Alignment-free RNA-seq workflow. Charlotte Soneson University of Zurich Brixen 2017
|
|
- Lily Harmon
- 5 years ago
- Views:
Transcription
1 Alignment-free RNA-seq workflow Charlotte Soneson University of Zurich Brixen 2017
2 The alignment-based workflow ALIGNMENT COUNTING ANALYSIS Gene A Gene B... Gene X
3 The alignment-based workflow slow unnecessary? ALIGNMENT COUNTING inaccurate? doesn t account for all uncertainty in abundance estimates ANALYSIS Gene A Gene B... Gene X
4 The alignment-based workflow slow unnecessary? ALIGNMENT COUNTING inaccurate? doesn t account for all uncertainty in abundance estimates ANALYSIS Gene A Gene B... Gene X
5 Impact of differential isoform usage on gene-level counts T1 length = L T2 length = 2L sample 1 sample 2
6 Impact of differential isoform usage on gene-level counts T1 length = L T2 length = 2L sample 1 sample 2
7 Impact of differential isoform usage on gene-level counts T1 length = L T2 length = 2L Gene sample 1 sample reads 150 reads
8 Impact of differential isoform usage on gene-level counts T1 length = L T2 length = 2L Gene sample 1 sample 2 Gene S1 S2 Count reads 150 reads
9 Impact of differential isoform usage on gene-level counts true abundance condition A condition B TPM 10 5 Lengths: isoform 1: 12'232 bp isoform 2: 1'733 bp isoform 3: 891 bp isoform 4: 1'404 bp isoform 5: 543 bp 0 condition 2 isoform 1 isoform 2 isoform 3 isoform 4 isoform 5
10 Impact of differential isoform usage on gene-level counts read count condition A condition B COUNT Lengths: isoform 1: 12'232 bp isoform 2: 1'733 bp isoform 3: 891 bp isoform 4: 1'404 bp isoform 5: 543 bp 0 condition 1 condition 2 isoform 1 isoform 2 isoform 3 isoform 4 isoform 5
11 The isoform composition affects the observed read count for a gene Differential isoform usage* can lead to false positives and false negatives in differential gene expression analyses *differences in isoform composition between groups
12 What can we do? Consider another abundance unit that better reflects the underlying abundances ( number of transcript molecules ) Include adjustment of gene counts to reflect underlying isoform composition
13 What can we do? How can we get such values? Are they any good? Consider another abundance unit that better reflects the underlying abundances ( number of transcript molecules ) Include adjustment of gene counts to reflect underlying isoform composition How could such adjustment be done?
14 What can we do? Consider another abundance unit that better reflects the underlying abundances ( number of transcript molecules ) Include adjustment of gene counts to reflect underlying isoform composition How can we get such values? How could such adjustment be done? Are they any good? We need transcript-level information!
15 Abundance units read count for transcript i c i t i = c ir `i TPM i = 10 6 RP KM i = 10 9 fragment length t i P k t k c i `i P k c k library size library size = 10 9 P t i k (t k`k) `i length of transcript i TPM X i / RP KM i TPM i = 10 6 i
16 Abundance units read count for transcript i c i t i = c ir `i TPM i = 10 6 RP KM i = 10 9 fragment length t i P k t k c i `i P k c k library size library size = 10 9 P t i k (t k`k) `i length of transcript i TPM X i / RP KM i TPM i = 10 6 i
17 Abundance units read count for transcript i c i t i = c ir `i TPM i = 10 6 fragment length RP KM i = 10 9 t i P k t k c i `i P k c k library size = 10 9 P t i `i length of transcript i TPM X i / RP KM i TPM i = 10 6 i k (t k`k)
