The Genetic Epidemiology of Antibiotic Resistance

Size: px
Start display at page:

Download "The Genetic Epidemiology of Antibiotic Resistance"

Transcription

1 The Genetic Epidemiology of Antibiotic Resistance Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright

2 The forensics of AMR Resistance involves emergence of mutations spread of resistance genes spread of resistant strains Genes Gene carriers IS, In, Tn, plasmids Tracking and characterizing the resistant strains their resistance genes Host species Strains, clones, phylogenetic groups, virulence traits, co-resistance Patients Hospital / community setting; risk factors 2 Sydney, 20th November 2014 Crown Copyright

3 The molecular epidemiology of resistance The resistant isolates molecular methods define strains relevant to hospital epidemiology 1. inter-patient or inter-hospital spread of strains 2. identifying new strains with the same resistance 3. on a national & global scale, the strains are highly diverse Their resistance genes / elements horizontal transfer of transposons or plasmids fundamental units of resistance characterization needed for the bigger picture origins and evolution of resistance 3 Sydney, 20th November 2014 Crown Copyright

4 Can you distinguish TEM-1 from CTX-M-15? Enzyme Examples Confer resiatance to Penicilllinases ESBLs pampc TEM-1/-2, SHV-1, OXA- 1/-30 TEM-, SHV-, OXA-, CTX- M, VEB, PER CMY, ACC, DHA, FOX, MOX, ENT / EBC Penicillins; early cephalosporins; overexpression affects penicillininhibitor combinations All generation cephalosporins (not cephamycins) 3 rd gen cephs (not 4 th ); cephamycins Carbapenems remain active against producers of these enzymes and are increasingly used for treatment 4 Sydney, 20th November 2014 Crown Copyright

5 Multiple escape events for the CTX-M family K. georgiana- related CTX-M-9 group K. georgiana- related K. ascorbata- related K. ascorbata- related The most successful variant: CTX-M-15 5 Sydney, 20th November 2014 Crown Copyright

6 followed by spread and global domination 6 Sydney, 20th November 2014 Crown Copyright Hawkey and Jones. JAC 2009; 64 (Suppl. 1), i3-i10

7 Travel destination influences risk and type of resistance 7 Sydney, 20th November 2014 Crown Copyright Ostholm-Balkhed et al. JAC 2013; 68:

8 ST131 dominates among ESBL-positive E. coli 8 Sydney, 20th November 2014 Crown Copyright

9 Geom. mean MICs (mg/l), CTX-M-15 +ve E. coli Epidemic A Other CTX-M- 15 Cefotaxime Ceftazidime Pip/taz Ciprofloxacin Trimethoprim Gentamicin Amikacin Nitrofurantoin Sydney, 20th November 2014 Crown Copyright Woodford et al., JAC 2004, 54, 735

10 Disruption of ISEcp1-bla CTX-M in ST131 strain A Most strains : ISEcp1 bla CTX-M bp Strain A : ISEcp1 IS26 bla CTX-M-15 IS26 between the bla gene and its usual promoter lower cephalosporin MICs 10 Sydney, 20th November 2014 Crown Copyright

11 Bacteria don t keep resistance genes to themselves 11 Sydney, 20th November 2014 Crown Copyright

12 Neat packages of multi-resistance Antibiotic classes Aminoglycosides Genes aac6 -Ib-cr aada5 Mechanism Modify drug β-lactams bla CTX-M-15 bla OXA-1 Destroy drug bla TEM-1 Chloramphenicol catb4 Modify drug Macrolides mph(a) Efflux Fluoroquinolones aac6 -Ib-cr Modify drug Sulfonamides suli By-pass Trimethoprim dhfr XVII By-pass Tetracycline tet(a) Efflux 12 Sydney, 20th November 2014 Crown Copyright Woodford, Carattoli et al. AAC

13 IncFII plasmids are spreading CTX-M-15 globally (Canada) UK Strain D UK Strain A 13 Sydney, 20th November 2014 Crown Copyright Woodford & Carattoli, AAC, 2009: 53:

14 but not all CTX-M plasmids in ST131 confer MDR UK strain C 96 kb, IncI1 encodes CTX-M-3 and TEM-1 no other resistance genes 14 Sydney, 20th November 2014 Crown Copyright Woodford & Carattoli, unpublished

15 Closely related CTX-M ESBLs have different origins related genes usually on distinct plasmid types CTX-M-3 : IncL/M (Poland), IncA/C, IncHI2, IncI1 CTX-M-15 (Asp240Gly) : IncF (IA, IB, II) ISEcp1-bla CTX-M-3 /-15 linking sequences often vary 48-bp (CTX-M-15) or 128-bp (CTX-M-3) separate escape events, rather than mutation after escape global CTX-M-15 explosion repeated mutation of bla CTX-M-3 it s horizontal plasmid spread and clonal expansion 15 Sydney, 20th November 2014 Crown Copyright

16 Putting it all together in the real world: ESBLs in nursing homes in Northern Ireland 40% patients colonized 134 / 135 isolates phylogenetic group B2, ST131 1) Strain spread: Strain A with CTX-M-15 on IncFII/FIA plasmid pek499 2) Plasmid spread: 3 strains with IncI1 plasmids (pek204-like) 3) Gene / Transposon spread: CTX-M-3 encoded by IncI1, IncFIA-B, IncN, and IncY plasmids 16 Sydney, 20th November 2014 Crown Copyright

17 Transposition has facilitated spread of bla CTX-M-3 to other plasmids ISEcp1-mediated mobilization of: bla CTX-M-3 only bla CTX-M-3 and bla TEM-1 Latter structure is identical to structures on IncFIA, IncFIA-FIB, IncN and IncY plasmids in Belfast 17 Sydney, 20th November 2014 Crown Copyright Dhanji et al. JAC 2011; 66:

