Seminar: MPS applica/ons in the forensic DNA IDen/fica/on Solu/ons Vienna, May
|
|
|
- Junior Dickerson
- 6 years ago
- Views:
Transcription
1 Seminar: MPS applica/ons in the forensic DNA IDen/fica/on Solu/ons Vienna, May Systematic Evaluation of the Early Access Applied Biosystems Precision ID Globalfiler Mixture ID and Globalfiler NGS STR Panels for the Ion S5 System within the DNASEQEX project Petra Müller 1, Burkhard Berger 1, Mar/n Bodner 1, Sharon WooNon 2, Robert Lagacé 2, The DNASEQEX Consor/um, Walther Parson 1,3 1 Ins/tute of Legal Medicine, Medical University of Innsbruck, Austria 2 Thermo Fisher Scien/fic Inc., South San Francisco, CA, USA 3 Forensic Science Program, Penn State University, PA, USA
2 Petra Müller, BSc MSc * Molecular Biologist * started working for the DNASEQEX project in April, 2016 * PhD candidate since March, 2017 Source: Spreadshirt.at
3
4 Evaluated MPS Technologies Berlin Innsbruck Madrid
5 General Overview Early Access Applied Biosystems Precision ID Globalfiler Mixture ID Simultaneously targets: 113 markers 29 astrs, 1 Y-STR, 42 SNPs, 2 Y-SNPs, 36 micro-haplotypes, Amelogenin and Y-InDel (rs ) Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panels for the Ion S5 Simultaneously targets: 33 markers 29 astrs, 1 Y-STR, Amelogenin and Y-InDel (rs )
6 Sample Set & Sequencing (according to TFS EA workbooks) Early Access Applied Biosystems Precision ID Globalfiler Mixture ID 32 samples: 4 concordance 4 sensitivity 24 casework samples 2 Ion 530 sequencing chips (16* samples each) * originally recommended 8 samples agreement to run 16 samples/chip Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panels for the Ion S5 32 samples: 4 concordance 4 sensitivity 24 casework samples 2 Ion 530 sequencing chips (8 samples, 24 samples)
7 Sequencing Runs Early Access Applied Biosystems Precision ID Globalfiler Mixture ID Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panels for the Ion S5 Chip 1 16 samples Chip 2 16 samples Chip 3 24 samples Chip 4 8 samples Total reads 8,615,689 Total reads 10,217,857 Total reads 8,945,109 Total reads 9,104,541 Loading (49 %) 18,383,528 Loading (60 %) 22,402,863 Loading (59 %) 22,195,405 Loading (59 %) 21,745,629 Enrichment 99 % Enrichment 100 % Enrichment 100 % Enrichment 97 % Clonal 67 % Clonal 62 % Clonal 63 % Clonal 68 % Final library 71 % Final library 74 % Final library 64 % Final library 64 %
8 Early Access Applied Biosystems Precision ID Globalfiler Mixture ID Results
9 Concordance Study (Globalfiler Mixture ID) NIST SRM 2391c -C & control DNA 9947A, DNA input 1 ng/assay astrs Comparison with NIST CE data 2391c A 2391c B 2391c C 9947A Concordance (%) Drop-out D19S433 (16.2), D12S391 (24) D19S433 (15.2), D10S1248 (16) Isometric-alleles 1 D2S441 (10) D8S1179 (13) Y-STR in allele counts (%) 29+1 (+2.1 %) 21+1 (+2.9 %) Concordance (%) EA ABI STR panel 1 Isometric-alleles appear homozygous with CE as they are identical in size but differ in sequence Additional isometric allele: 2391c C in D5S2800 (14) confirmed by EA ABI GF Mixture ID panel
10 Concordance Study (Globalfiler Mixture ID) NIST SRM 2391c B 2 4 D19S433 16, 16.2 D12S391 19, 24
11 Sensitivity Study (Globalfiler Mixture ID) NIST SRM 2372 A & control DNA 9947A, DNA input 250; 125 pg/assay Sampl e DNA input/ assay [pg] Observed alleles [%] Drop-out Isometric-alleles 1 ( in allele counts) 9947A D22S1045 (16) D8S1179 (13); +2.9 % 9947A A D10S1248 (16) 2372A D10S1248 (16), 1 D2S1338 (25) Isometric-alleles appear homozygous with CE as they are identical in size but differ in sequence D3S1358 (16), D8S1179 (14); +5.3 %
