Read Quality Assessment & Improvement. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
|
|
- Preston Hensley
- 6 years ago
- Views:
Transcription
1 Read Quality ssessment & Improvement J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
2 Error modes Each technology has unique error modes, depending on the physico-chemical processes involved in the whole sequencing life cycle (not just base-calling step).
3 Illumina 3'-end noise
4 Illumina 3'-end noise
5 Illumina 3'-end noise
6 Illumina 3'-end noise
7 Illumina 3'-end noise
8 Illumina 3'-end noise
9 Illumina 3'-end noise
10 454, Ion Torrent homopolymer runs Nucleotides are not "terminated," so homopolymer runs add bases all at the same time. n absolute level of uncertainty / noise in the fluorescence signal will have a greater proportional effect on longer homopolymer runs. I.e. 4 's vs 5 's is a 25% difference... 8 's vs 9 's is a 12% difference
11 PacBio errors C G T T G C C G T T G C G T T G C G T T G C G T T G C G T T G false peak identified true peak missed
12 The reads are (not) alright... Contaminating sequence within reads adapters Poor quality sequence substitution, indel errors Sample contamination Chimerism in library
13 dapter contamination
14 dapter contamination Older "in-line" or "homebrew" adapters can be added to one or both ends of DN library fragments. Tools like Sabre (Nik Joshi) can recognize these, separate reads into different files, and remove barcode bases.
15 dapter contamination The problem is heterogeneous fragment sizes, resulting from any of the current library preparation techniques. ll libraries will contain DN fragments of variable size.
16 dapter contamination Contamination is the result of the sequencer reading through a short read, into adapter sequence that didn't come from your sample!
17 dapter contamination Where can you find out adapter sequences? Google "github ucdavis-bioinformatics" Check Seqanswers.com Contact Illumina, PacBio, etc. for "tech notes" specifying the library prep primer / adapter sequences (not always that clear to work out). Find them in your data. Scythe "*_adapters.fa"
18 Base qualities
19 Base quality in the FSTQ format
20 FSTQ - Pop Quiz! 1. What does a quality character of ";" mean? 2. In Sanger (standard) FSTQ, which SCII character would I use to indicate that I'm absolutely sure that I'm wrong about a particular base? 3. If a particular 40 bp read from a run analyzed with Illumina Pipeline 1.6 (phred + 64) had consistent quality characters of "J", how many errors should you expect in the read?
21 FSTQ - Base order / read orientation n "F/R" pair, or "innies"
22 Back to contamination / quality issues
23 Back to contamination / quality issues
24 (side note - "file" issues) Do your FSTQ files begin and end with the same IDs? Incomplete downloads, accidental sorting, different trimming, etc. can get your forward and reverse read files out of sync with each other.
25 Sabre
26 Scythe
27 Sickle
28 File Formats FST FSTQ SFF (Standard Flowgram Format) HDF5
29 File Formats Illumina FSTQ, BM 454, Ion Torrent(?) SFF FSTQ, FST + QUL sff_extract script, Roche's GS-Tools PacBio HDF5 ("*.bas.h5") FSTQ, FST + QUL Secondary_nalysis_Results ("filtered_subreads.fastq")
30 Error Correction Illumina k-mer spectrum - based Quake CORL PacBio PBcR (Koren 2012 Nature Biotech)... in SMRT-nalysis tools
31 Error Correction (PBcR)
32 Data "grooming"
Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes
More informationHapsembler version 2.1 ( + Encore & Scarpa) Manual. Nilgun Donmez Department of Computer Science University of Toronto
Hapsembler version 2.1 ( + Encore & Scarpa) Manual Nilgun Donmez Department of Computer Science University of Toronto January 13, 2013 Contents 1 Introduction.................................. 2 2 Installation..................................