18 Hospital antibiotic sales (kg; IMS data) 3000 Carbapenems use of carbapenems new selective pressures..., but what consequences? 18 Sydney, 20th November 2014 Crown Copyright

19 Acquired carbapenemases Class Carbapenemase Enterobacteriaceae Non-fermenters A (non-metallo) KPC BIC, GES, IMI, NMC, SME + +/- B (metallo) IMP*, VIM* NDM AIM, DIM, GIM, SIM, SPM, TMB - ++ D (non-metallo) OXA-48-like +++ +/- OXA-23, -40, -58, -143, /- +++ IMP- & VIM- types are integron-associated IMP-types described first, but have been overtaken by other types 19 Sydney, 20th November 2014 Crown Copyright

20 Strain dynamics: a dominant international KPC +ve K. pneumoniae clone, but... ST258 ST258 ST258 One KPC outbreak: 11, 25, , (258 - Col-R) , 491 plus Enterobacter + E. coli 20 Sydney, 20th November 2014 Crown Copyright Nordmann et al. TLID 2009; 9:

21 A KPC cluster: spread of strains and plasmids Isolate Patient Bacterial ID VNTR profile KPC Plasmid n=6 A, B, C, D, E, H K. pneumoniae 6, 4, 2, 0, -, 2, 2, 3, 1 pkpqil-d2 3 C E. cloacae n.a. pkpqil-d2 7 F Klebsiella oxytoca n.a. pkpqil-d2 8 G Citrobacter freundii n.a. Not pkpqil-like* 9 G K. pneumoniae 1, -, 4, 1, -, 1, 3, 5, 1 Not pkpqil-like* Patients A, B, C, D, E & H spread of the same K. pneumoniae strain Patients C and F spread of pkpqil plasmid into two other species Patient G Separate introduction (distinct strains and plasmids) 21 Sydney, 20th November 2014 Crown Copyright

22 International plasmid epidemic : OXA-48 in Klebsiella, Enterobacter and E. coli OXA-181 (c. 7kb) OXA-48 (c. 62 kb) OXA Sydney, 20th November 2014 Crown Copyright

23 OXA-48 and its known relatives: (ex-shewanella spp.) OXA Shewanella piezotolerans WP3 OXA Shewanella baltica OS223 OXA Shewanella putrefaciens CN-32 OXA-181 Shewanella xiamenensis S12 OXA-163 OXA-48 OXA-162 OXA-54 Shewanella oneidensis MR-1 OXA-55 Shewanella algae KB-1 OXA Shewanella loihica PV-4 OXA Shewanella pealeana ATCC OXA Shewanella halifaxensis HAW-EB4 A 23 Gram-negative Sydney, 20th November genus 2014 isolated Crown Copyright from lake sediments

24 All this yet we still can t answer some questions H H E. coli K. pneumoniae E. coli + K. pneumoniae, same patient similar NDM plasmids Do they indicate: transfer in the patient, or that patient was colonized by two strains already possessing related plasmids? 24 Sydney, 20th November 2014 Crown Copyright

25 Whole genome sequencing and resistance prediction Will it solve our problems, or just create new ones? Need an iterative catalogue of all resistance determinants By species? Need algorithm(s) for fast processing Will need high sensitivity and specificity low numbers of very major errors (resistant, but no R gene found so called susceptible) and major errors (susceptible, but R gene found and so called resistant) Will need to be validated to be equivalent or superior to routine susceptibility testing 25 Sydney, 20th November 2014 Crown Copyright

26 Concordance of genotypic vs. phenotypic antibiograms for E. coli (n=74) 26 Sydney, 20th November 2014 Crown Copyright J. Antimicrob. Chemother. (2013)

27 Can WGS eventually (ever?) replace some AST? All rapid tests for mechanisms = surrogates for rapid AST Absence of a resistance mechanism doesn t confirm susceptibility cannot indicate appropriate empiric therapy Presence of a resistance mechanism used to infer likely resistance indicates potentially inappropriate empiric therapy (Confirming susceptibility = prime criterion for appropriate therapy) Challenge is to replace surveillance in e.g. surveys first Likely to be problematic antibiotic classes with poor concordance 27 Sydney, 20th November 2014 Crown Copyright

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD

By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)

More information

Resistance to third-generation cephalosporins in human non-typhoidal Salmonella enterica isolates from England and Wales,

Resistance to third-generation cephalosporins in human non-typhoidal Salmonella enterica isolates from England and Wales, Royal College of Surgeons in Ireland e-publications@rcsi Clinical Microbiology Articles Department of Clinical Microbiology 1-4-2014 Resistance to third-generation cephalosporins in human non-typhoidal

More information

Antibiotic Resistance in Enterobacteriaceae

Antibiotic Resistance in Enterobacteriaceae Antibiotic Resistance in Enterobacteriaceae Prof. P. Nordmann 16 es JNI, Nancy, du 10 au 12 juin 2015 1 16 es JNI, Nancy, du 10 au 12 juin 2015 16 es JNI, Nancy, du 10 au 12 juin 2015 16 es JNI, Nancy,

More information

Why the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method

Why the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method Why the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method Peter Newton Medical Microbiologist Wollongong Hospital, Wollongong, NSW Where do I come from? SEALS

More information

Received 1 November 2011; returned 25 November 2011; revised 30 November 2011; accepted 1 December 2011

Received 1 November 2011; returned 25 November 2011; revised 30 November 2011; accepted 1 December 2011 J Antimicrob Chemother 2012; 67: 878 885 doi:10.1093/jac/dkr553 Advance Access publication 29 December 2011 Characterization of plasmids encoding extended-spectrum b-lactamases and their addiction systems

