Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food
|
|
- Carmel O’Brien’
- 6 years ago
- Views:
Transcription
1 Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food
2 Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes Hands-on) DNA quantification for NGS (Hands-on) Coffee.and.Library preparation ( at the movies ) Running the MiSeq (Show n tell) Computer exercises (Hands-on) Goodbye
3
4 EU RL workshop on WGS Advanced NGS on antimicrobial resistant bacteria One day the training course will consist of hands-on and theoretical teaching focusing at NGS. This training aims at introducing relevant tools for the attendees to prepare for the challenges of genomic techniques. This theme will teach you how to prepare genomic DNA from bacterial culture for DNA sequencing, give a theoretical introduction to NGS sequencing including library preparation and running the MiSeq DNA sequencer. Finally, you will also perform an exercise regarding analysis of NGS data in relation to species identification, antimicrobial resistance gene detection and plasmid typing.
5 DNA sequencing 5
6 DNA sequencing Applied Biosystems (ABI) Genetic analyser First Generation Sequencing machine (capillary Sanger sequencing) 6
7 7
8 Second generation sequencing
9 Second generation sequencing machines 454 Life Sciences (Roche) First Next Generation Sequencing machine Illumina HiSeq/GAII systems High throughput systems Ion Torrent PGM system Low/medium throughput system Illumina MiSeq system Medium throughput system 9
10 Workflow today at the clinical laboratory
11 Workflow with WGS at the clinical laboratory Didelot et al, 2012.
12 Server side Client side Raw DNA sequences Rough assembly and compression Fine assembly Identification Gene finding Comparison Summary of: What it is? Has it been seen before? How we can fight/treat? What is new/unusual? What is already known? Pathogenicity islands Virulence genes Resistance genes MLST type What is novel? Vaccine targets Virulence genes Resistance genes SNPs Google maps like view Reports Outbreaks
13 Illumina MiSeq system Medium throughput system
14 MiSeq Workflow Gram+ Analysis tools Library DNA purification DNA barcoding
15 Tutorial on MiSeq workflow MiSeq Sequencing Chemistry: ca. 20 min
16 DNA purification EasyDNA from Invitrogen
17
18 Qubit DNA quantification
19 Questions? Then to the dungeons
20 MiSeq Workflow Gram+ Analysis tools Library DNA purification DNA barcoding
21 Normal Illumina workflow
22 Video on Sample preparation
23 Simplified protocol
24 Nextera XT sample prep video Manual:
25 Nextera XT tutorial Nextera DNA Sample Prep. Kit: ca. 20 min
26 Nextera XT library workflow
27 Adapters added by PCR Index (barcode)
28 Multiplexing DNA samples Multiplexing 18 E. coli 24 S. aureus Illumina MiSeq system Medium throughput system
29 Multiplexing with Nextera XT
30 Library building
31 Library preparation movies (Login might be required)
32 How many bacteria in a library? genomes around 5-6 Mb - E. coli - Klebsiella - Salmonella 24 genomes around 3 Mb - Enterococcus - Staphylococcus - Campylobacter
33 The MiSeq principle
34 To the MiSeq Illumina MiSeq system Medium throughput system
35 NGS output Huge numbers of small fragments ( bp)
36 Data analysis of WGS data Assembled data Raw reads Single end Paired end De novo Assembly Com. Software Web tool
37 Reference vs. de novo assembly Reference assembly Known genome De novo assembly Smaller fragments (Unknown order)
38 Reference vs. de novo assembly
39 Data analysis of WGS data Assembled data Species confirmation MLST Resistance genes Virulence genes Plasmids
40 1G bases NGS Illumina PacBio Assembly pipeline 2-6 Mb Allele 1 Allele 2 Resistance Allele 3 MLST gene Outbreak profile strain SNP* Species based ID typing Allele 4 Allele 5 } ST List of genes (100% or >95%) Theoretical resistance phenotype AAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA Epidemiological Virulence Resistance AAAATAAAAAAAAAAA genes AATAAATAATAATAAA markers *SNP Single Nucleotide Polymorphism (extreme MLST)
41 Data analysis of WGS data Assembled data
42 Data analysis of WGS data Assembled data Species confirmation KmerFinder SpeciesFinder Description Breaks the genome into small 16-mers (k=16) and scans a DB of complete genomes for best match. Identifies 16S in the genome and compare to a database of 16S sequences. Output A sorted list of the number of best-matching 16-mers in a given complete genome (hits in sequence) The best hit. A TRUE value means perfect hit, a FAIL value means close match.