More informationCycle «Analyse de données de séquençage à haut-débit»
Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Chadi Saad CRIStAL - Équipe BONSAI - Univ Lille, CNRS, INRIA (chadi.saad@univ-lille.fr) Présentation de Sophie Gallina (source:
More informationHigh-throughput sequence alignment. November 9, 2017
High-throughput sequence alignment November 9, 2017 a little history human genome project #1 (many U.S. government agencies and large institute) started October 1, 1990. Goal: 10x coverage of human genome,
More informationGenome Assembly. Sequencing Output. High Throughput Sequencing
Genome High Throughput Sequencing Sequencing Output Example applications: Sequencing a genome (DNA) Sequencing a transcriptome and gene expression studies (RNA) ChIP (chromatin immunoprecipitation) Example
More informationIntroduction. SAMStat. QualiMap. Conclusions
Introduction SAMStat QualiMap Conclusions Introduction SAMStat QualiMap Conclusions Where are we? Why QC on mapped sequences Acknowledgment: Fernando García Alcalde The reads may look OK in QC analyses
More informationIntroduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
More informationGBS Bioinformatics Pipeline(s) Overview
GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from
More informationTranscriptional Circuitry and the Regulatory Conformation of the Genome
Transcriptional Circuitry and the Regulatory Conformation of the Genome I-CORE for Gene Regulation in Complex Human Disease. Feb. 1 st, 2015 The Hebrew University Introduction to Next-generation sequencing
More informationPredictive Genome Analysis Using Partial DNA Sequencing Data
Predictive Genome Analysis Using Partial DNA Sequencing Data Nauman Ahmed, Koen Bertels and Zaid Al-Ars Computer Engineering Lab, Delft University of Technology, Delft, The Netherlands {n.ahmed, k.l.m.bertels,
More informationHigh-throughput sequencing: Alignment and related topic
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg HTS Platforms E s ta b lis h e d p la tfo rm s Illu m in a H is e q, A B I S O L id, R o c h e 4 5 4 N e w c o m e rs
More informationGBS Bioinformatics Pipeline(s) Overview
GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Rob Elshire With supporting information from the
More informationVariant visualisation and quality control
Variant visualisation and quality control You really should be making plots! 25/06/14 Paul Theodor Pyl 1 Classical Sequencing Example DNA.BAM.VCF Aligner Variant Caller A single sample sequencing run 25/06/14
More informationPeptideProphet: Validation of Peptide Assignments to MS/MS Spectra
PeptideProphet: Validation of Peptide Assignments to MS/MS Spectra Andrew Keller Day 2 October 17, 2006 Andrew Keller Rosetta Bioinformatics, Seattle Outline Need to validate peptide assignments to MS/MS
More informationGenome Sequencing & Assembly Michael Schatz. May 2, 2013 Human Microbiome Consortium
Genome Sequencing & Assembly Michael Schatz May 2, 2013 Human Microbiome Consortium Outline 1. Assembly theory 1. Assembly by analogy 2. De Bruijn and Overlap graph 3. Coverage, read length, errors, and
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Section of Bioinformatics Department of Biostatistics and Applied Mathematics UT M. D. Anderson Cancer Center kabagg@mdanderson.org
More informationBias in RNA sequencing and what to do about it
Bias in RNA sequencing and what to do about it Walter L. (Larry) Ruzzo Computer Science and Engineering Genome Sciences University of Washington Fred Hutchinson Cancer Research Center Seattle, WA, USA
More informationTMHMM2.0 User's guide
TMHMM2.0 User's guide This program is for prediction of transmembrane helices in proteins. July 2001: TMHMM has been rated best in an independent comparison of programs for prediction of TM helices: S.
More informationSupplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation.
Supplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation. Inlets are labelled in blue, outlets are labelled in red, and static channels
More informationPractical Bioinformatics
4/24/2017 Resources Course website: http://histo.ucsf.edu/bms270/ Resources on the course website: Syllabus Papers and code (for downloading before class) Slides and transcripts (available after class)
More informationPaired-End Read Length Lower Bounds for Genome Re-sequencing
1/11 Paired-End Read Length Lower Bounds for Genome Re-sequencing Rayan Chikhi ENS Cachan Brittany PhD student in the Symbiose team, Irisa, France 2/11 NEXT-GENERATION SEQUENCING Next-gen vs. traditional
More informationDNA Barcoding and taxonomy of Glossina
DNA Barcoding and taxonomy of Glossina Dan Masiga Molecular Biology and Biotechnology Department, icipe & Johnson Ouma Trypanosomiasis Research Centre, KARI The taxonomic problem Following ~250 years of
More informationNew Contig Creation Algorithm for the de novo DNA Assembly Problem
New Contig Creation Algorithm for the de novo DNA Assembly Problem Mohammad Goodarzi Computer Science A thesis submitted in partial fulfilment of the requirements for the degree of Master of Science in
More informationHeterozygous BMN lines
Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30
More informationBloom Filters, Minhashes, and Other Random Stuff
Bloom Filters, Minhashes, and Other Random Stuff Brian Brubach University of Maryland, College Park StringBio 2018, University of Central Florida What? Probabilistic Space-efficient Fast Not exact Why?
More informationIntroduc)on to RNA- Seq Data Analysis. Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas
Introduc)on to RNA- Seq Data Analysis Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas Material: hep://)ny.cc/rnaseq Slides: hep://)ny.cc/slidesrnaseq
More informationWhole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) as a tool for monitoring purposes Henrik Hasman DTU - Food The Challenge Is to: Continue to increase the power of surveillance and diagnostic using molecular tools Develop
More informationMiss C's Weekly Forecast
Miss C's Weekly Forecast Monday Tuesday Wednesday Thursday Friday Quiz 1.3 Unit 1 Review Unit 2 Preassessment Unit 1 Self Evaluation Unit 1 TEST Lesson 8 Continued Lesson7&8 Quiz Lesson 9 Break Break Break
More informationDevyser Index Plate A. Instructions for Use
Devyser Index Plate A Art. No.: 8-A200 Instructions for Use Page 1 of 17 TABLE OF CONTENTS TABLE OF CONTENTS 2 1. INTRODUCTION TO DEVYSER INDEX PLATE A 3 1.1 Intended use 3 1.2 Kit configuration Devyser
More informationGenome Assembly Results, Protocol & Demo
Genome Assembly Results, Protocol & Demo Monday, March 7, 2016 BIOL 7210: Genome Assembly Group Aroon Chande, Cheng Chen, Alicia Francis, Alli Gombolay, Namrata Kalsi, Ellie Kim, Tyrone Lee, Wilson Martin,
More informationDNA methylome analysis using short bisulfite read data
Nature Methods DN methylome analysis using short isulfite read data Felix Krueger, Benjamin Krek, ndre Franke & Simon R ndrews Supplementary Figure : Effets of inter-onverting isulfite treated olor spae
More informationGenotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing
More informationSingle Cell Sequencing
Single Cell Sequencing Fundamental unit of life Autonomous and unique Interactive Dynamic - change over time Evolution occurs on the cellular level Robert Hooke s drawing of cork cells, 1665 Type Prokaryotes
More informationAnalysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,
More informationNew method developments in pollen DNA barcoding for forensic applica8ons
New method developments in pollen DNA barcoding for forensic applica8ons Karen Leanne Bell, Emory University Homeland Security Symposium Series, University of Texas El Paso, June 2016 1 Overview Background
More informationCOGS Q250 Fall Homework 7: Learning in Neural Networks Due: 9:00am, Friday 2nd November.