18 Abundance units read count for transcript i c i t i = c ir `i TPM i = 10 6 fragment length RP KM i = 10 9 t i P k t k c i `i P k c k library size = 10 9 P t i `i length of transcript i TPM X i / RP KM i TPM i = 10 6 i k (t k`k)
19 Abundance units read count for transcript i c i t i = c ir `i TPM i = 10 6 fragment length RP KM i = 10 9 t i P k t k c i `i P k c k library size = 10 9 P t i `i length of transcript i TPM X i / RP KM i TPM i = 10 6 i k (t k`k)
20 Average transcript lengths Similar to correction factors for library size, but sampleand gene-specific Weighted average of transcript lengths, weighted by estimated abundances (TPMs) Average transcript length for gene g in sample s: AT L gs = X i2g is `is, X i2g is =1 `is =e ective length of isoform i (in sample s) is = relative abundance of isoform i in sample s
21 Average transcript lengths T1 length = L T2 length = 2L AT L g1 =1 L +0 2L = L AT L g2 =0 L +1 2L =2L
22 Average transcript lengths T1 length = L T2 length = 2L AT L g1 =0.75 L L =1.25L AT L g2 =0.5 L L =1.5L
23 Average transcript lengths T1 length = L T2 length = 2L AT L g1 =0.75 L L =1.25L AT L g2 =0.5 L L =1.5L weights obtained from transcript TPM estimates
24 The alignment-based workflow ALIGNMENT COUNTING ANALYSIS Gene A Gene B... Gene X
25 The alignment-free workflow MAPPING ESTIMATION ANALYSIS Gene A Gene B... Gene X
26 The mapping step Does not provide full alignment information (i.e., no exact base-by-base alignment). Rather, finds all transcripts (and positions) that a read is compatible with. Comes in various flavors: pseudoalignment (kallisto) lightweight alignment (Salmon) quasimapping (Sailfish, RapMap) Bray et al. 2016; Patro et al. 2014; Patro et al. 2017; Srivastava et al. 2016
27 Transcript-level counts
28 Transcript-level counts
29 Gene-level counts 30
30 The estimation step Input: for each read, the equivalence class of compatible transcripts Probabilistic modeling of read generation process, with transcript abundance as parameter EM algorithm Output: estimated abundance of each transcript
31 Step 1: build transcriptome index kallisto name of index $ kallisto index -i my_transcripts.idx \ my_transcripts.fasta transcriptome fasta file Salmon $ salmon index -i my_transcripts.idx \ -t my_transcripts.fasta
32 Where to find transcript fasta?
33 Step 2: quantify number of cores kallisto name of index # bootstraps $ kallisto quant -i my_transcripts.idx \ -o results/sample1 -b 30 -t 10 \ sample1_1.fastq sample1_2.fastq output folder Salmon input fastq files libtype $ salmon quant -i my_transcripts.idx -l A \ -1 sample1_1.fastq -2 sample1_2.fastq \ -p 10 -o results/sample1 \ --numbootstraps 30 --seqbias --gcbias
34 Salmon LIBTYPE argument
35 Salmon LIBTYPE argument From v 0.7: -l A (automatic determination of libtype)
36 output kallisto Salmon
37 output kallisto [abundance.tsv] Salmon [quant.sf]
38 Comparison to alignment-based workflow Salmon/kallisto are considerably faster than traditional alignment+counting -> allow bootstrapping provide more highly resolved estimates (transcripts rather than gene) - can be aggregated to gene level can use a larger fraction of the reads don t give precise alignments (for e.g. visualization in genome browser) - but avoid large alignment files
39 kallisto and Salmon gene counts overall similar SRR Salmon (log(counts + 1)) kallisto (log(counts + 1))
40 Gene-level counts mostly similar to alignment-based approach SRR Salmon (log(counts + 1)) featurecounts (log(counts + 1))
41 kallisto and Salmon can use slightly more reads Number of mapped reads 3e+07 2e+07 1e+07 0e+00 SRR SRR SRR SRR SRR SRR SRR SRR featurecounts kallisto Salmon
