The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
|
|
|
- Thomas Willis
- 5 years ago
- Views:
Transcription
1 Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling the activation or repression of. start stop cis-regulatory sequence
2 Transcription Factors Protein that binds specific DNA sequences controlling the activation or repression of. Transcription Factors Protein that binds specific DNA sequences controlling the activation or repression of. start stop start stop cis-regulatory sequence cis-regulatory sequence AAAAAAAAAAAA mrna produced One Gene Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) K start stop cis-regulatory sequence mrna produced AAAAAAAAAAAA start stop cis-regulatory sequence AAAAAAAAAAAA mrna produced
3 Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) ,000 Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) ,000 I II III IV V VI VII VIII I I II III IV V VI M I II III IV V VI VII VIII I I II III IV V VI M Affinity Purification Review
4 RNA Polymerase II RNA Polymerase II RNA Polymerase II RNA Polymerase II AAAAAAAAAAAAA AAAAAAAAAAAAA Ribosome
5 Ribosome RNA Polymerase II AAAAAAAAAAAAA The Experiment (ChIP-seq) (1) cross-link proteins to genomic DNA
6 (1) cross-link proteins to genomic DNA (1) cross-link proteins to genomic DNA (2) shear genomic DNA (2) shear genomic DNA (3) affinity purify factors (1) cross-link proteins to genomic DNA (1) cross-link proteins to genomic DNA (2) shear genomic DNA (2) shear genomic DNA (3) affinity purify factors (3) affinity purify factors (4) reverse the cross-links (4) reverse the cross-links (5) purify DNA fragments
7 (5) sequence DNA fragments (1) cross-link proteins to genomic DNA (2) shear genomic DNA (3) affinity purify factors (4) reverse the cross-links (5) purify DNA fragments (5) sequence DNA fragments (5) sequence DNA fragments (5) sequence DNA fragments (6) map DNA sequences to genome (6) map DNA sequences to genome (7) establish consensus sequences
8 (5) sequence DNA fragments (6) map DNA sequences to genome (1) cross-link proteins to genomic DNA (2) shear genomic DNA (7) establish consensus sequences (3) affinity purify factors (8) elucidate peaks How do we actually accomplish this purification? Input DNA Pre Clearing Other Protein Other DNA Sepharose Bead Other Protein Other DNA (Transcription Factor Protein) a (Transcription Factor Protein) a Other Protein Y Other Protein Y
9 Immunoprecipitation (Transcription Factor Protein) Protein A a Sepharose Bead IgG Immunoglobulin G IgG IgG molecules are synthesized and secreted by plasma B cells built of two heavy chains and two light chains each IgG has two antigen binding sites most abundant immunoglobulin, secondary immune response is approximately equally distributed in blood and in tissue liquids, constituting 75% of serum immunoglobulins in humans Protein A kda surface protein cell wall of bacteria Staphylococcus aureus binds with immunoglobulins through interaction with the heavy chain Input DNA Pre Clearing Input DNA (Transcription Factor Protein) a Immunoprecipitation
10 Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) ,000 Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) ,000 I II III IV V VI VII VIII I I II III IV V VI M I II III IV V VI VII VIII I I II III IV V VI M I II III IV V Whole Genome (Saccharomyces cerevisiae has 16 chromosomes + mitochondrial DNA) ,000 Which Transcription Factors? Characterized Cell Cycle Regulators VI VII VIII SWI5 MCM1 ACE2 SWI4 FKH1 FKH2 I I II III IV V start stop VI M cis-regulatory sequence
11 Which Transcription Factors? How Did I Choose These Factors? Characterized Cell Cycle Regulators SWI5 MCM1 ACE2 start SWI4 FKH1 FKH2 stop cis-regulatory sequence Cell (2001) vol. 106 (6) pp sample ~100 ml at each time point 2 9 sample ~100 ml at each time point
12 Possible Cell States Synchrony
13 sample ~100 ml at each time point 1 2 sample ~100 ml at each time point Experimental Data Collected SWI5 What is the end goal? 8 4 MCM1 ACE2 FKH2 7 5 SWI4 FKH1 6
14 Alternative plan? Cell (2001) vol. 106 (6) pp Experimental Data Collected SWI5 MCM1 ACE2 Research Progress Report IV 5
15 Business Issues Research Progress Report IV Boxes in Freezer (not racks), By Friday! RNA, DNA, PCR Checkpoint ChIP Reagents Aliquoted MiniBead Beater Training & Video Sonicator Training & Video
Functional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication
Functional Genomics Research Stream Lecture: May 5, 2009 The Road to Publication Final Lab Issues Lab Hours this Week: Wednesday 10 AM - 6 PM Thursday 10 AM - 6 PM One Hour Required (sign in, sign out)
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
RNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
12-5 Gene Regulation
12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
APGRU6L2. Control of Prokaryotic (Bacterial) Genes
APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
Control of Gene Expression
Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:
Translation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
UNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
Controlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
Gene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
CHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline
CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
GCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
Welcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
Prokaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
Chapter 20. Initiation of transcription. Eukaryotic transcription initiation
Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Chapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
Name Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Unit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
Nucleus. The nucleus is a membrane bound organelle that store, protect and express most of the genetic information(dna) found in the cell.