COGS Q250 Fall 2012 Homework 7: Learning in Neural Networks Due: 9:00am, Friday 2nd November. For the first two questions of the homework you will need to understand the learning algorithm using the delta
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Section of Bioinformatics Department of Biostatistics and Applied Mathematics UT M. D. Anderson Cancer Center kabagg@mdanderson.org
More informationLast updated: Copyright
Last updated: 2012-08-20 Copyright 2004-2012 plabel (v2.4) User s Manual by Bioinformatics Group, Institute of Computing Technology, Chinese Academy of Sciences Tel: 86-10-62601016 Email: zhangkun01@ict.ac.cn,
More informationAlignment-free RNA-seq workflow. Charlotte Soneson University of Zurich Brixen 2017
Alignment-free RNA-seq workflow Charlotte Soneson University of Zurich Brixen 2017 The alignment-based workflow ALIGNMENT COUNTING ANALYSIS Gene A Gene B... Gene X 7... 13............... The alignment-based
More informationOctave. Tutorial. Daniel Lamprecht. March 26, Graz University of Technology. Slides based on previous work by Ingo Holzmann
Tutorial Graz University of Technology March 26, 2012 Slides based on previous work by Ingo Holzmann Introduction What is? GNU is a high-level interactive language for numerical computations mostly compatible
More informationIon Torrent. The chip is the machine
Ion Torrent Introduction The Ion Personal Genome Machine [PGM] is simple, more costeffective, and more scalable than any other sequencing technology. Founded in 2007 by Jonathan Rothberg. Part of Life
More informationHOMEWORK 8 SOLUTIONS MATH 4753
HOMEWORK 8 SOLUTIONS MATH 4753 In this homework we will practice taking square roots of elements in F p in F p 2, and study the encoding scheme suggested by Koblitz for use in elliptic curve cryptosystems.
More informationPeptideProphet: Validation of Peptide Assignments to MS/MS Spectra. Andrew Keller
PeptideProphet: Validation of Peptide Assignments to MS/MS Spectra Andrew Keller Outline Need to validate peptide assignments to MS/MS spectra Statistical approach to validation Running PeptideProphet
More informationProbabilistic insertion, deletion and substitution error correction using Markov inference in next generation sequencing reads
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations 2016 Probabilistic insertion, deletion and substitution error correction using Markov inference in next generation
More informationGenotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview RJ Elshire, JC laubitz, Q Sun, JV Harriman ES Buckler, and SE Mitchell http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina
More informationASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support
ASTRAL: Fast coalescent-based computation of the species tree topology, branch lengths, and local branch support Siavash Mirarab University of California, San Diego Joint work with Tandy Warnow Erfan Sayyari
More informationSupplementary Material for Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation
Supplementary Material for Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation Raw assemblies and polished results at http://gembox.cbcb.umd.edu/shared/canu/index.html
More informationRecap. CS514: Intermediate Course in Operating Systems. What time is it? This week. Reminder: Lamport s approach. But what does time mean?
CS514: Intermediate Course in Operating Systems Professor Ken Birman Vivek Vishnumurthy: TA Recap We ve started a process of isolating questions that arise in big systems Tease out an abstract issue Treat
More informationAssembly improvement: based on Ragout approach. student: Anna Lioznova scientific advisor: Son Pham
Assembly improvement: based on Ragout approach student: Anna Lioznova scientific advisor: Son Pham Plan Ragout overview Datasets Assembly improvements Quality overlap graph paired-end reads Coverage Plan
More informationExplore SNP polymorphism data. A. Dereeper, Y. Hueber