More information

Characteristics of Plasmids in Multi-Drug-Resistant Enterobacteriaceae Isolated during Prospective Surveillance of a Newly Opened Hospital in Iraq

Characteristics of Plasmids in Multi-Drug-Resistant Enterobacteriaceae Isolated during Prospective Surveillance of a Newly Opened Hospital in Iraq Characteristics of Plasmids in Multi-Drug-Resistant Enterobacteriaceae Isolated during Prospective Surveillance of a Newly Opened Hospital in Iraq Xiao-Zhe Huang 1 *., Jonathan G. Frye 2., Mohamad A. Chahine

More information

Phenotypic and Molecular Characteristics of Carbapenem-Non-Susceptible Enterobacteriaceae from a Teaching Hospital in Wenzhou, Southern China

Phenotypic and Molecular Characteristics of Carbapenem-Non-Susceptible Enterobacteriaceae from a Teaching Hospital in Wenzhou, Southern China Jpn. J. Infect. Dis., 66, 96-102, 2013 Original Article Phenotypic and Molecular Characteristics of Carbapenem-Non-Susceptible Enterobacteriaceae from a Teaching Hospital in Wenzhou, Southern China Tieli

More information

Ian Morrissey, 1 Samuel K. Bouchillon, 2 Meredith Hackel, 2 Douglas J. Biedenbach, 2 Stephen Hawser, 1 Daryl Hoban 2 and Robert E.

Ian Morrissey, 1 Samuel K. Bouchillon, 2 Meredith Hackel, 2 Douglas J. Biedenbach, 2 Stephen Hawser, 1 Daryl Hoban 2 and Robert E. Journal of Medical Microbiology (2014), 63, 556 561 DOI 10.1099/jmm.0.068981-0 Evaluation of the Clinical and Laboratory Standards Institute phenotypic confirmatory test to detect the presence of extended-spectrum

More information

Implementation of Public Health Surveillance of Carbapenemase- Producing Enterobacteriaceae in Victoria, Australia

Implementation of Public Health Surveillance of Carbapenemase- Producing Enterobacteriaceae in Victoria, Australia Implementation of Public Health Surveillance of Carbapenemase- Producing Enterobacteriaceae in Victoria, Australia C.R. Lane*, J. Brett, M.B. Schultz, K. Stevens, A. van Diemen, S.A. Ballard, N.L. Sherry,

More information

ESCMID Online Lecture Library

ESCMID Online Lecture Library E. coli producing extendedspectrum β lactamases Luis Martínez Martínez Dept. Molecular Biology, University of Cantabria Service of Microbiology Hosp. Univ. Marqués de Valdecilla Santander, Spain Barcelona

More information

Whole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food

Whole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food Whole genome sequencing (WGS) as a tool for monitoring purposes Henrik Hasman DTU - Food The Challenge Is to: Continue to increase the power of surveillance and diagnostic using molecular tools Develop

More information

Most common dose (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1. Maximum dose schedule (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1

Most common dose (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1. Maximum dose schedule (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 Ertapenem Rationale for the EUCAST clinical breakpoints, version 1.3 1 st June 2009 Introduction Ertapenem is a carbapenem, available only for parenteral use. Ertapenem is relevant for therapy of septicaemia,

More information

Characterization of plasmids encoding bla ESBL and surrounding genes in Spanish clinical isolates of Escherichia coli and Klebsiella pneumoniae

Characterization of plasmids encoding bla ESBL and surrounding genes in Spanish clinical isolates of Escherichia coli and Klebsiella pneumoniae Journal of Antimicrobial Chemotherapy (2009) 63, 60 66 doi:10.1093/jac/dkn453 Advance Access publication 6 November 2008 Characterization of plasmids encoding bla ESBL and surrounding genes in Spanish

More information

Two novel Salmonella genomic island 1 variants in Proteus mirabilis

Two novel Salmonella genomic island 1 variants in Proteus mirabilis AAC Accepted Manuscript Posted Online 27 April 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.00120-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Two novel Salmonella

More information

New Delhi Metallo-Beta-Lactamase- Producing Enterobacteriaceae in. South Korea Between 2010 and 2015 INTRODUCTION

New Delhi Metallo-Beta-Lactamase- Producing Enterobacteriaceae in. South Korea Between 2010 and 2015 INTRODUCTION ORIGINAL RESEARCH published: 29 March 2018 doi: 10.3389/fmicb.2018.00571 New Delhi Metallo-Beta-Lactamase- Producing Enterobacteriaceae in South Korea Between 2010 and 2015 Eun-JeongYoon 1,DaYoungKang

More information

Rapid detection of extended-spectrum ß-lactamase-producing. Enterobacteriaceae

Rapid detection of extended-spectrum ß-lactamase-producing. Enterobacteriaceae JCM Accepts, published online ahead of print on 3 July 2012 J. Clin. Microbiol. doi:10.1128/jcm.00859-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Rapid detection of extended-spectrum

More information

Gentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009

Gentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009 Gentamicin Rationale for the EUCAST clinical breakpoints, version 1.2 16 th February, 2009 Introduction The aminoglycosides are a group of naturally occurring or semi-synthetic compounds with bactericidal

More information

Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014

Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014 CODA-CERVA Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014 Vicky Jasson and Pierre Wattiau Veterinary and Agrochemical Research Centre 1 Introduction