42 How to get the estimated values into R?
43 How to get the estimated values into R?
44 How to get the estimated values into R? TPMs counts ATL offsets
45 A word of warning Abundance estimates for lowly expressed transcripts are highly variable and should be interpreted with caution Estimated TPM True TPM Soneson, Love & Robinson, F1000 Research 2016
46 A word of warning Problematic when coverage of region defining an isoform is low Soneson, Love & Robinson, F1000 Research 2016
47 A word of warning When aggregated to the gene level, abundance estimates are less variable Estimated TPM True TPM Soneson, Love & Robinson, F1000 Research 2016
48 References Srivastava et al.: RapMap: a rapid, sensitive and accurate tool for mapping RNA-seq read to transcriptomes. Bioinformatics 32:i192-i200 (2016) - RapMap Patro et al.: Accurate, fast, and model-aware transcript expression quantification with Salmon. biorxiv dx.doi.org/ / (2015) - Salmon Bray et al.: Near-optimal probabilistic RNA-seq quantification. Nature Biotechnology 34(5): (2016) - kallisto Patro et al.: Sailfish enables alignment-free isoform quantification from RNA-seq reads using lightweight algorithms. Nature Biotechnology 32: (2014) - Sailfish Pimentel et al.: Differential analysis of RNA-Seq incorporating quantification uncertainty. biorxiv / (2016) - sleuth Wagner et al.: Measurement of mrna abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory in Biosciences 131: (2012) - TPM vs FPKM Soneson et al.: Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. F1000Research 4:1521 (2016) - ATL offsets (tximport package) Li et al.: RNA-seq gene expression estimation with read mapping uncertainty. Bioinformatics 26(4): (2010) - TPM, RSEM
New RNA-seq workflows. Charlotte Soneson University of Zurich Brixen 2016
New RNA-seq workflows Charlotte Soneson University of Zurich Brixen 2016 Wikipedia The traditional workflow ALIGNMENT COUNTING ANALYSIS Gene A Gene B... Gene X 7... 13............... The traditional workflow
More informationDifferential analyses for RNA-seq: transcript-level estimates improve gene-level inferences Supplementary Material
Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences Supplementary Material Charlotte Soneson, Michael I. Love, Mark D. Robinson Contents 1 Simulation details, sim2
More informationIsoform discovery and quantification from RNA-Seq data
Isoform discovery and quantification from RNA-Seq data C. Toffano-Nioche, T. Dayris, Y. Boursin, M. Deloger November 2016 C. Toffano-Nioche, T. Dayris, Y. Boursin, M. Isoform Deloger discovery and quantification
More informationexpress: Streaming read deconvolution and abundance estimation applied to RNA-Seq
express: Streaming read deconvolution and abundance estimation applied to RNA-Seq Adam Roberts 1 and Lior Pachter 1,2 1 Department of Computer Science, 2 Departments of Mathematics and Molecular & Cell
More informationOur typical RNA quantification pipeline
RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality
More informationSingle Cell Sequencing
Single Cell Sequencing Fundamental unit of life Autonomous and unique Interactive Dynamic - change over time Evolution occurs on the cellular level Robert Hooke s drawing of cork cells, 1665 Type Prokaryotes
More informationDEGseq: an R package for identifying differentially expressed genes from RNA-seq data
DEGseq: an R package for identifying differentially expressed genes from RNA-seq data Likun Wang Zhixing Feng i Wang iaowo Wang * and uegong Zhang * MOE Key Laboratory of Bioinformatics and Bioinformatics
More informationIntroduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
More informationUnit-free and robust detection of differential expression from RNA-Seq data
Unit-free and robust detection of differential expression from RNA-Seq data arxiv:405.4538v [stat.me] 8 May 204 Hui Jiang,2,* Department of Biostatistics, University of Michigan 2 Center for Computational
More informationThe Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy
More informationEBSeq: An R package for differential expression analysis using RNA-seq data
EBSeq: An R package for differential expression analysis using RNA-seq data Ning Leng, John Dawson, and Christina Kendziorski October 14, 2013 Contents 1 Introduction 2 2 Citing this software 2 3 The Model