Explore SNP polymorphism data A. Dereeper, Y. Hueber Bioinformatics trainings, Supagro, February, 2016 Tablet Graphical tool to visualize assemblies Accept many formats ACE, SAM, BAM GATK (Genome Analysis
More informationOverview - MS Proteomics in One Slide. MS masses of peptides. MS/MS fragments of a peptide. Results! Match to sequence database
Overview - MS Proteomics in One Slide Obtain protein Digest into peptides Acquire spectra in mass spectrometer MS masses of peptides MS/MS fragments of a peptide Results! Match to sequence database 2 But
More informationQuantitative Bioinformatics
Chapter 9 Class Notes Signals in DNA 9.1. The Biological Problem: since proteins cannot read, how do they recognize nucleotides such as A, C, G, T? Although only approximate, proteins actually recognize
More informationComputational Genetics Winter 2013 Lecture 10. Eleazar Eskin University of California, Los Angeles
Computational Genetics Winter 2013 Lecture 10 Eleazar Eskin University of California, Los ngeles Pair End Sequencing Lecture 10. February 20th, 2013 (Slides from Ben Raphael) Chromosome Painting: Normal
More informationWhole Genome Alignments and Synteny Maps
Whole Genome Alignments and Synteny Maps IINTRODUCTION It was not until closely related organism genomes have been sequenced that people start to think about aligning genomes and chromosomes instead of
More informationPython Tutorial on Reading in & Manipulating Fits Images and Creating Image Masks (with brief introduction on DS9)
1 Tyler James Metivier Professor Whitaker Undergrad. Research February 26, 2017 Python Tutorial on Reading in & Manipulating Fits Images and Creating Image Masks (with brief introduction on DS9) Abstract:
More informationMarkov Chains and Hidden Markov Models. = stochastic, generative models
Markov Chains and Hidden Markov Models = stochastic, generative models (Drawing heavily from Durbin et al., Biological Sequence Analysis) BCH339N Systems Biology / Bioinformatics Spring 2016 Edward Marcotte,
More informationThe SUNRISE on the sunflower genome sequence
The SUNRISE on the sunflower genome sequence Stéphane Muños Baptiste Mayjonade: molecular biology Jérôme Gouzy: bioinformatics stephane.munos@toulouse.inra.fr ANR-11-BTBR-0005 Toulouse: a unique place
More informationFei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
More informationProbabilistic methods for quality improvement in high-throughput sequencing data
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations 2016 Probabilistic methods for quality improvement in high-throughput sequencing data Xin Yin Iowa State University
More informationGrundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
More information1 Introduction. command intended for command prompt
Guest Lecture, Smith College, CS 334, BioInformatics 21 October 2008 GROMACS, Position Restrained MD, Protein Catalytic Activity Filip Jagodzinski 1 Introduction GROMACS (GROningen MAchine for Chemistry
More informationAssembly and Repeats: An Epic Struggle
Assembly and Repeats: An Epic Struggle Towards efficient assemblers for reference quality, de novo reconstructions MPI CBG Gene Myers Tschira Chair of Systems Biology MPI for Cell Biology and Genetics
More informationPyrobayes: an improved base caller for SNP discovery in pyrosequences
Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The
More informationAlgorithmics and Bioinformatics
Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32
More informationCentrifuge: rapid and sensitive classification of metagenomic sequences
Centrifuge: rapid and sensitive classification of metagenomic sequences Daehwan Kim, Li Song, Florian P. Breitwieser, and Steven L. Salzberg Supplementary Material Supplementary Table 1 Supplementary Note
More information#33 - Genomics 11/09/07
BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33
More informationPysolar Documentation
Pysolar Documentation Release 0.7 Brandon Stafford Mar 30, 2018 Contents 1 Difference from PyEphem 3 2 Difference from Sunpy 5 3 Prerequisites for use 7 4 Examples 9 4.1 Location calculation...........................................