More information

Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food

Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes

More information

Escherichia coli O26 9

Escherichia coli O26 9 15 Vero b- (ESBL) Escherichia coli O26 1 1) 1) 2) 2) 2) 2) 3) 3) 1) 1) 2) 2 3) 16 10 18 16 12 17 Vero b- (Extended-spectrum b-lactamase: ESBL) Escherichia coli O26 9 2004 6 14 16 E. coli O O26 Vero VT1

More information

Comparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK hospitals

Comparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK hospitals Journal of Antimicrobial Chemotherapy (2003) 51, 1191 1202 DOI: 10.1093/jac/dkg234 Advance Access publication 14 April 2003 Comparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK

More information

Characteristics of extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from horses

Characteristics of extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from horses Veterinary Microbiology 124 (2007) 248 255 www.elsevier.com/locate/vetmic Characteristics of extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from horses An

More information

Resistance plasmid families in Enterobacteriaceae

Resistance plasmid families in Enterobacteriaceae AAC Accepts, published online ahead of print on March 00 Antimicrob. Agents Chemother. doi:0./aac.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi: /aac

AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi: /aac AAC Accepts, published online ahead of print on 20 August 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.00614-07 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

«Minor» ESBLs T. NAASN AAS, Microbiology department (P. Nordmann) Bicêtre hospital, South Paris Medical School France CENTRE HOSPITALIER

«Minor» ESBLs T. NAASN AAS, Microbiology department (P. Nordmann) Bicêtre hospital, South Paris Medical School France CENTRE HOSPITALIER CENTRE HOSPITALIER UNIVERSITAIR E BICÊTRE «Minor» ESBLs T. NAASN AAS, Microbiology department (P. Nordmann) Bicêtre hospital, South Paris Medical School France ß-lactamases Serine b-lactamases Metallo

More information

Value of the Modified Hodge test for detection of emerging. carbapenemases in Enterobacteriaceae

Value of the Modified Hodge test for detection of emerging. carbapenemases in Enterobacteriaceae JCM Accepts, published online ahead of print on 23 November 2011 J. Clin. Microbiol. doi:10.1128/jcm.05247-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All

More information

Toronto General Hospital ANTIBIOGRAM Emergency Department January 1, December 31, 2016

Toronto General Hospital ANTIBIOGRAM Emergency Department January 1, December 31, 2016 IV (meningitis) IV (non-meningitis) (meningitis) (non-meningitis) Blood Isolates % Susceptible 644 18 36 70 78 74 59 69 75 262 100 19 64 75 100 92 54 72 78 76 68 89 86 99 Escherichia coli 153 58 30 67

More information

Characterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan

Characterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan Jpn. J. Infect. Dis., 60, 250-256, 2007 Original Article Characterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan Chien-Fang

More information

ACCEPTED. *Corresponding author. Mailing address: Faculdade de Medicina Veterinária, Av. da

ACCEPTED. *Corresponding author. Mailing address: Faculdade de Medicina Veterinária, Av. da AAC Accepts, published online ahead of print on 10 November 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.00896-08 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Detection of carbapenemase producers in Enterobacteriaceae. using a novel screening medium

Detection of carbapenemase producers in Enterobacteriaceae. using a novel screening medium JCM Accepts, published online ahead of print on 22 February 2012 J. Clin. Microbiol. doi:10.1128/jcm.06477-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Detection of carbapenemase

More information

Increasing Carbapenem-Resistant Gram-Negative Bacilli and Decreasing Metallo-β-Lactamase Producers over Eight Years from Korea

Increasing Carbapenem-Resistant Gram-Negative Bacilli and Decreasing Metallo-β-Lactamase Producers over Eight Years from Korea Brief Communication http://dx.doi.org/10.3349/ymj.2015.56.2.572 pissn: 0513-5796, eissn: 1976437 Yonsei Med J 56(2):572-577, 2015 Increasing Carbapenem-Resistant Gram-Negative Bacilli and Decreasing Metallo-β-Lactamase

More information

EUCAST Expert Rules Version 3.1. Intrinsic Resistance and Exceptional Phenotypes Tables

EUCAST Expert Rules Version 3.1. Intrinsic Resistance and Exceptional Phenotypes Tables EUCAST Expert s Version 3.1 Intrinsic Resistance and Exceptional Phenotypes Tables EUCAST Expert s version 2.0 was published on 29 October 2011(http://www.eucast.org/expert_rules). The expert rules have

More information

Genomic characteristics of NDM-producing Enterobacteriaceae in

Genomic characteristics of NDM-producing Enterobacteriaceae in AAC Accepted Manuscript Posted Online 19 October 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.01243-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 Genomic characteristics

More information

INRA, UR1282, Infectiologie Animale et Santé Publique, IASP, Nouzilly, F-37380, France 1 ;

INRA, UR1282, Infectiologie Animale et Santé Publique, IASP, Nouzilly, F-37380, France 1 ; AAC Accepts, published online ahead of print on 1 July 0 Antimicrob. Agents Chemother. doi:./aac.000- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Genetic characterization of IncI2 plasmids carrying bla CTX-M-55. spreading in both pets and food animals in China

Genetic characterization of IncI2 plasmids carrying bla CTX-M-55. spreading in both pets and food animals in China AAC Accepts, published online ahead of print on 11 March 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.02155-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Genetic

More information

MINIREVIEW. Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes. R. Bonnet*

MINIREVIEW. Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes. R. Bonnet* ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Jan. 2004, p. 1 14 Vol. 48, No. 1 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.1.1 14.2004 MINIREVIEW Growing Group of Extended-Spectrum -Lactamases: the CTX-M Enzymes

More information

Prevalence and molecular epidemiology of plasmidmediated fosfomycin resistance genes among blood and urinary Escherichia coli isolates