More informationg A n(a, g) n(a, ḡ) = n(a) n(a, g) n(a) B n(b, g) n(a, ḡ) = n(b) n(b, g) n(b) g A,B A, B 2 RNA-seq (D) RNA mrna [3] RNA 2. 2 NGS 2 A, B NGS n(
,a) RNA-seq RNA-seq Cuffdiff, edger, DESeq Sese Jun,a) Abstract: Frequently used biological experiment technique for observing comprehensive gene expression has been changed from microarray using cdna
More informationValidation of two ribosomal RNA removal methods for microbial metatranscriptomics
Nature Methods Validation of two ribosomal RNA removal methods for microbial metatranscriptomics Shaomei He 1,2,5, Omri Wurtzel 3,5, Kanwar Singh 1, Jeff L Froula 1, Suzan Yilmaz 1, Susannah G Tringe 1,
More informationComparative analysis of RNA- Seq data with DESeq2
Comparative analysis of RNA- Seq data with DESeq2 Simon Anders EMBL Heidelberg Two applications of RNA- Seq Discovery Eind new transcripts Eind transcript boundaries Eind splice junctions Comparison Given
More informationStatistics for Differential Expression in Sequencing Studies. Naomi Altman
Statistics for Differential Expression in Sequencing Studies Naomi Altman naomi@stat.psu.edu Outline Preliminaries what you need to do before the DE analysis Stat Background what you need to know to understand
More informationTechnologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA
Technologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA Expression analysis for RNA-seq data Ewa Szczurek Instytut Informatyki Uniwersytet Warszawski 1/35 The problem
More informationRNASeq Differential Expression
12/06/2014 RNASeq Differential Expression Le Corguillé v1.01 1 Introduction RNASeq No previous genomic sequence information is needed In RNA-seq the expression signal of a transcript is limited by the
More informationGoing Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014
Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more
More informationIntroduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationSupplemental Information
Molecular Cell, Volume 52 Supplemental Information The Translational Landscape of the Mammalian Cell Cycle Craig R. Stumpf, Melissa V. Moreno, Adam B. Olshen, Barry S. Taylor, and Davide Ruggero Supplemental
More informationBias in RNA sequencing and what to do about it
Bias in RNA sequencing and what to do about it Walter L. (Larry) Ruzzo Computer Science and Engineering Genome Sciences University of Washington Fred Hutchinson Cancer Research Center Seattle, WA, USA
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Sensitivity versus FDR in the "effect from experiment" simulation at the transcript level. Zoomed out version of performance on effect from experiment simulation at the isoform level.
More informationUnlocking RNA-seq tools for zero inflation and single cell applications using observation weights
Unlocking RNA-seq tools for zero inflation and single cell applications using observation weights Koen Van den Berge, Ghent University Statistical Genomics, 2018-2019 1 The team Koen Van den Berge Fanny
More informationOverview - MS Proteomics in One Slide. MS masses of peptides. MS/MS fragments of a peptide. Results! Match to sequence database
Overview - MS Proteomics in One Slide Obtain protein Digest into peptides Acquire spectra in mass spectrometer MS masses of peptides MS/MS fragments of a peptide Results! Match to sequence database 2 But
More informationDaphnia magna. Genetic and plastic responses in
Genetic and plastic responses in Daphnia magna Comparison of clonal differences and environmental stress induced changes in alternative splicing and gene expression. Jouni Kvist Institute of Biotechnology,
More informationLecture: Mixture Models for Microbiome data
Lecture: Mixture Models for Microbiome data Lecture 3: Mixture Models for Microbiome data Outline: - - Sequencing thought experiment Mixture Models (tangent) - (esp. Negative Binomial) - Differential abundance
More informationLecture 3: Mixture Models for Microbiome data. Lecture 3: Mixture Models for Microbiome data
Lecture 3: Mixture Models for Microbiome data 1 Lecture 3: Mixture Models for Microbiome data Outline: - Mixture Models (Negative Binomial) - DESeq2 / Don t Rarefy. Ever. 2 Hypothesis Tests - reminder