More informationGenome sequence of Plasmopara viticola and insight into the pathogenic mechanism
Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism Ling Yin 1,3,, Yunhe An 1,2,, Junjie Qu 3,, Xinlong Li 1, Yali Zhang 1, Ian Dry 5, Huijun Wu 2*, Jiang Lu 1,4** 1 College
More informationIntroduction to PLINK H3ABionet Course Covenant University, Nigeria
UNIVERSITY OF THE WITWATERSRAND, JOHANNESBURG Introduction to PLINK H3ABionet Course Covenant University, Nigeria Scott Hazelhurst H3ABioNet funded by NHGRI grant number U41HG006941 Wits Bioinformatics
More informationPhyQuart-A new algorithm to avoid systematic bias & phylogenetic incongruence
PhyQuart-A new algorithm to avoid systematic bias & phylogenetic incongruence Are directed quartets the key for more reliable supertrees? Patrick Kück Department of Life Science, Vertebrates Division,
More informationSTRUCTURAL BIOINFORMATICS I. Fall 2015
STRUCTURAL BIOINFORMATICS I Fall 2015 Info Course Number - Classification: Biology 5411 Class Schedule: Monday 5:30-7:50 PM, SERC Room 456 (4 th floor) Instructors: Vincenzo Carnevale - SERC, Room 704C;
More informationOverview of IslandPick pipeline and the generation of GI datasets
Overview of IslandPick pipeline and the generation of GI datasets Predicting GIs using comparative genomics By using whole genome alignments we can identify regions that are present in one genome but not
More informationWhole-genome amplification in doubledigest RADseq results in adequate libraries but fewer sequenced loci
Whole-genome amplification in doubledigest RADseq results in adequate libraries but fewer sequenced loci Bruno A. S. de Medeiros and Brian D. Farrell Department of Organismic and Evolutionary Biology and
More informationGuidelines: Numerical Data CAMS
Guidelines: Numerical Data CAMS Issued by: METEO FRANCE Date: 07/09/2017 Summary : The aim of the user guide of Regional Air Quality data production is to give a general description of CAMS production
More informationNJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees
NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Erin Molloy and Tandy Warnow {emolloy2, warnow}@illinois.edu University of Illinois at Urbana
More informationCISC 889 Bioinformatics (Spring 2004) Hidden Markov Models (II)
CISC 889 Bioinformatics (Spring 24) Hidden Markov Models (II) a. Likelihood: forward algorithm b. Decoding: Viterbi algorithm c. Model building: Baum-Welch algorithm Viterbi training Hidden Markov models
More informationEmpirical Bayes Moderation of Asymptotically Linear Parameters
Empirical Bayes Moderation of Asymptotically Linear Parameters Nima Hejazi Division of Biostatistics University of California, Berkeley stat.berkeley.edu/~nhejazi nimahejazi.org twitter/@nshejazi github/nhejazi
More informationPNW ShakeAlert overview
PNW ShakeAlert overview Past and expected performance of ElarmS-2 algorithm Bottom line should work for all events close enough and big enough to cause damage. But we will do more extensive testing to
More informationSupplementary Figure 1 The number of differentially expressed genes for uniparental males (green), uniparental females (yellow), biparental males
Supplementary Figure 1 The number of differentially expressed genes for males (green), females (yellow), males (red), and females (blue) in caring vs. control comparisons in the caring gene set and the
More informationGenomic characterisation of Australian wild rice species
Genomic characterisation of Australian wild rice species Marta Katarzyna Brozynska MSc of Biotechnology A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2016
More informationThe applicability of next-generation sequencing to native plant materials development
The applicability of next-generation sequencing to native plant materials development Rob Massatti, USGS-Southwest Biological Science Center Flagstaff, AZ Michael Luth www.blackfootnativeplants.com Next-generation
More informationRepeat resolution. This exposition is based on the following sources, which are all recommended reading:
Repeat resolution This exposition is based on the following sources, which are all recommended reading: 1. Separation of nearly identical repeats in shotgun assemblies using defined nucleotide positions,
More informationUsing Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics
Using Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics Tandy Warnow Founder Professor of Engineering The University of Illinois at Urbana-Champaign http://tandy.cs.illinois.edu