Prevalence and molecular epidemiology of plasmidmediated fosfomycin resistance genes among blood and urinary Escherichia coli isolates Journal of Medical Microbiology (2013), 62, 1707 1713 DOI 10.1099/jmm.0.062653-0 Prevalence and molecular epidemiology of plasmidmediated fosfomycin resistance genes among blood and urinary Escherichia

More information

REVIEW. Extended-spectrum b-lactamases and the permeability barrier

REVIEW. Extended-spectrum b-lactamases and the permeability barrier REVIEW Extended-spectrum b-lactamases and the permeability barrier L. Martínez-Martínez Service of Microbiology, University Hospital Marqués de Valdecilla, Santander, Spain ABSTRACT The outer membrane

More information

Efflux Mechanisms of Fluoroquinolones and β-lactams

Efflux Mechanisms of Fluoroquinolones and β-lactams Efflux Mechanisms of Fluoroquinolones and β-lactams Paul M. Tulkens, MD, PhD Françoise Van Bambeke, PharmD, PhD Cellular and Molecular Pharmacology Unit Catholic University of Louvain, Brussels, Belgium

More information

Expansion of Salmonella Typhimurium ST34 clone carrying multiple. resistance determinants in China

Expansion of Salmonella Typhimurium ST34 clone carrying multiple. resistance determinants in China AAC Accepts, published online ahead of print on 24 June 2013 Antimicrob. Agents Chemother. doi:10.1128/aac.01174-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Expansion

More information

Antibiotic resistance by efflux: from molecular aspects to cinical impact

Antibiotic resistance by efflux: from molecular aspects to cinical impact 16-09-2013 University of Notre-Dame, Notre Dame, IN 1 Antibiotic resistance by efflux: from molecular aspects to cinical impact Françoise Van Bambeke & Paul M. Tulkens Pharmacologie cellulaire et moléculaire

More information

Pseudomonas putida 5

Pseudomonas putida 5 Pseudomonas putida 1 1 2 1 2 1 2 14 1 8 14 12 16 1997 1 21 12 5 Pseudomonas putida 8 27 imipenemipm IPM piperacillinceftazidimeamikacin norfloxacin 27 IPM IMP blaimp P. putida blaimp 27 8 9 4 1 MIC P.

More information

Emergence of colistin resistance in Gram-negative bacteria

Emergence of colistin resistance in Gram-negative bacteria Emergence of colistin resistance in Gram-negative bacteria Youri GLUPCZYNSKI Daniel Te-Din HUANG Pierre BOGAERTS CHU UCL Namur Dinant-Godinne Clinical Microbiology Laboratory National Reference Centre

More information

BMR nouveaux antibiotiques Dubreuil, PhD, PharmD - LIRIC UMR 995 Inserm/Université Lille France

BMR nouveaux antibiotiques Dubreuil, PhD, PharmD - LIRIC UMR 995 Inserm/Université Lille France BMR nouveaux antibiotiques Dubreuil, PhD, PharmD - LIRIC UMR 995 Inserm/Université Lille France Lille Octobre 2016 Bad bugs need new drug MRSA LIRIC UMR 995 Dubreuil L S. pneumoniae SFM Mars 2016 Adverse

More information

Validation of EUCAST zone diameter breakpoints against reference broth microdilution

Validation of EUCAST zone diameter breakpoints against reference broth microdilution ORIGINAL ARTICLE BACTERIOLOGY Validation of EUCAST zone diameter breakpoints against reference broth microdilution S. Bengtsson 1, C. Bjelkenbrant 1 and G. Kahlmeter 1,2 1) Department of Clinical Microbiology,

More information

Tetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009

Tetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009 Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline

More information

Basma Mnif 1,3,4*, Hela Harhour 1,4, Jihène Jdidi 2, Faouzia Mahjoubi 1,4, Nathalie Genel 3, Guillaume Arlet 3 and Adnene Hammami 1,4

Basma Mnif 1,3,4*, Hela Harhour 1,4, Jihène Jdidi 2, Faouzia Mahjoubi 1,4, Nathalie Genel 3, Guillaume Arlet 3 and Adnene Hammami 1,4 Mnif et al. BMC Microbiology 2013, 13:147 RESEARCH ARTICLE Open Access Molecular epidemiology of extended-spectrum beta-lactamase-producing Escherichia coli in Tunisia and characterization of their virulence

More information

Nitroxoline Rationale for the NAK clinical breakpoints, version th October 2013

Nitroxoline Rationale for the NAK clinical breakpoints, version th October 2013 Nitroxoline Rationale for the NAK clinical breakpoints, version 1.0 4 th October 2013 Foreword NAK The German Antimicrobial Susceptibility Testing Committee (NAK - Nationales Antibiotika-Sensitivitätstest

More information

Epidemiology and genetics of CTX-M extended-spectrum β-lactamases in Gram-negative bacteria

Epidemiology and genetics of CTX-M extended-spectrum β-lactamases in Gram-negative bacteria Critical Reviews in Microbiology, 2013; 39(1): 79 101 ISSN 1040-841X print/issn 1549-7828 online DOI: 10.3109/1040841X.2012.691460 REVIEW ARTICLE Epidemiology and genetics of CTX-M extended-spectrum β-lactamases

More information

Comparisons of CTX-M-Producing Escherichia coli Isolates from Humans and Animals in South Korea

Comparisons of CTX-M-Producing Escherichia coli Isolates from Humans and Animals in South Korea Journal of Bacteriology and Virology 2014. Vol. 44, No. 1 p.44 51 http://dx.doi.org/10.4167/jbv.2014.44.1.44 Original Article Comparisons of CTX-M-Producing Escherichia coli Isolates from Humans and Animals

