy is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC
Why is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC 2 The Innovation gap in novel classes Obscures the Discovery void 1940
More informationTitle: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America
Accepted Manuscript Title: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America Author: Diego Faccone S13-71(18)30078-X https://doi.org/101/j.jgar.018.04.011
More informationPlasmid-encoded functions compensate for the biological cost of AmpC overexpression in a clinical isolate of Salmonella typhimurium
Journal of Antimicrobial Chemotherapy (2004) 53, 964 970 DOI: 10.1093/jac/dkh240 Advance Access publication 12 May 2004 Plasmid-encoded functions compensate for the biological cost of AmpC overexpression
More informationScreening Extended-spectrum b-lactamase Production in Enterobacter cloacae and Serratia marcescens Using Antibiogram-based Methods
J Microbiol Immunol Infect 2010;43(1):26 34 Contents lists available at ScienceDirect Journal of Microbiology, Immunology and Infection Journal homepage: http://www.e-jmii.com Original Article Screening
More informationand ColE-like (both human and chicken isolates) plasmids (2, 6, 8, 9, 11, 13, 14, 16).
AAC Accepts, published online ahead of print on 18 October 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.00866-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationAntibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria
Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Françoise Van Bambeke on behalf of J.M. Michot, C. Seral, M. Heremans, M.P. Mingeot-Leclercq, P.M.
More informationReceived 5 July 2008/Returned for modification 2 September 2008/Accepted 10 October 2008
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2009, p. 519 524 Vol. 53, No. 2 0066-4804/09/$08.00 0 doi:10.1128/aac.00886-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. High Prevalence
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationIncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates
ORIGINAL RESEARCH published: 30 September 2016 doi: 10.3389/fmicb.2016.01566 IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates Wenyao Chen, Tingzi Fang, Xiujuan Zhou, Daofeng
More informationIntroduction to the SNP/ND concept - Phylogeny on WGS data
Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny
More informationOriginal Article Clinical Microbiology INTRODUCTION
Original Article Clinical Microbiology Ann Lab Med 2018;38:555-562 https://doi.org/10.3343/alm.2018.38.6.555 ISSN 2234-3806 eissn 2234-3814 Detection of mcr-1 Plasmids in Enterobacteriaceae Isolates From
More informationReading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing
Reading guide EUCAST disk diffusion method for antimicrobial susceptibility testing Version 4.0 June 2014 Modifications to EUCAST reading guide slide show Version Version 4.0 June 2014 Version 3.0 April
More informationEvolution of bacterial resistance to antibiotics during the last three decades
INTERNATL MICROBIOL (1998) 1:279 284 Springer-Verlag Ibérica 1998 REVIEW ARTICLE 279 Rafael Gómez-Lus Department of Microbiology, Hospital Clínico Universitario, Zaragoza, Spain Received 25 June 1998 Accepted
More informationb-lactam resistance and b-lactamase expression in clinical Stenotrophomonas maltophilia isolates having defined phylogenetic relationships
Journal of Antimicrobial Chemotherapy Advance Access published December 13, 2005 Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dki453 b-lactam resistance and b-lactamase expression in clinical
More informationCeftriaxone resistant Salmonella Typhimurium Sequence Type 313 from Kenyan patients is associated with blactx-m-15 gene on a novel IncHI2 plasmid
AAC Accepted Manuscript Posted Online 16 March 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.00078-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 Ceftriaxone
More informationMolecular Characterization of Antibiotic-Resistant Salmonella Isolates from Retail Meat from Markets in Northern Vietnam
1709 Journal of Food Protection, Vol. 75, No. 9, 2012, Pages 1709 1714 doi:10.4315/0362-028x.12-101 Copyright G, International Association for Food Protection Research Note Molecular Characterization of
More informationSTUDY ABOUT ANTIBIOTIC RESISTANCE IN SERRATIA SPP. ISOLATED FROM HOSPITALIZED PATIENTS
Bulletin of the Transilvania University of Braşov Series VI: Medical Sciences Vol. 7 (56) No. 1-2014 STUDY ABOUT ANTIBIOTIC RESISTANCE IN SERRATIA SPP. ISOLATED FROM HOSPITALIZED PATIENTS Mihaela Elena
More informationNatural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species
Natural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species Sara Domingues 1,2, Klaus Harms 2, W. Florian Fricke 3,Pål J. Johnsen 2, Gabriela J. da
More informationμ gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli gyra E. coli parc gyra parc gyra Escherichia coli E. coli E.
gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli μ E. coli gyra parc gyra parc gyra parc μ μ gyra parc Key words Escherichia coli gyra parc Escherichia coli E. coli gyra
More informationEmergence of Multidrug-Resistant Salmonella enterica Serovar Typhi in Korea
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2004, p. 4130 4135 Vol. 48, No. 11 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.11.4130 4135.2004 Copyright 2004, American Society for Microbiology. All Rights
More informationTested Against Tigecycline and Agents Commonly Used for S. maltophilia Infections. David J. Farrell 1*, Helio S. Sader 1,2. and. Ronald N.