43 Example: KmerFinder
44 Example - KmerFinder
45 Example Resfinder VTEC O104:H4 outbreak strain
46
47 For publication in: Journal of Antimicrobial Chemotherapy Genotyping using whole-genome sequencing is a realistic alternative to surveillance based on phenotypic antimicrobial susceptibility testing Ea Zankari 1,2, Henrik Hasman 1, Rolf Sommer Kaas 1,2, Anne Mette Seyfarth 1, Yvonne Agersø 1, Ole Lund 2, Mette Voldby Larsen 2, Frank M. Aarestrup 1,# 200 isolates reduced to 197 (Salmonella, E. coli, E. faecium, E. faecalis) 3,051 individual susceptibility tests
48 Table 2. Overview of resistance genes detected in the isolates by ResFinder with an ID 98.0% Resistance gene No. of isolates (%)* S. Typhimurium (n = 49) E. coli (n = 48) E. faecalis (n = 50) E. faecium (n = 50) Aminoglycoside str 0 (0) 0 (0) 5 (10.0) 1 (2.0) ant(6)-ia 0 (0) 0 (0) 18 (36.0) 18 (36.0) ant(6')-ii 0 (0) 0 (0) 0 (0) 49 (98.0) aph(3')-ia 2 (4.1) 2 (4.2) 0 (0) 0 (0) aph(3')-ic 2 (4.1) 0 (0) 0 (0) 0 (0) aph(3')-iii 0 (0) 0 (0) 17 (34.0) 10 (20.0) aac(6')-aph(2'') 0 (0) 0 (0) 10 (20.0) 0 (0) stra/strb 19 (38.8) 10 (20.8) 0 (0) 0 (0) aada1 5 (10.2) 19 (39.6) 0 (0) 0 (0) aada2 2 (4.1) 4 (8.3) 0 (0) 0 (0) Gene blatem-1 blactx-m-14 blacarb-2 Salmonella 21 (42.9%) 0 (0%) 1 (2.1%) E. Coli 12 (25.0%) 1 (2.1%) 2 (4.1%) aada4 0 (0) 1 (2.1) 0 (0) 0 (0) aada13 1 (2.0) 0 (0) 0 (0) 0 (0) Beta-lactam pbp5 0 (0) 0 (0) 0 (0) 49 (98.0) blatem-1 21 (42.9) 12 (25.0) 0 (0) 0 (0) blatem (0) 1 (2.1) 0 (0) 0 (0) blactx-m-14 0 (0) 1 (2.1) 0 (0) 0 (0) blacarb-2 2 (4.1) 0 (0) 0 (0) 0 (0) MLS erm(b) 0 (0) 1 (2.1) 25 (50.0) 15 (30.0) Isa(A) 0 (0) 0 (0) 50 (100.0) 0 (0) Inu(B) 0 (0) 0 (0) 11 (22.0) 15 (30.0) msr(c) 0 (0) 0 (0) 0 (0) 44 (88.0) mph(a) 0 (0) 1 (2.1) 0 (0) 0 (0) Phenicol cata1 0 (0) 2 (4.2) 0 (0) 0 (0) flor 2 (4.1) 0 (0) 0 (0) 0 (0) cmla1 0 (0) 3 (6.3) 0 (0) 0 (0) cat(pc194) 0 (0) 0 (0) 0 (0) 1 (2.0) Sulphonamide sul1 9 (18.4) 8 (16.7) 0 (0) 0 (0) sul2 20 (40.8) 7 (14.6) 0 (0) 0 (0) sul3 0 (0) 3 (6.3) 0 (0) 0 (0) Tetracycline tet(a) 1 (2.0) 11 (22.9) 0 (0) 0 (0) tet(b) 19 (38.8) 4 (8.3) 0 (0) 0 (0) tet(g) 2 (4.1) 0 (0) 0 (0) 0 (0) tet(m) 0 (0) 0 (0) 34 (68.0) 27 (54.0) tet(l) 0 (0) 0 (0) 24 (48.0) 5 (10.0) tet(s) 0 (0) 0 (0) 0 (0) 1 (2.0) tet(o) 0 (0) 0 (0) 0 (0) 1 (2.0) Trimethoprim dfra1 1 (2.0) 9 (18.8) 0 (0) 0 (0) dfra12 0 (0) 2 (4.2) 0 (0) 0 (0) dfra14 1 (2.0) 0 (0) 0 (0) 0 (0) dfra21 0 (0) 1 (2.1) 0 (0) 0 (0) dfrd 0 (0) 0 (0) 0 (0) 1 (2.0) dfrg 0 (0) 0 (0) 17 (34.0) 0 (0) Glycopeptide Van-A 0 (0) 0 (0) 0 (0) 1 (2.0) MLS, Macrolide-Lincosamide-StreptograminB, *, Per cent resistance genes was determined by dividing the number of isolates harbouring the gene by the total number of isolates (per species).
49 Phenotypic Resistant Susceptible Predicted resistant Predicted susceptible % concordance retest Phenotypic Resistant Susceptible Resistant Susceptible % concordance Spectinomycin in E. coli
50 Example: VirulenceFinder
51
52 Plasmid markers
53 Assembled genome/contigs Gram negative plasmids 100% 454 single end reads 454 paired end reads Illumina Gram 98% positive single end plasmids reads Illumina 95% paired end reads Ion Torrent 90% SOLiD single end reads 85% SOLiD paired end reads SOLiD mate pair reads incf plasmid