More information

Mechanisms of colistin resistance in Gram negative bacteria

Mechanisms of colistin resistance in Gram negative bacteria Mechanisms of colistin resistance in Gram negative bacteria BARON Sophie Interne en biologie médicale 2 st year PhD student Supervisor: ROLAIN Jean-Marc I. Increase of antibiotic resistance. Introduction

More information

by author ESCMID Online Lecture Library Epidemiological cutoff values (ECOFFs) and Low Level resistance Gunnar Kahlmeter

by author ESCMID Online Lecture Library Epidemiological cutoff values (ECOFFs) and Low Level resistance Gunnar Kahlmeter Epidemiological cutoff values (ECOFFs) and Low Level resistance ECCMID 2010 Gunnar Kahlmeter Sweden Gunnar.Kahlmeter@ltkronoberg.se The epidemiological cutoff value ECOFF When breakpoints fail to detect

More information

Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria

Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Unité de Pharmacologie cellulaire et moléculaire F. Van Bambeke Magic bullets need to reach their target

More information

Low intestinal colonization of Escherichia coli clone ST131 producing CTX-M-15 in Jordanian infants

Low intestinal colonization of Escherichia coli clone ST131 producing CTX-M-15 in Jordanian infants Journal of Medical Microbiology (2016), 65, 137 141 DOI 10.1099/jmm.0.000210 Low intestinal colonization of Escherichia coli clone ST131 producing CTX-M-15 in Jordanian infants E. F. Badran, 1 R. A. Qamer

More information

Zoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes

Zoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2007, p. 6686 6690 Vol. 73, No. 20 0099-2240/07/$08.00 0 doi:10.1128/aem.01054-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Zoo

More information

Three Steps to Antibiotic Resistance?

Three Steps to Antibiotic Resistance? Three Steps to Antibiotic Resistance? The Development of Tigecycline Resistance in the Gram-Negative Bacteria Escherichia coli and Salmonella typhimurium Minna-Maria Neuvonen Degree project in biology,

More information

ACCEPTED. from Poultry and Humans in Belgium and France,

ACCEPTED. from Poultry and Humans in Belgium and France, AAC Accepts, published online ahead of print on February 00 Antimicrob. Agents Chemother. doi:./aac.0-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Stability. Received for publication 1 August to be fl-lactamase-producing strains.

Stability. Received for publication 1 August to be fl-lactamase-producing strains. ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1978, p. 584-588 0066-4804/78/0013-0584$02.00/0 Copyright X) 1978 American Society for Microbiology Vol. 13, No. 4 Printed in U.S.A. Cefaclor: In Vitro Spectrum

More information

Antimicrobial Activities of Ceftazidime/Avibactam and Comparator Agents against Clinical. Bacteria Isolated from Patients with Cancer.

Antimicrobial Activities of Ceftazidime/Avibactam and Comparator Agents against Clinical. Bacteria Isolated from Patients with Cancer. AAC Accepted Manuscript Posted Online 23 January 2017 Antimicrob. Agents Chemother. doi:10.1128/aac.02106-16 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 Antimicrobial Activities

More information

Ho, PL; Yeung, MK; Lo, WU; Tse, H; Li, Z; Lai, ELY; Chow, KH; To, KK; Yam, WC

Ho, PL; Yeung, MK; Lo, WU; Tse, H; Li, Z; Lai, ELY; Chow, KH; To, KK; Yam, WC Title Author(s) Predominance of phk01-like incompatibility group FII plasmids encoding CTX-M-14 among extended-spectrum beta-lactamaseproducing Escherichia coli in Hong Kong, 1996-2008 Ho, PL; Yeung, MK;

More information

Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica

Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica Curr. Issues Mol. Biol. (2003) 5: 113-122. Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica 113 Plasmid-Mediated Antimicrobial Resistance in Salmonella enterica Alessandra Carattoli Lab.

More information

Serotype epidemiology and multidrug resistance patterns of Salmonella enterica infecting humans in Italy

Serotype epidemiology and multidrug resistance patterns of Salmonella enterica infecting humans in Italy DOI 10.1186/s13099-016-0110-8 Gut Pathogens RESEARCH Serotype epidemiology and multidrug resistance patterns of Salmonella enterica infecting humans in Italy Ilaria Frasson 1, Sabrina Bettanello 2, Ettore

More information

Why is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC

Why is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC Why is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC 2 The Innovation gap in novel classes Obscures the Discovery void 1940

More information

Title: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America

Title: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America Accepted Manuscript Title: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America Author: Diego Faccone S13-71(18)30078-X https://doi.org/101/j.jgar.018.04.011

More information

Plasmid-encoded functions compensate for the biological cost of AmpC overexpression in a clinical isolate of Salmonella typhimurium

Plasmid-encoded functions compensate for the biological cost of AmpC overexpression in a clinical isolate of Salmonella typhimurium Journal of Antimicrobial Chemotherapy (2004) 53, 964 970 DOI: 10.1093/jac/dkh240 Advance Access publication 12 May 2004 Plasmid-encoded functions compensate for the biological cost of AmpC overexpression

More information

Screening Extended-spectrum b-lactamase Production in Enterobacter cloacae and Serratia marcescens Using Antibiogram-based Methods

Screening Extended-spectrum b-lactamase Production in Enterobacter cloacae and Serratia marcescens Using Antibiogram-based Methods J Microbiol Immunol Infect 2010;43(1):26 34 Contents lists available at ScienceDirect Journal of Microbiology, Immunology and Infection Journal homepage: http://www.e-jmii.com Original Article Screening

More information

and ColE-like (both human and chicken isolates) plasmids (2, 6, 8, 9, 11, 13, 14, 16).

and ColE-like (both human and chicken isolates) plasmids (2, 6, 8, 9, 11, 13, 14, 16). AAC Accepts, published online ahead of print on 18 October 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.00866-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria

Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Antibiotic efflux pumps in eucaryotic cells: consequences for activity against intracellular bacteria Françoise Van Bambeke on behalf of J.M. Michot, C. Seral, M. Heremans, M.P. Mingeot-Leclercq, P.M.