12 Stutter Analysis (Globalfiler Mixture ID) Average stutter ratios range: 7.4 % (D5S25800) to 31.6 % (D22S1045) TH01 displayed no stutters 8 0 R e la tive stu tte r h e ig h t [% ] D 5 S T P O X D 3 S D 4 S D 2 S D 7 S D Y S D 6 S C S F 1 P O D 2 S D 1 6 S D 1 3 S D 6 S D 5 S D 1 4 S D 8 S F G A D 1 8 S 5 1 D 2 1 S 1 1 D 2 S D 3 S D 1 S v W A D 1 S D 1 9 S D 1 0 S D 1 2 A T A 6 3 D 1 2 S D 2 2 S Dataset includes single person samples (1 ng DNA input), homo- and heterozygous genotypes as well as isometric allele calls. O v e r p : Overlap: E S S & C O D IS L oess c i & CODIS ALoci d d io n a l C O D IS L o c i ( Additional E x p a n d e d S e t ) CODIS Loci (Expanded Other Set) t h e r L o c iloci
13 Balance (Globalfiler Mixture ID) STR coverage varies from % (D22S1045) to % (TH01) compared to the calculated expected value (100 %) R e la tive m a rke r co ve ra g e [% ] D 2 2 S D 1 S A M E L Y D 1 9 S D Y S D 3 S D 1 0 S F G A D 4 S D 2 S D 1 8 S 5 1 D 1 2 A T A 6 3 D 1 3 S D 1 4 S D 2 1 S 1 1 D 2 S D 1 2 S v W A D 2 S D 5 S D 7 S D 3 S C S F 1 P O D 5 S T P O X D 8 S D 1 S D 6 S D 6 S A M E L X D 1 6 S T H 0 1 % h ig h e r e x p e c t e d v a lu e % lo w e r O v e r la p : Overlap: ESS & E S S & C O D IS L o c i CODIS Loci A d d io n a l C O D Additional CODIS Loci L o c i ( E x p a n d e d S e t ) (Expanded Set) Other O t h e r L o c i Loci
14 Early Access Applied Biosystems Precision ID Globalfiler NGS STR Panels for the Ion S5 Results
15 Concordance Study (Globalfiler NGS STR Panels) NIST SRM 2391c A-C & control DNA 9947A, DNA input 1 ng/assay Comparison with NIST CE data 2391c A 2391c B 2391c C 9947A Concordance (%) astrs Y-STR Overlapping markers Isometric-alleles 1 D2S441 (10) in allele counts 29+1 (+2.1 %) D8S1179 (13) 21+1 (+2.9 %) Concordance (%) EA ABI STR panel 1 Isometric-alleles appear homozygous with CE as they are identical in size but differ in sequence Additional isometric allele: 2391c C in D5S2800 (14) confirmed by EA ABI GF Mixture ID panel
16 Sensitivity Study (Globalfiler NGS STR Panels) NIST SRM 2372 A & control DNA 9947A, DNA input 250, 125 pg/assay Sample DNA input/ assay [pg] Observed alleles [%] 9947A A Isometric-alleles ( in allele counts [%]) D8S1179 (13); +2.9 % 2372A D3S1358 (16), D8S1179 (14); 2372A % 1 Isometric-alleles appear homozygous with CE as they are identical in size but differ in sequence
17 Stutter Analysis (Globalfiler NGS STR Panels) Average stutter ratios range: 6.3 % (D4S2408) to 19.4 % (FGA) TH01 displayed no stutters 8 0 R e la tive stu tte r h e ig h t [% ] D 4 S D 5 S D 3 S T P O X D 2 S D 6 S D Y S D 1 3 S C S F 1 P O D 7 S D 6 S D 1 6 S D 8 S D 1 4 S D 2 1 S 1 1 D 1 S D 5 S D 3 S D 1 0 S v W A D 1 9 S D 2 S D 1 S D 1 2 S D 1 8 S 5 1 D 2 2 S D 1 2 A T A 6 3 F G A Dataset includes single person samples (1 ng DNA input), homo- and heterozygous genotypes as well as isometric allele calls. O v e r la p : Overlap: ESS & CODIS E S S & C O D IS L o c i Loci Additional A d d io n a l C OCODIS D L o c i Loci (Expanded Set) ( E x p a n d e d S e t ) Other O t h e r LLoci o c i
18 Balance (Globalfiler NGS STR Panels) STR coverage varies from % (D22S1045) to % (TH01) compared to the calculated expected value (100 %) R e la tive m a rke r co ve ra g e [% ] D 2 2 S F G A D 1 8 S 5 1 D Y S A M E L Y v W A D 1 9 S D 4 S D 2 1 S 1 1 D 3 S D 1 3 S D 2 S D 1 0 S D 7 S D 1 2 A T A 6 3 D 5 S D 1 S D 6 S D 5 S D 1 4 S C S F 1 P O D 1 S D 1 2 S D 6 S D 2 S D 3 S T P O X D 8 S D 1 6 S A M E L X T H 0 1 % h ig h e r e x p e c t e d v a lu e % lo w e r O v e r la p : Overlap: ESS & E S S & C O D IS L o c i CODIS Additional Loci A d d io n a l C CODIS O D L o cloci i (Expanded ( E x p a n d e d S eset) t ) Other Loci O t h e r L o c i
19 Observations
20 Observed Split-Peaks D18S51 NIST SRM 2391c_A FGA GEDNAP 45_S2 D6S474 NIST SRM 2391c_E
21 Observations for D2S441 (GEDNAP 48_S3, single person) Applied Biosystems GlobalFiler PCR Amplification Kit Globalfiler Mixture ID Globalfiler NGS STR Panels
22 Observations Globalfiler Mixture ID (GEDNAP 48_S3) STRait Razor v2s (King et al., 2017). Analytical Threshold: 11 reads (defaul settings).