54 PlasmidFinder
55 Workflow with WGS at the clinical laboratory 4-6 hours Modified from Didelot et al., 2012.
56 E. coli in Urine samples A: ATCC 8739 reference SNP tree ST597 ST597 ST409 ST409 ST227 ST227 _d = Direct sequencing on urine _i = sequencing of isolate from urine
57 Strain KmerFinder SpeciesFinder ResFinder VirulenceFinder PlasmidFinder C751 24_ E64 Skejby2
Whole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) as a tool for monitoring purposes Henrik Hasman DTU - Food The Challenge Is to: Continue to increase the power of surveillance and diagnostic using molecular tools Develop
More informationAlternative tools for phylogeny. Identification of unique core sequences
Alternative tools for phylogeny Identification of unique core sequences Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture you should be able to account
More informationIntroduction to the SNP/ND concept - Phylogeny on WGS data
Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny
More informationWhole Genome based Phylogeny
Whole Genome based Phylogeny Johanne Ahrenfeldt PhD student DTU Bioinformatics Short about me Johanne Ahrenfeldt johah@dtu.dk PhD student at DTU Bioinformatics Whole Genome based Phylogeny Graduate Engineer
More informationBy Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food Supervised by Henrik Hasman, PhD
By Eliza Bielak Bacterial Genomics and Epidemiology, DTU-Food elibi@food.dtu.dk Supervised by Henrik Hasman, PhD 1. Introduction to plasmid biology 2. Plasmid encoded resistance to β- lactams (basic theories)
More informationOther tools for typing and phylogeny
Other tools for typing and phylogeny Workshop on Whole Genome Sequencing and Analysis, 27-29 Mar. 2017 Learning objective: After this lecture you should be able to account for tools for typing Salmonella
More informationAnalysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,
More informationThe Genetic Epidemiology of Antibiotic Resistance
The Genetic Epidemiology of Antibiotic Resistance Professor Neil Woodford Antimicrobial Resistance & Healthcare Associated Infections (AMRHAI) Reference Unit Crown copyright The forensics of AMR Resistance
More informationANTIMICROBIAL TESTING. E-Coli K-12 - E-Coli 0157:H7. Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis
ANTIMICROBIAL TESTING E-Coli K-12 - E-Coli 0157:H7 Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis Staphylococcus Aureus (Staph Infection MRSA) Streptococcus Pyrogenes Anti Bacteria effect
More informationOptimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 2200 TapeStation
Optimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 22 TapeStation Application Note Authors Richard Jeannotte, Eric Lee, Narine Arabyan,
More informationWhole-Genome Sequencing of Drug-Resistant Salmonella enterica Isolated from Dairy
AEM Accepted Manuscript Posted Online 7 April 2017 Appl. Environ. Microbiol. doi:10.1128/aem.00140-17 Copyright 2017 American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13
More informationTitle: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America