More information

Received 5 July 2008/Returned for modification 2 September 2008/Accepted 10 October 2008

Received 5 July 2008/Returned for modification 2 September 2008/Accepted 10 October 2008 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2009, p. 519 524 Vol. 53, No. 2 0066-4804/09/$08.00 0 doi:10.1128/aac.00886-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. High Prevalence

More information

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get

More information

IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates

IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates ORIGINAL RESEARCH published: 30 September 2016 doi: 10.3389/fmicb.2016.01566 IncHI2 Plasmids Are Predominant in Antibiotic-Resistant Salmonella Isolates Wenyao Chen, Tingzi Fang, Xiujuan Zhou, Daofeng

More information

Introduction to the SNP/ND concept - Phylogeny on WGS data

Introduction to the SNP/ND concept - Phylogeny on WGS data Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny

More information

Original Article Clinical Microbiology INTRODUCTION

Original Article Clinical Microbiology INTRODUCTION Original Article Clinical Microbiology Ann Lab Med 2018;38:555-562 https://doi.org/10.3343/alm.2018.38.6.555 ISSN 2234-3806 eissn 2234-3814 Detection of mcr-1 Plasmids in Enterobacteriaceae Isolates From

More information

Reading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing

Reading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing Reading guide EUCAST disk diffusion method for antimicrobial susceptibility testing Version 4.0 June 2014 Modifications to EUCAST reading guide slide show Version Version 4.0 June 2014 Version 3.0 April

More information

Evolution of bacterial resistance to antibiotics during the last three decades

Evolution of bacterial resistance to antibiotics during the last three decades INTERNATL MICROBIOL (1998) 1:279 284 Springer-Verlag Ibérica 1998 REVIEW ARTICLE 279 Rafael Gómez-Lus Department of Microbiology, Hospital Clínico Universitario, Zaragoza, Spain Received 25 June 1998 Accepted

More information

b-lactam resistance and b-lactamase expression in clinical Stenotrophomonas maltophilia isolates having defined phylogenetic relationships

b-lactam resistance and b-lactamase expression in clinical Stenotrophomonas maltophilia isolates having defined phylogenetic relationships Journal of Antimicrobial Chemotherapy Advance Access published December 13, 2005 Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dki453 b-lactam resistance and b-lactamase expression in clinical

More information

Ceftriaxone resistant Salmonella Typhimurium Sequence Type 313 from Kenyan patients is associated with blactx-m-15 gene on a novel IncHI2 plasmid

Ceftriaxone resistant Salmonella Typhimurium Sequence Type 313 from Kenyan patients is associated with blactx-m-15 gene on a novel IncHI2 plasmid AAC Accepted Manuscript Posted Online 16 March 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.00078-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 Ceftriaxone

More information

Molecular Characterization of Antibiotic-Resistant Salmonella Isolates from Retail Meat from Markets in Northern Vietnam

Molecular Characterization of Antibiotic-Resistant Salmonella Isolates from Retail Meat from Markets in Northern Vietnam 1709 Journal of Food Protection, Vol. 75, No. 9, 2012, Pages 1709 1714 doi:10.4315/0362-028x.12-101 Copyright G, International Association for Food Protection Research Note Molecular Characterization of

More information

STUDY ABOUT ANTIBIOTIC RESISTANCE IN SERRATIA SPP. ISOLATED FROM HOSPITALIZED PATIENTS

STUDY ABOUT ANTIBIOTIC RESISTANCE IN SERRATIA SPP. ISOLATED FROM HOSPITALIZED PATIENTS Bulletin of the Transilvania University of Braşov Series VI: Medical Sciences Vol. 7 (56) No. 1-2014 STUDY ABOUT ANTIBIOTIC RESISTANCE IN SERRATIA SPP. ISOLATED FROM HOSPITALIZED PATIENTS Mihaela Elena

More information

Natural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species

Natural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species Natural Transformation Facilitates Transfer of Transposons, Integrons and Gene Cassettes between Bacterial Species Sara Domingues 1,2, Klaus Harms 2, W. Florian Fricke 3,Pål J. Johnsen 2, Gabriela J. da

More information

μ gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli gyra E. coli parc gyra parc gyra Escherichia coli E. coli E.

μ gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli gyra E. coli parc gyra parc gyra Escherichia coli E. coli E. gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli μ E. coli gyra parc gyra parc gyra parc μ μ gyra parc Key words Escherichia coli gyra parc Escherichia coli E. coli gyra

More information

Emergence of Multidrug-Resistant Salmonella enterica Serovar Typhi in Korea

Emergence of Multidrug-Resistant Salmonella enterica Serovar Typhi in Korea ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2004, p. 4130 4135 Vol. 48, No. 11 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.11.4130 4135.2004 Copyright 2004, American Society for Microbiology. All Rights

More information

Tested Against Tigecycline and Agents Commonly Used for S. maltophilia Infections. David J. Farrell 1*, Helio S. Sader 1,2. and. Ronald N.