More informationscrna-seq Differential expression analysis methods Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden October 2017
scrna-seq Differential expression analysis methods Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden October 2017 Olga (NBIS) scrna-seq de October 2017 1 / 34 Outline Introduction: what
More informationStatistical Inferences for Isoform Expression in RNA-Seq
Statistical Inferences for Isoform Expression in RNA-Seq Hui Jiang and Wing Hung Wong February 25, 2009 Abstract The development of RNA sequencing (RNA-Seq) makes it possible for us to measure transcription
More informationGEP Annotation Report
GEP Annotation Report Note: For each gene described in this annotation report, you should also prepare the corresponding GFF, transcript and peptide sequence files as part of your submission. Student name:
More informationDispersion modeling for RNAseq differential analysis
Dispersion modeling for RNAseq differential analysis E. Bonafede 1, F. Picard 2, S. Robin 3, C. Viroli 1 ( 1 ) univ. Bologna, ( 3 ) CNRS/univ. Lyon I, ( 3 ) INRA/AgroParisTech, Paris IBC, Victoria, July
More informationBayesian Clustering of Multi-Omics
Bayesian Clustering of Multi-Omics for Cardiovascular Diseases Nils Strelow 22./23.01.2019 Final Presentation Trends in Bioinformatics WS18/19 Recap Intermediate presentation Precision Medicine Multi-Omics
More informationSession 5: Phylogenomics
Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree
More informationIntroduction. SAMStat. QualiMap. Conclusions
Introduction SAMStat QualiMap Conclusions Introduction SAMStat QualiMap Conclusions Where are we? Why QC on mapped sequences Acknowledgment: Fernando García Alcalde The reads may look OK in QC analyses
More informationBioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
More informationAnalyses biostatistiques de données RNA-seq
Analyses biostatistiques de données RNA-seq Ignacio Gonzàlez, Annick Moisan & Nathalie Villa-Vialaneix prenom.nom@toulouse.inra.fr Toulouse, 18/19 mai 2017 IG, AM, NV 2 (INRA) Biostatistique RNA-seq Toulouse,
More informationABSSeq: a new RNA-Seq analysis method based on modelling absolute expression differences
ABSSeq: a new RNA-Seq analysis method based on modelling absolute expression differences Wentao Yang October 30, 2018 1 Introduction This vignette is intended to give a brief introduction of the ABSSeq
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 25 no. 8 29, pages 126 132 doi:1.193/bioinformatics/btp113 Gene expression Statistical inferences for isoform expression in RNA-Seq Hui Jiang 1 and Wing Hung Wong 2,
More informationSUSTAINABLE AND INTEGRAL EXPLOITATION OF AGAVE
SUSTAINABLE AND INTEGRAL EXPLOITATION OF AGAVE Editor Antonia Gutiérrez-Mora Compilers Benjamín Rodríguez-Garay Silvia Maribel Contreras-Ramos Manuel Reinhart Kirchmayr Marisela González-Ávila Index 1.
More informationAPGRU6L2. Control of Prokaryotic (Bacterial) Genes
APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production
More informationCycle «Analyse de données de séquençage à haut-débit»
Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Chadi Saad CRIStAL - Équipe BONSAI - Univ Lille, CNRS, INRIA (chadi.saad@univ-lille.fr) Présentation de Sophie Gallina (source:
More informationCount ratio model reveals bias affecting NGS fold changes
Published online 8 July 2015 Nucleic Acids Research, 2015, Vol. 43, No. 20 e136 doi: 10.1093/nar/gkv696 Count ratio model reveals bias affecting NGS fold changes Florian Erhard * and Ralf Zimmer Institut
More informationCOLE TRAPNELL, BRIAN A WILLIAMS, GEO PERTEA, ALI MORTAZAVI, GORDON KWAN, MARIJKE J VAN BAREN, STEVEN L SALZBERG, BARBARA J WOLD, AND LIOR PACHTER
SUPPLEMENTARY METHODS FOR THE PAPER TRANSCRIPT ASSEMBLY AND QUANTIFICATION BY RNA-SEQ REVEALS UNANNOTATED TRANSCRIPTS AND ISOFORM SWITCHING DURING CELL DIFFERENTIATION COLE TRAPNELL, BRIAN A WILLIAMS,
More informationStatistical tests for differential expression in count data (1)
Statistical tests for differential expression in count data (1) NBIC Advanced RNA-seq course 25-26 August 2011 Academic Medical Center, Amsterdam The analysis of a microarray experiment Pre-process image
More informationGenome-wide modelling of transcription kinetics reveals patterns of RNA production delays arxiv: v2 [q-bio.