Accepted Manuscript Title: Emergence of azithromycin resistance mediated by mph(a) gene in Salmonella Typhimurium clinical isolates in Latin America Author: Diego Faccone S13-71(18)30078-X https://doi.org/101/j.jgar.018.04.011
More informationRead Quality Assessment & Improvement. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
Read Quality ssessment & Improvement J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Error modes Each technology has unique error modes, depending on the physico-chemical processes involved
More informationNRL-Salmonella, Hungary. National Food Chain Safety Office Food and Feed Safety Directorate Erzsébet Adrián 29 May 2018
NRL-Salmonella, Hungary National Food Chain Safety Office Food and Feed Safety Directorate Erzsébet Adrián 29 May 2018 Structure National Food Chain Safety Office Food and Feed Safety Directorate Official
More informationSatheesh Nair Salmonella Reference Service, GBRU,PHE Colindale. April 2017
Whole genome sequencing for routine identification, drug resistance detection and epidemiology of Salmonella: A revolution in public health microbiology April 2017 Satheesh Nair Salmonella Reference Service,
More informationGenotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview RJ Elshire, JC laubitz, Q Sun, JV Harriman ES Buckler, and SE Mitchell http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationComparative Genomics Background & Strategy. Faction 2
Comparative Genomics Background & Strategy Faction 2 Overview Introduction to comparative genomics Salmonella enterica subsp. enterica serovar Heidelberg Comparative Genomics Faction 2 Objectives Genomic
More informationMultivariate analysis of genetic data: an introduction
Multivariate analysis of genetic data: an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London XXIV Simposio Internacional De Estadística Bogotá, 25th July
More informationCurriculum Vitae. Farzaneh Firoozeh Assistant Professor of Microbiology
Curriculum Vitae Farzaneh Firoozeh Assistant Professor of Microbiology PERSONAL First name: Farzaneh Family name: Firoozeh Nationality: Iranian Marital status: Married OFFICE ADDRESS Department of Microbiology
More informationIntroduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationGenotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing
More informationToronto General Hospital ANTIBIOGRAM Emergency Department January 1, December 31, 2016
IV (meningitis) IV (non-meningitis) (meningitis) (non-meningitis) Blood Isolates % Susceptible 644 18 36 70 78 74 59 69 75 262 100 19 64 75 100 92 54 72 78 76 68 89 86 99 Escherichia coli 153 58 30 67
More informationIon Torrent. The chip is the machine
Ion Torrent Introduction The Ion Personal Genome Machine [PGM] is simple, more costeffective, and more scalable than any other sequencing technology. Founded in 2007 by Jonathan Rothberg. Part of Life
More informationSurvey of plasmid profiles of Shigella species isolated in Malaysia during
World Journal of Microbiology & Biotechnology (2005) 21: 271 278 Ó Springer 2005 DOI 10.1007/s11274-004-3631-0 Survey of plasmid profiles of Shigella species isolated in Malaysia during 1994 2000 C.H.
More informationHorizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
More informationNatural Genetic Resistance to Infection
Natural Genetic Resistance to Infection The Discovery of Natural Determinants of Susceptibility to Infection in Cattle, especially Tarentaise Steve A Carlson, DVM PhD Tim A Day, PhD PSR Genetics, LLC Scott
More informationRecent evolution in invasive Salmonellosis
Recent evolution in invasive Salmonellosis Professor Gordon Dougan Wellcome Trust Sanger Institute and Cambridge University 30 25 20 5 0 5 0 How does evolution deal with dogma Statements that have launched
More informationEvolution AP Biology
Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:
More informationPaired-End Read Length Lower Bounds for Genome Re-sequencing
1/11 Paired-End Read Length Lower Bounds for Genome Re-sequencing Rayan Chikhi ENS Cachan Brittany PhD student in the Symbiose team, Irisa, France 2/11 NEXT-GENERATION SEQUENCING Next-gen vs. traditional
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationHigh-throughput sequence alignment. November 9, 2017
High-throughput sequence alignment November 9, 2017 a little history human genome project #1 (many U.S. government agencies and large institute) started October 1, 1990. Goal: 10x coverage of human genome,
More informationOverview. Michelle D. Danyluk University of Florida. 4/14/14
Michelle D. Danyluk University of Florida mddanyluk@ufl.edu Overview Biological Hazards What is the pathogen of concern? Are all strains created equal? What pathogen is the most resistant to the lethal
More informationGenetic characterization of extraintestinal Escherichia coli isolates from chicken, cow and swine
https://doi.org/10.1186/s13568-018-0646-8 ORIGINAL ARTICLE Genetic characterization of extraintestinal Escherichia coli isolates from chicken, cow and swine Li Chen 1, Leyi Wang 2, Afrah Kamal Yassin 1,3,
More informationRESISTANCE TO ANTIMICROBIALS is one of the best-known examples
Acknowledgement This is a copy of an article published in the Microbial drug resistance 2004 copyright Mary Ann Liebert, Inc.; Microbial drug resistance is available online at: http://online.liebertpub.com.
More informationby author ESCMID Online Lecture Library Epidemiological cutoff values (ECOFFs) and Low Level resistance Gunnar Kahlmeter
Epidemiological cutoff values (ECOFFs) and Low Level resistance ECCMID 2010 Gunnar Kahlmeter Sweden Gunnar.Kahlmeter@ltkronoberg.se The epidemiological cutoff value ECOFF When breakpoints fail to detect
More informationEasy Illumina Nextera DNA FLEX Library Preparation using the epmotion 5075t automated liquid handler
WHITE PAPER No. 13 Easy Illumina Nextera DNA FLEX Library Preparation using the epmotion 5075t automated liquid handler Executive Summary Library preparation steps, including DNA extraction, quantification,
More informationPr oject Summar y. Funded by The Beef Checkoff
Pr oject Summar y Seasonal effects on E. coli O157:H7, multi drug-resistant Salmonella, and Listeria monocytogenes prevalence and E. coli O157:H7 and Salmonella load on hides and carcasses at cow/bull
More informationTwo novel Salmonella genomic island 1 variants in Proteus mirabilis
AAC Accepted Manuscript Posted Online 27 April 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.00120-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Two novel Salmonella
More informationBacteria Outline. 1. Overview. 2. Structural & Functional Features. 3. Taxonomy. 4. Communities
Bacteria Outline 1. Overview 2. Structural & Functional Features 3. Taxonomy 4. Communities Bacteria - Taxonomy PHYLUM CLASS ORDER FAMILY GENUS SPECIES SUB-SPECIES & STRAINS Bacteria - Phyla Firmicutes
More informationA pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa.