Tested Against Tigecycline and Agents Commonly Used for S. maltophilia Infections. David J. Farrell 1*, Helio S. Sader 1,2. and. Ronald N. AAC Accepts, published online ahead of print on 5 April 2010 Antimicrob. Agents Chemother. doi:10.1128/aac.01774-09 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Research Article Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures

Research Article Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures BioMed Volume 2016, Article ID 1081536, 6 pages http://dx.doi.org/10.1155/2016/1081536 Research Article Evaluation of Verigene Blood Culture Test Systems for Rapid Identification of Positive Blood Cultures

More information

Objectives. Epidemiology of AB resistance in S. pneumoniae. Pasteur Institute (R. Vanhoof) AB resistance evaluation (MIC) & mechanisms

Objectives. Epidemiology of AB resistance in S. pneumoniae. Pasteur Institute (R. Vanhoof) AB resistance evaluation (MIC) & mechanisms Epidemiological survey of susceptibility to β-lactams, macrolides, and fluoroquinolones in a Belgian collection of Streptococcus pneumoniae isolated from patients with CAP A. Lismond, S. Carbonnelle, F.

More information

Antibiotic Resistance in Escherichia coli Iron Transport Mutants

Antibiotic Resistance in Escherichia coli Iron Transport Mutants Bowling Green State University ScholarWorks@BGSU Honors Projects Honors College Fall 12-11-2017 Antibiotic Resistance in Escherichia coli Iron Transport Mutants Madeline Brandt mbrandt@bgsu.edu Follow

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Structural and biochemical investigation of Metallo-β-lactamases; Insights into the antibiotic binding sites

Structural and biochemical investigation of Metallo-β-lactamases; Insights into the antibiotic binding sites FACULTY OF HEALTH SCIENCES DEPARTMENT OF MEDICAL BIOLOGY UNIVERSITY HOSPITAL OF NORTH NORWAY DEPARTMENT OF MICROBIOLOGY AND INFECTION CONTROL REFERENCE CENTRE FOR DETECTION OF ANTIMICROBIAL RESISTANCE

More information

Alita Miller, PhD. Head of BioScience. April 24, 2017 ECCMID 2017 Vienna, Austria

Alita Miller, PhD. Head of BioScience. April 24, 2017 ECCMID 2017 Vienna, Austria ETX5 restoration of sulbactam activity against multidrug resistant Acinetobacter baumannii correlates with β-lactamase inhibition in vitro and in vivo Alita Miller, PhD Head of BioScience April, 07 ECCMID

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Antimicrobial Resistance in Nontyphoidal Salmonella

Antimicrobial Resistance in Nontyphoidal Salmonella 780 Journal of Food Protection, Vol. 70, No. 3, 2007, Pages 780 790 Copyright, International Association for Food Protection Review Antimicrobial Resistance in Nontyphoidal Salmonella SAMUEL D. ALCAINE,

More information

Complete Nucleotide Sequence of the pctx-m3 Plasmid and Its Involvement in Spread of the Extended-Spectrum -Lactamase Gene bla CTX-M-3

Complete Nucleotide Sequence of the pctx-m3 Plasmid and Its Involvement in Spread of the Extended-Spectrum -Lactamase Gene bla CTX-M-3 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2007, p. 3789 3795 Vol. 51, No. 11 0066-4804/07/$08.00 0 doi:10.1128/aac.00457-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Complete

More information

ENTEROBACTER AEROGENES UNKNOWN BACTERIA FLOW CHART UNKNOWN LAB REPORT, MICROBIOLOGY ENTEROBACTER AEROGENES

ENTEROBACTER AEROGENES UNKNOWN BACTERIA FLOW CHART UNKNOWN LAB REPORT, MICROBIOLOGY ENTEROBACTER AEROGENES ENTEROBACTER AEROGENES UNKNOWN BACTERIA PDF UNKNOWN LAB REPORT, MICROBIOLOGY ENTEROBACTER AEROGENES IDENTIFICATION OF AN UNKNOWN BACTERIAL SPECIES OF 1 / 5 2 / 5 3 / 5 enterobacter aerogenes unknown bacteria

More information

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI

More information

Identification of emergent bla CMY-2 - carrying Proteus mirabilis lineages by whole-genome sequencing

Identification of emergent bla CMY-2 - carrying Proteus mirabilis lineages by whole-genome sequencing NEW RESISTANT MICROBES IN HUMANS Identification of emergent bla CMY-2 - carrying Proteus mirabilis lineages by whole-genome sequencing M. Mac Aogáin 1, T. R. Rogers 1,2 and B. Crowley 1,2 1) Department

More information

A multicenter surveillance of antimicrobial resistance in Serratia marcescens in Taiwan

A multicenter surveillance of antimicrobial resistance in Serratia marcescens in Taiwan Journal of Microbiology, Immunology and Infection (2014) 47, 387e393 Available online at www.sciencedirect.com journal homepage: www.e-jmii.com ORIGINAL ARTICLE A multicenter surveillance of antimicrobial

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats

Characterization of Multiple-Antimicrobial-Resistant Salmonella Serovars Isolated from Retail Meats APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2004, p. 1 7 Vol. 70, No. 1 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.1.1 7.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Characterization

More information

Multiple acquisitions of CTX-M plasmids in the rare D 2 genotype of Escherichia coli provide evidence for convergent evolution

Multiple acquisitions of CTX-M plasmids in the rare D 2 genotype of Escherichia coli provide evidence for convergent evolution Microbiology (2009), 155, 1656 1668 DOI 10.1099/mic.0.023234-0 Multiple acquisitions of CTX-M plasmids in the rare D 2 genotype of Escherichia coli provide evidence for convergent evolution Catherine Deschamps,

More information

Reading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing. Version 2.0 May 2012

Reading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing. Version 2.0 May 2012 Reading guide EUCAST disk diffusion method for antimicrobial susceptibility testing Version 2.0 May 2012 Modifications to EUCAST reading guide slide show Version Version 2.0 May 2012 Version 1.1 December

More information