Genome-wide modelling of transcription kinetics reveals patterns of RNA production delays arxiv:153.181v2 [q-bio.gn] 16 Jul 215 Antti Honkela 1, Jaakko Peltonen 2,3, Hande Topa 2, Iryna Charapitsa 4, Filomena
More informationProtein Quantitation II: Multiple Reaction Monitoring. Kelly Ruggles New York University
Protein Quantitation II: Multiple Reaction Monitoring Kelly Ruggles kelly@fenyolab.org New York University Traditional Affinity-based proteomics Use antibodies to quantify proteins Western Blot RPPA Immunohistochemistry
More informationProtein Quantitation II: Multiple Reaction Monitoring. Kelly Ruggles New York University
Protein Quantitation II: Multiple Reaction Monitoring Kelly Ruggles kelly@fenyolab.org New York University Traditional Affinity-based proteomics Use antibodies to quantify proteins Western Blot Immunohistochemistry
More informationGenome Annotation. Qi Sun Bioinformatics Facility Cornell University
Genome Annotation Qi Sun Bioinformatics Facility Cornell University Some basic bioinformatics tools BLAST PSI-BLAST - Position-Specific Scoring Matrix HMM - Hidden Markov Model NCBI BLAST How does BLAST
More informationCo-expression analysis of RNA-seq data with the coseq package
Co-expression analysis of RNA-seq data with the coseq package Andrea Rau 1 and Cathy Maugis-Rabusseau 1 andrea.rau@jouy.inra.fr coseq version 0.1.10 Abstract This vignette illustrates the use of the coseq
More informationRNA-seq. Differential analysis
RNA-seq Differential analysis DESeq2 DESeq2 http://bioconductor.org/packages/release/bioc/vignettes/deseq 2/inst/doc/DESeq2.html Input data Why un-normalized counts? As input, the DESeq2 package expects
More informationMixture models for analysing transcriptome and ChIP-chip data
Mixture models for analysing transcriptome and ChIP-chip data Marie-Laure Martin-Magniette French National Institute for agricultural research (INRA) Unit of Applied Mathematics and Informatics at AgroParisTech,
More informationVariant visualisation and quality control
Variant visualisation and quality control You really should be making plots! 25/06/14 Paul Theodor Pyl 1 Classical Sequencing Example DNA.BAM.VCF Aligner Variant Caller A single sample sequencing run 25/06/14
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Jianlin Cheng, PhD Department of Computer Science Informatics Institute 2011 Topics Introduction Biological Sequence Alignment and Database Search Analysis of gene expression
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:
More informationHigh-throughput sequencing: Alignment and related topic
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg HTS Platforms E s ta b lis h e d p la tfo rm s Illu m in a H is e q, A B I S O L id, R o c h e 4 5 4 N e w c o m e rs
More informationExploring variability in reads from next generation rna-sequencing data. Presented By. Andrew Butler
Exploring variability in reads from next generation rna-sequencing data Presented By Andrew Butler in partial fullfillment of the requirements for graduation with a dean s scholars honors degree in biology
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationTutorial 1: Setting up your Skyline document
Tutorial 1: Setting up your Skyline document Caution! For using Skyline the number formats of your computer have to be set to English (United States). Open the Control Panel Clock, Language, and Region
More informationWeb-based Supplementary Materials for BM-Map: Bayesian Mapping of Multireads for Next-Generation Sequencing Data
Web-based Supplementary Materials for BM-Map: Bayesian Mapping of Multireads for Next-Generation Sequencing Data Yuan Ji 1,, Yanxun Xu 2, Qiong Zhang 3, Kam-Wah Tsui 3, Yuan Yuan 4, Clift Norris 1, Shoudan
More informationDifferential Expression Analysis Techniques for Single-Cell RNA-seq Experiments
Differential Expression Analysis Techniques for Single-Cell RNA-seq Experiments for the Computational Biology Doctoral Seminar (CMPBIO 293), organized by N. Yosef & T. Ashuach, Spring 2018, UC Berkeley
More informationMathangi Thiagarajan Rice Genome Annotation Workshop May 23rd, 2007
-2 Transcript Alignment Assembly and Automated Gene Structure Improvements Using PASA-2 Mathangi Thiagarajan mathangi@jcvi.org Rice Genome Annotation Workshop May 23rd, 2007 About PASA PASA is an open
More informationMotifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.
Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer
More informationDEXSeq paper discussion
DEXSeq paper discussion L Collado-Torres December 10th, 2012 1 / 23 1 Background 2 DEXSeq paper 3 Results 2 / 23 Gene Expression 1 Background 1 Source: http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/applexpression.shtml
More informationAnnotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA)
Annotation of Plant Genomes using RNA-seq Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) inuscu1-35bp 5 _ 0 _ 5 _ What is Annotation inuscu2-75bp luscu1-75bp 0 _ 5 _ Reconstruction
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
More informationStatistical Models for Gene and Transcripts Quantification and Identification Using RNA-Seq Technology
Purdue University Purdue e-pubs Open Access Dissertations Theses and Dissertations Fall 2013 Statistical Models for Gene and Transcripts Quantification and Identification Using RNA-Seq Technology Han Wu
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationThe official electronic file of this thesis or dissertation is maintained by the University Libraries on behalf of The Graduate School at Stony Brook
Stony Brook University The official electronic file of this thesis or dissertation is maintained by the University Libraries on behalf of The Graduate School at Stony Brook University. Alll Rigghht tss
More informationSynteny Portal Documentation
Synteny Portal Documentation Synteny Portal is a web application portal for visualizing, browsing, searching and building synteny blocks. Synteny Portal provides four main web applications: SynCircos,
More information*Equal contribution Contact: (TT) 1 Department of Biomedical Engineering, the Engineering Faculty, Tel Aviv
Supplementary of Complementary Post Transcriptional Regulatory Information is Detected by PUNCH-P and Ribosome Profiling Hadas Zur*,1, Ranen Aviner*,2, Tamir Tuller 1,3 1 Department of Biomedical Engineering,
More informationThe Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
More informationIntroduc)on to RNA- Seq Data Analysis. Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas
Introduc)on to RNA- Seq Data Analysis Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas Material: hep://)ny.cc/rnaseq Slides: hep://)ny.cc/slidesrnaseq
More informationTaxonomical Classification using:
Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical
More informationSPH 247 Statistical Analysis of Laboratory Data. April 28, 2015 SPH 247 Statistics for Laboratory Data 1
SPH 247 Statistical Analysis of Laboratory Data April 28, 2015 SPH 247 Statistics for Laboratory Data 1 Outline RNA-Seq for differential expression analysis Statistical methods for RNA-Seq: Structure and
More informationGS Analysis of Microarray Data
GS01 0163 Analysis of Microarray Data Keith Baggerly and Bradley Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org
More informationMassHunter TOF/QTOF Users Meeting
MassHunter TOF/QTOF Users Meeting 1 Qualitative Analysis Workflows Workflows in Qualitative Analysis allow the user to only see and work with the areas and dialog boxes they need for their specific tasks
More informationTUTORIAL EXERCISES WITH ANSWERS
TUTORIAL EXERCISES WITH ANSWERS Tutorial 1 Settings 1. What is the exact monoisotopic mass difference for peptides carrying a 13 C (and NO additional 15 N) labelled C-terminal lysine residue? a. 6.020129
More informationPackage HarmonicRegression
Package HarmonicRegression April 1, 2015 Type Package Title Harmonic Regression to One or more Time Series Version 1.0 Date 2015-04-01 Author Paal O. Westermark Maintainer Paal O. Westermark
More informationDavid M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis
David M. Rocke Division of Biostatistics and Department of Biomedical Engineering University of California, Davis March 18, 2016 UVA Seminar RNA Seq 1 RNA Seq Gene expression is the transcription of the
More informationNormalization and differential analysis of RNA-seq data
Normalization and differential analysis of RNA-seq data Nathalie Villa-Vialaneix INRA, Toulouse, MIAT (Mathématiques et Informatique Appliquées de Toulouse) nathalie.villa@toulouse.inra.fr http://www.nathalievilla.org
More informationDifferential expression analysis for sequencing count data. Simon Anders