1 A pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa. Protozoa are single celled eukaryotic organisms. Some protozoa are pathogens.
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
More informationOutline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer
Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,
More informationMultivariate analysis of genetic data an introduction
Multivariate analysis of genetic data an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London Population genomics in Lausanne 23 Aug 2016 1/25 Outline Multivariate
More informationGenome Assembly. Sequencing Output. High Throughput Sequencing
Genome High Throughput Sequencing Sequencing Output Example applications: Sequencing a genome (DNA) Sequencing a transcriptome and gene expression studies (RNA) ChIP (chromatin immunoprecipitation) Example
More informationReceived 11 February 2010/Accepted 6 July 2010
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2010, p. 5947 5959 Vol. 76, No. 17 0099-2240/10/$12.00 doi:10.1128/aem.00377-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. The
More informationWhy the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method
Why the CDS? The unique advantages of using an Australian antimicrobial susceptibility testing method Peter Newton Medical Microbiologist Wollongong Hospital, Wollongong, NSW Where do I come from? SEALS
More informationGenomic characteristics of NDM-producing Enterobacteriaceae in
AAC Accepted Manuscript Posted Online 19 October 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.01243-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 3 Genomic characteristics
More informationDEVELOP YOUR LAB, YOUR WAY
Technical brochure DEVELOP YOUR LAB, YOUR WAY The FLOW Solution: Expand your potential today Redesign your lab with the FLOW Solution The FLOW Solution is a highly flexible modular, semi-automated data
More informationComparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK hospitals
Journal of Antimicrobial Chemotherapy (2003) 51, 1191 1202 DOI: 10.1093/jac/dkg234 Advance Access publication 14 April 2003 Comparative evaluation of the VITEK 2 Advanced Expert System (AES) in five UK
More informationMolecular Characterization of Antibiotic-Resistant Salmonella Isolates from Retail Meat from Markets in Northern Vietnam
1709 Journal of Food Protection, Vol. 75, No. 9, 2012, Pages 1709 1714 doi:10.4315/0362-028x.12-101 Copyright G, International Association for Food Protection Research Note Molecular Characterization of
More informationEUCAST Expert Rules Version 3.1. Intrinsic Resistance and Exceptional Phenotypes Tables
EUCAST Expert s Version 3.1 Intrinsic Resistance and Exceptional Phenotypes Tables EUCAST Expert s version 2.0 was published on 29 October 2011(http://www.eucast.org/expert_rules). The expert rules have
More informationGentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009
Gentamicin Rationale for the EUCAST clinical breakpoints, version 1.2 16 th February, 2009 Introduction The aminoglycosides are a group of naturally occurring or semi-synthetic compounds with bactericidal
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationAutomated Illumina TruSight HLA v2 Sequencing Panel Library Preparation with the epmotion 5075t
SHORT PROTOCOL No. 41 Automated Illumina TruSight HLA v2 Sequencing Panel Library Preparation with the epmotion 5075t Introduction This protocol describes the workstation configuration and pre-programmed
More informationSupplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
More information_ + Discriminates aerobic organisms that produce catalase to degrade hydrogen peroxide into water and oxygen
Lab 11 Goals and Objectives: Catalase Test Exercise 39: Oxidation and Fermentation Tests (Catalase) Exercise 67: Staphylococci Identification (MSA & Coagulase) Exercise 68: Streptococci & Enterococci Identification
More information3M Food Safety Technical Bulletin
3M Petrifilm Aqua Enterobacteriaceae Count Plates Performance Summary 3M Petrifi lm Aqua Enterobacteriaceae (AQEB) Count Plates are sample ready media plates used in the microbial testing of bottled water.