AAC Accepts, published online ahead of print on 5 April 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.01774-09 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationResearch Article Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures
BioMed Volume 2016, Article ID 1081536, 6 pages http://dx.doi.org/10.1155/2016/1081536 Research Article Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures
More informationObjectives. Epidemiology of AB resistance in S. pneumoniae. Pasteur Institute (R. Vanhoof) AB resistance evaluation (MIC) & mechanisms
Epidemiological survey of susceptibility to β-lactams, macrolides, and fluoroquinolones in a Belgian collection of Streptococcus pneumoniae isolated from patients with CAP A. Lismond, S. Carbonnelle, F.
More informationAntibiotic Resistance in Escherichia coli Iron Transport Mutants
Bowling Green State University ScholarWorks@BGSU Honors Projects Honors College Fall 12-11-2017 Antibiotic Resistance in Escherichia coli Iron Transport Mutants Madeline Brandt mbrandt@bgsu.edu Follow
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationStructural and biochemical investigation of Metallo-β-lactamases; Insights into the antibiotic binding sites
FACULTY OF HEALTH SCIENCES DEPARTMENT OF MEDICAL BIOLOGY UNIVERSITY HOSPITAL OF NORTH NORWAY DEPARTMENT OF MICROBIOLOGY AND INFECTION CONTROL REFERENCE CENTRE FOR DETECTION OF ANTIMICROBIAL RESISTANCE
More informationAlita Miller, PhD. Head of BioScience. April 24, 2017 ECCMID 2017 Vienna, Austria
ETX5 restoration of sulbactam activity against multidrug resistant Acinetobacter baumannii correlates with β-lactamase inhibition in vitro and in vivo Alita Miller, PhD Head of BioScience April, 07 ECCMID
More informationGene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
More informationAntimicrobial Resistance in Nontyphoidal Salmonella
780 Journal of Food Protection, Vol. 70, No. 3, 2007, Pages 780 790 Copyright, International Association for Food Protection Review Antimicrobial Resistance in Nontyphoidal Salmonella SAMUEL D. ALCAINE,
More informationComplete Nucleotide Sequence of the pctx-m3 Plasmid and Its Involvement in Spread of the Extended-Spectrum -Lactamase Gene bla CTX-M-3
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2007, p. 3789 3795 Vol. 51, No. 11 0066-4804/07/$08.00 0 doi:10.1128/aac.00457-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Complete
More informationENTEROBACTER AEROGENES UNKNOWN BACTERIA FLOW CHART UNKNOWN LAB REPORT, MICROBIOLOGY ENTEROBACTER AEROGENES
ENTEROBACTER AEROGENES UNKNOWN BACTERIA PDF UNKNOWN LAB REPORT, MICROBIOLOGY ENTEROBACTER AEROGENES IDENTIFICATION OF AN UNKNOWN BACTERIAL SPECIES OF 1 / 5 2 / 5 3 / 5 enterobacter aerogenes unknown bacteria
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More informationIdentification of emergent bla CMY-2 - carrying Proteus mirabilis lineages by whole-genome sequencing
NEW RESISTANT MICROBES IN HUMANS Identification of emergent bla CMY-2 - carrying Proteus mirabilis lineages by whole-genome sequencing M. Mac Aogáin 1, T. R. Rogers 1,2 and B. Crowley 1,2 1) Department
More informationA multicenter surveillance of antimicrobial resistance in Serratia marcescens in Taiwan
Journal of Microbiology, Immunology and Infection (2014) 47, 387e393 Available online at www.sciencedirect.com journal homepage: www.e-jmii.com ORIGINAL ARTICLE A multicenter surveillance of antimicrobial
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationCharacterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2004, p. 1 7 Vol. 70, No. 1 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.1.1 7.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Characterization
More informationMultiple acquisitions of CTX-M plasmids in the rare D 2 genotype of Escherichia coli provide evidence for convergent evolution
Microbiology (2009), 155, 1656 1668 DOI 10.1099/mic.0.023234-0 Multiple acquisitions of CTX-M plasmids in the rare D 2 genotype of Escherichia coli provide evidence for convergent evolution Catherine Deschamps,
More informationReading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing. Version 2.0 May 2012
Reading guide EUCAST disk diffusion method for antimicrobial susceptibility testing Version 2.0 May 2012 Modifications to EUCAST reading guide slide show Version Version 2.0 May 2012 Version 1.1 December
More information