Differential expression analysis for sequencing count data Simon Anders RNA-Seq Count data in HTS RNA-Seq Tag-Seq Gene 13CDNA73 A2BP1 A2M A4GALT AAAS AACS AADACL1 [...] ChIP-Seq Bar-Seq... GliNS1 4 19
More informationHigh-throughput sequence alignment. November 9, 2017
High-throughput sequence alignment November 9, 2017 a little history human genome project #1 (many U.S. government agencies and large institute) started October 1, 1990. Goal: 10x coverage of human genome,
More informationGene Network Science Diagrammatic Cell Language and Visual Cell
Gene Network Science Diagrammatic Cell Language and Visual Cell Mr. Tan Chee Meng Scientific Programmer, System Biology Group, Bioinformatics Institute Overview Introduction Why? Challenges Diagrammatic
More informationGene expression from RNA-Seq
Gene expression from RNA-Seq Once sequenced problem becomes computational cells cdna sequencer Sequenced reads ChI Alinment read coverae enome Considerations and assumptions Hih library complexity #molecules
More informationWhat is Systems Biology
What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the
More informationFrom transcriptome to epigenome, and back? Mattia Pelizzola Center for Genomic Science Istituto Italiano di Tecnologia (IIT), Milano
From transcriptome to epigenome, and back? Mattia Pelizzola Center for Genomic Science Istituto Italiano di Tecnologia (IIT), Milano m6a epitranscriptome m6a dynamics synthesis processing degradation m5c
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationMixtures and Hidden Markov Models for analyzing genomic data
Mixtures and Hidden Markov Models for analyzing genomic data Marie-Laure Martin-Magniette UMR AgroParisTech/INRA Mathématique et Informatique Appliquées, Paris UMR INRA/UEVE ERL CNRS Unité de Recherche
More informationComputational Methods for Mass Spectrometry Proteomics
Computational Methods for Mass Spectrometry Proteomics Eidhammer, Ingvar ISBN-13: 9780470512975 Table of Contents Preface. Acknowledgements. 1 Protein, Proteome, and Proteomics. 1.1 Primary goals for studying
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationEppendorf twin.tec PCR Plates 96 LoBind Increase Yield of Transcript Species and Number of Reads of NGS Libraries
APPLICATION NOTE No. 375 I December 2016 Eppendorf twin.tec PCR Plates 96 LoBind Increase Yield of Transcript Species and Number of Reads of NGS Libraries Hanae A. Henke¹, Björn Rotter² ¹Eppendorf AG,
More informationExpanded View Figures
Molecular Systems iology Evolutionary divergence of mouse P Mei-Sheng Xiao et al Expanded View Figures Nucleotide percentage (%) 0 20 40 60 80 100 T G Nucleotide percentage (%) 0 20 40 60 80 100 T G Frequency
More informationLecture 15: Programming Example: TASEP
Carl Kingsford, 0-0, Fall 0 Lecture : Programming Example: TASEP The goal for this lecture is to implement a reasonably large program from scratch. The task we will program is to simulate ribosomes moving
More informationLecture 5: Processes and Timescales: Rates for the fundamental processes 5.1
Lecture 5: Processes and Timescales: Rates for the fundamental processes 5.1 Reading Assignment for Lectures 5-6: Phillips, Kondev, Theriot (PKT), Chapter 3 Life is not static. Organisms as a whole are
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More informationControl of Prokaryotic (Bacterial) Gene Expression. AP Biology
Control of Prokaryotic (Bacterial) Gene Expression Figure 18.1 How can this fish s eyes see equally well in both air and water? Aka. Quatro ojas Regulation of Gene Expression: Prokaryotes and eukaryotes
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationModelling gene expression dynamics with Gaussian processes
Modelling gene expression dynamics with Gaussian processes Regulatory Genomics and Epigenomics March th 6 Magnus Rattray Faculty of Life Sciences University of Manchester Talk Outline Introduction to Gaussian
More informationAgilent All Ions MS/MS
Agilent All Ions MS/MS Workflow Overview A Determine fragment ions for LC/MS Quant method B Develop final Quant method Develop LC/MS Qualitative Analysis method Process data with Find by Formula Build
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More information