More informationMLVA Update. Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA
MLVA Update Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA Presentation outline Status of the S. Enteritidis MLVA protocol
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationStability. Received for publication 1 August to be fl-lactamase-producing strains.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1978, p. 584-588 0066-4804/78/0013-0584$02.00/0 Copyright X) 1978 American Society for Microbiology Vol. 13, No. 4 Printed in U.S.A. Cefaclor: In Vitro Spectrum
More informationPan-genomics: theory & practice
Pan-genomics: theory & practice Michael Schatz Sept 20, 2014 GRC Assembly Workshop #gi2014 / @mike_schatz Part 1: Theory Advances in Assembly! Perfect Human Assembly First PacBio RS @ CSHL Perfect Microbes
More informationTetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009
Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline
More informationSeminar: MPS applica/ons in the forensic DNA IDen/fica/on Solu/ons Vienna, May
Seminar: MPS applica/ons in the forensic DNA workflow@human IDen/fica/on Solu/ons 2017 - Vienna, May 16 2017 Systematic Evaluation of the Early Access Applied Biosystems Precision ID Globalfiler Mixture
More information3.1: Place of collection of entomopathogenic nematode isolates : Measurement of 12 bacterial isolates 45
List of Tables 3.1: Place of collection of entomopathogenic nematode isolates... 39 3.2: Measurement of 12 bacterial isolates 45 3.3: Colony morphology of bacteria on nutrient agar 46 3.4: Colony morphology
More informationμ gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli gyra E. coli parc gyra parc gyra Escherichia coli E. coli E.
gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli μ E. coli gyra parc gyra parc gyra parc μ μ gyra parc Key words Escherichia coli gyra parc Escherichia coli E. coli gyra
More informationProduct List. - Kits & Reagents
Product List - Kits & Reagents Bacterial Pathogens Viral Pathogens Beverage Spoilage Organisms Yeast and Mold GMOs Allergens Animal Identification Veterinary Environmental Pharma DNA/RNA Extraction Additional
More informationThree Steps to Antibiotic Resistance?
Three Steps to Antibiotic Resistance? The Development of Tigecycline Resistance in the Gram-Negative Bacteria Escherichia coli and Salmonella typhimurium Minna-Maria Neuvonen Degree project in biology,
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationWorld Journal of Pharmaceutical Research SJIF Impact Factor 8.074
SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS
More informationValidation of EUCAST zone diameter breakpoints against reference broth microdilution
ORIGINAL ARTICLE BACTERIOLOGY Validation of EUCAST zone diameter breakpoints against reference broth microdilution S. Bengtsson 1, C. Bjelkenbrant 1 and G. Kahlmeter 1,2 1) Department of Clinical Microbiology,
More informationGenomeTrakr: Data Submission and Analysis
GenomeTrakr: Data Submission and Analysis Ruth Timme and Hugh Rand Center for Food Safety and Applied Nutrition U.S. Food Drug Administration IFSH Whole Genome Sequencing for Food Safety Symposium SEPTEMBER
More informationComparison of 61 E. coli genomes
Comparison of 61 E. coli genomes Center for Biological Sequence Analysis Department of Systems Biology Dave Ussery! DTU course 27105 - Comparative Genomics Oksana s 61 E. coli genomes paper! Monday, 23
More informationFei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
More informationUse of the 3M Molecular Detection System for Salmonella and Listeria spp.
Use of the 3M Molecular Detection System for Salmonella and Listeria spp. March 11, 213 Prof Steve Forsythe Pathogen Research Centre, School of Science and Technology Nottingham Trent University Clifton
More informationAdventures in Forensic DNA: Cold Hits, Familial Searches, and Mixtures
Adventures in Forensic DNA: Cold Hits, Familial Searches, and Mixtures Departments of Mathematics and Statistics Northwestern University JSM 2012, July 30, 2012 The approach of this talk Some simple conceptual
More informationDetection of multidrug-resistant Salmonella typhimurium DT104 by multiplex polymerase chain reaction
FEMS Microbiology Letters 182 (2000) 355^360 www.fems-microbiology.org Detection of multidrug-resistant Salmonella typhimurium DT104 by multiplex polymerase chain reaction Ashraf A. Khan *, Mohammed S.