More informationChapter 9 Chemical Names And Formulas Quiz Answers
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with chapter 9 chemical names
More informationPolarSync Quick Start
PolarSync Quick Start Installation and Use In this Quick Start guide, we will cover installing the PolarSync program and using it as a teacher, student or guest. I. Installing PolarSync... 1 II. Teacher
More informationHow s that *new* LOD Coming? Rick Mealy WWOA Board of Directors DNR LabCert
How s that *new* LOD Coming? Rick Mealy WWOA Board of Directors DNR LabCert The LOD Procedure has changed Federal Register /Vol. 82, No. 165 /Monday, August 28, 2017 ACTION: Final rule. DATES: This regulation
More informationGenomeTrakr: Data Submission and Analysis
GenomeTrakr: Data Submission and Analysis Ruth Timme and Hugh Rand Center for Food Safety and Applied Nutrition U.S. Food Drug Administration IFSH Whole Genome Sequencing for Food Safety Symposium SEPTEMBER
More informationIntroduction to Google Drive Objectives:
Introduction to Google Drive Objectives: Learn how to access your Google Drive account Learn to create new documents using Google Drive Upload files to store on Google Drive Share files and folders with
More informationDecision Tree Learning
Topics Decision Tree Learning Sattiraju Prabhakar CS898O: DTL Wichita State University What are decision trees? How do we use them? New Learning Task ID3 Algorithm Weka Demo C4.5 Algorithm Weka Demo Implementation
More informationSolving Multi-Step Linear Equations (page 3 and 4)
Solving Multi-Step Linear Equations (page 3 and 4) Sections: Multi-step equations, "No solution" and "all x" equations Most linear equations require more than one step for their solution. For instance:
More informationValidation of two ribosomal RNA removal methods for microbial metatranscriptomics
Nature Methods Validation of two ribosomal RNA removal methods for microbial metatranscriptomics Shaomei He 1,2,5, Omri Wurtzel 3,5, Kanwar Singh 1, Jeff L Froula 1, Suzan Yilmaz 1, Susannah G Tringe 1,
More informationPrac%cal Bioinforma%cs for Life Scien%sts. Week 14, Lecture 28. István Albert Bioinforma%cs Consul%ng Center Penn State
Prac%cal Bioinforma%cs for Life Scien%sts Week 14, Lecture 28 István Albert Bioinforma%cs Consul%ng Center Penn State Final project A group of researchers are interested in studying protein binding loca%ons
More informationProblem Set 2. MAS 622J/1.126J: Pattern Recognition and Analysis. Due: 5:00 p.m. on September 30
Problem Set 2 MAS 622J/1.126J: Pattern Recognition and Analysis Due: 5:00 p.m. on September 30 [Note: All instructions to plot data or write a program should be carried out using Matlab. In order to maintain
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationEvaluation of the Number of Different Genomes on Medium and Identification of Known Genomes Using Composition Spectra Approach.
Evaluation of the Number of Different Genomes on Medium and Identification of Known Genomes Using Composition Spectra Approach Valery Kirzhner *1 & Zeev Volkovich 2 1 Institute of Evolution, University
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Lecture : p he biological problem p lobal alignment p Local alignment p Multiple alignment 6 Background: comparative genomics p Basic question in biology: what properties
More informationMass Spectrometry and Proteomics - Lecture 5 - Matthias Trost Newcastle University
Mass Spectrometry and Proteomics - Lecture 5 - Matthias Trost Newcastle University matthias.trost@ncl.ac.uk Previously Proteomics Sample prep 144 Lecture 5 Quantitation techniques Search Algorithms Proteomics
More informationProbabilistic Arithmetic Automata
Probabilistic Arithmetic Automata Applications of a Stochastic Computational Framework in Biological Sequence Analysis Inke Herms PhD thesis defense Overview 1 Probabilistic Arithmetic Automata 2 Application
More informationA. Incorrect! This inequality is a disjunction and has a solution set shaded outside the boundary points.
Problem Solving Drill 11: Absolute Value Inequalities Question No. 1 of 10 Question 1. Which inequality has the solution set shown in the graph? Question #01 (A) x + 6 > 1 (B) x + 6 < 1 (C) x + 6 1 (D)
More informationTechnologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA
Technologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA Expression analysis for RNA-seq data Ewa Szczurek Instytut Informatyki Uniwersytet Warszawski 1/35 The problem
More information