Nucleus The nucleus is a membrane bound organelle that store, protect and express most of the genetic information(dna) found in the cell. Since regulation of gene expression takes place in the nucleus,
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Lecture 4: Transcription networks basic concepts
Lecture 4: Transcription networks basic concepts - Activators and repressors - Input functions; Logic input functions; Multidimensional input functions - Dynamics and response time 2.1 Introduction The
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
Co-ordination occurs in multiple layers Intracellular regulation: self-regulation Intercellular regulation: coordinated cell signalling e.g.
Gene Expression- Overview Differentiating cells Achieved through changes in gene expression All cells contain the same whole genome A typical differentiated cell only expresses ~50% of its total gene Overview
Regulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
Control of Prokaryotic (Bacterial) Gene Expression. AP Biology
Control of Prokaryotic (Bacterial) Gene Expression Figure 18.1 How can this fish s eyes see equally well in both air and water? Aka. Quatro ojas Regulation of Gene Expression: Prokaryotes and eukaryotes
What is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
4. Why not make all enzymes all the time (even if not needed)? Enzyme synthesis uses a lot of energy.
1 C2005/F2401 '10-- Lecture 15 -- Last Edited: 11/02/10 01:58 PM Copyright 2010 Deborah Mowshowitz and Lawrence Chasin Department of Biological Sciences Columbia University New York, NY. Handouts: 15A
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
Eukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
REGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
Proteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Chapter 18: Control of Gene Expression
Chapter 18: Control of Gene Expression 海洋生物研究所 曾令銘 海事大樓 426 室分機 : 5326 Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
Mouth animalcules (bacteria)
Mouth animalcules (bacteria) 1684 http://en.citizendium.org/images/thumb/9/94/leeuwenhoek.jpg/300px-leeuwenhoek.jpg Prokaryotic Cell Shapes Coccus - cocci Bacillus - bacillus Spirillum - spirilli Vibrio
Gene regulation II Biochemistry 302. Bob Kelm February 28, 2005
Gene regulation II Biochemistry 302 Bob Kelm February 28, 2005 Catabolic operons: Regulation by multiple signals targeting different TFs Catabolite repression: Activity of lac operon is restricted when
Control of Gene Expression in Prokaryotes
Why? Control of Expression in Prokaryotes How do prokaryotes use operons to control gene expression? Houses usually have a light source in every room, but it would be a waste of energy to leave every light
A DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
Regulation of Gene Expression in Bacteria and Their Viruses
11 Regulation of Gene Expression in Bacteria and Their Viruses WORKING WITH THE FIGURES 1. Compare the structure of IPTG shown in Figure 11-7 with the structure of galactose shown in Figure 11-5. Why is
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
The Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
GENE REGULATION AND PROBLEMS OF DEVELOPMENT
GENE REGULATION AND PROBLEMS OF DEVELOPMENT By Surinder Kaur DIET Ropar Surinder_1998@ yahoo.in Mob No 9988530775 GENE REGULATION Gene is a segment of DNA that codes for a unit of function (polypeptide,
GACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
Chapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
CELL CYCLE AND DIFFERENTIATION
CELL CYCLE AND DIFFERENTIATION Dewajani Purnomosari Department of Histology and Cell Biology Faculty of Medicine Universitas Gadjah Mada d.purnomosari@ugm.ac.id WHAT IS CELL CYCLE? 09/12/14 d.purnomosari@ugm.ac.id
The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
Genetic transcription and regulation
Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process DNA codes for DNA replication
16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization
The Cell Cycle 16 The Cell Cycle Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization Introduction Self-reproduction is perhaps
GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
A Simple Protein Synthesis Model
A Simple Protein Synthesis Model James K. Peterson Department of Biological Sciences and Department of Mathematical Sciences Clemson University September 3, 213 Outline A Simple Protein Synthesis Model
Unit Two: Molecular Genetics. 5.5 Control Mechanisms 5.7 Key Differences 5.8 Genes and Chromosomes
Unit Two: Molecular Genetics 5.5 Control Mechanisms 5.7 Key Differences 5.8 Genes and Chromosomes Control Mechanisms Not all genes need to be produced at all times. Example: alcohol dehydrogenase Methods
REVIEW 2: CELLS & CELL DIVISION UNIT. A. Top 10 If you learned anything from this unit, you should have learned:
Period Date REVIEW 2: CELLS & CELL DIVISION UNIT A. Top 10 If you learned anything from this unit, you should have learned: 1. Prokaryotes vs. eukaryotes No internal membranes vs. membrane-bound organelles
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
16 CONTROL OF GENE EXPRESSION
16 CONTROL OF GENE EXPRESSION Chapter Outline 16.1 REGULATION OF GENE EXPRESSION IN PROKARYOTES The operon is the unit of transcription in prokaryotes The lac operon for lactose metabolism is transcribed
The Making of the Fittest: Evolving Switches, Evolving Bodies
INTRODUCTION MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH The types and amounts of proteins produced by a given cell in the body are very important and carefully regulated. Transcribing
Rule learning for gene expression data
Rule learning for gene expression data Stefan Enroth Original slides by Torgeir R. Hvidsten The Linnaeus Centre for Bioinformatics Predicting biological process from gene expression time profiles Papers:
Honors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
Measuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
Lecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps
Gene regulation II Biochemistry 302. February 27, 2006
Gene regulation II Biochemistry 302 February 27, 2006 Molecular basis of inhibition of RNAP by Lac repressor 35 promoter site 10 promoter site CRP/DNA complex 60 Lewis, M. et al. (1996) Science 271:1247
Initiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5