More informationFriday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo
Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization
More informationDr. Jennifer Weller WORKFLOW DURING THE B3 CAMP MAKING SOLUTIONS FROM STOCKS. B3 Summer Science Camp at Olympic High School
Dr. Jennifer Weller WORKFLOW DURING THE B3 CAMP MAKING SOLUTIONS FROM STOCKS B3 Summer Science Camp at Olympic High School LAB WORKFLOW OVERVIEW Collect Samples (June 12 th ) Extract DNA from the samples
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More information3M Food Safety Technical Bulletin
3M Petrifilm Aqua Heterotrophic Count Plate Performance Summary 3M Petrifilm Aqua Heterotrophic Count (AQHC) Plates are sample ready media plates used in the microbial testing of bottled water. Each plate
More informationDesign of an Enterobacteriaceae Pan-genome Microarray Chip
Design of an Enterobacteriaceae Pan-genome Microarray Chip Oksana Lukjancenko and David W. Ussery DTU CBS 2010 2 Background Pan-genome complete collection of variuos genes located within populations at
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationReading guide. EUCAST disk diffusion method for antimicrobial susceptibility testing
Reading guide EUCAST disk diffusion method for antimicrobial susceptibility testing Version 4.0 June 2014 Modifications to EUCAST reading guide slide show Version Version 4.0 June 2014 Version 3.0 April
More informationReport: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014
CODA-CERVA Report: antimicrobial resistance in commensal E. coli from poultry, pigs, cows and veal calves. 2014 Vicky Jasson and Pierre Wattiau Veterinary and Agrochemical Research Centre 1 Introduction
More informationResistance to third-generation cephalosporins in human non-typhoidal Salmonella enterica isolates from England and Wales,
Royal College of Surgeons in Ireland e-publications@rcsi Clinical Microbiology Articles Department of Clinical Microbiology 1-4-2014 Resistance to third-generation cephalosporins in human non-typhoidal
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationCharacterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan
Jpn. J. Infect. Dis., 60, 250-256, 2007 Original Article Characterization of Class 1 Integrons and Antimicrobial Resistance in CTX-M-3-Producing Serratia marcescens Isolates from Southern Taiwan Chien-Fang
More informationResearch Article Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains Phage Type DT120 in Southern Italy
BioMed Research International Volume 2015, Article ID 265042, 8 pages http://dx.doi.org/10.1155/2015/265042 Research Article Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains
More informationSymbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype
Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Kunihiko Kaneko (Univ of Tokyo, Komaba) with Tetsuya Yomo (Osaka Univ.) experiment Akiko
More informationGenetic Organization and Distribution of Tetracycline Resistance Determinants in Clostridium perfringens
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 1996, p. 2500 2504 Vol. 40, No. 11 0066-4804/96/$04.00 0 Copyright 1996, American Society for Microbiology Genetic Organization and Distribution of Tetracycline
More informationWhy is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC
Why is it so hard to discover develop antibacterial drugs for Gram negative bacteria? Lynn L. Silver, Ph.D. LL Silver Consulting, LLC 2 The Innovation gap in novel classes Obscures the Discovery void 1940
More informationBacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria
Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Seminar presentation Pierre Barbera Supervised by:
More informationINTERPRETATION OF THE GRAM STAIN
INTERPRETATION OF THE GRAM STAIN DISCLOSURE Relevant relationships with commercial entities none Potential for conflicts of interest within this presentation none Steps taken to review and mitigate potential
More informationStructural insights into bacterial flagellar hooks similarities and specificities
Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:
More informationProduct List. - Kits & Reagents
Product List - Kits & Reagents Bacterial Pathogens Viral Pathogens Beverage Spoilage Organisms Yeast and Mold GMOs Allergens Animal Identification Veterinary Environmental Pharma DNA/RNA Extraction Additional
More information