23 Observations Globalfiler Mixture ID (GEDNAP 48_S3) Length-based Sample ID Locus DoC String Sequence Data Data 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 14 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA]TTA[TCTA][TCTA] _S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAA_CT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA]TTA[TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA]TTA[TCTA][TCTA] T 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA]TTA[TCTA][TCTA] TATCATACACCACAGCCAC Nomenclature (according to Parson et al. FSIG (2016), ISFG MPS STR Considerations) Allele 13.3: (TCTA) 11 TTA (TCTA) 2 Allele 14: (TCTA) 11 TTTA (TCTA) 2
24 Observations Globalfiler NGS STR Panels (GEDNAP 48_S3) STRait Razor v2s (King et al., 2017). Analytical Threshold: 11 reads (defaul settings).
25 Observations Globalfiler NGS STR Panels (GEDNAP 48_S3) Lengthbased Data Sample ID Locus DoC String Sequence Data 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 14 48_S3_IonCode_0126 D2S441 48_S3_IonCode_0126 D2S441 48_S3_IonCode_0126 D2S441 48_S3_IonCode_0126 D2S441 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] GAAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TTTA][TCTA][TCTA] GAACTGTGGCTCATCTATGAAA_CT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA]TTA[TCTA][TCTA] _S3_IonCode_0126 D2S GAAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] TATCATAAACACCACAGCCAC 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] TATCATAAACACCACAGCCAC 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] TATCATA_CACCACAGCCAC 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCCATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] TATCGTAACACCACAGCCAC 48_S3_IonCode_0126 D2S GAACTGTGGCTCATCTATGAAAACT[TCTA][TCTA][TCTA][TCTA][TCTA][CCTA][TCTA][TCTA][TCTA][TCTA][TCTA][TTTA][TCTA][TCTA] Nomenclature (according to Parson et al. FSIG (2016), ISFG MPS STR Considerations) Allele 14: (TCTA) 11 TTTA (TCTA)
26 General Conclusion Low hands-on time in the lab Fully automatic workflow is easy to handle, which is crucial for the implementation of MPS into forensic routine applications Software improvement required
27 Conclusion Applied Biosystems Globalfiler Mixture ID Higher imbalanced STR genotypes due to large multiplex consisting 113 markers Drop-outs in the concordance and sensitivity experiments Increased stutters relative to values expected to CE (7.4 % to 31.6 %)
28 Conclusion Applied Biosystems Globalfiler NGS STR Panels More balanced STR genotype coverage No drop-outs observed in concordance and sensitivity studies Lower average stutter ratios (6.3 % to 19.4 %)
29 Additional optimization steps that are important for the implementation of MPS into forensic routine applications: More balanced assay amplification performance of high-throughput multiplex Low amplification performance of sex-typing markers (AMELY, DYS391 important for mixture analysis) Frequent split-peaks (e.g. in FGA, D5S2800, D6S474 and D18S51) showing high coverage Provide sequence information of flanking regions (according to Parson et al. FSIG (2016), ISFG MPS STR Considerations)
30 Acknowledgements Home/2014/ISFP/AG/LAWX/ DNA-STR Massive Sequencing & International Information Exchange Harald Niederstätter Christina Strobl
31 Speaker was provided travel and hotel support by Thermo Fisher Scien/fic for this presenta/on, but no remunera/on When used for purposes other than Human Iden/fica/on or Paternity Tes/ng the instruments and soiware modules cited are for Research Use Only. Not for use in diagnos/c procedures. Thermo Fisher Scien/fic and its affiliates are not endorsing, recommending, or promo/ng any use or applica/on of Thermo Fisher Scien/fic products presented by third par/es during this seminar. Informa/on and materials presented or provided by third par/es are provided as- is and without warranty of any kind, including regarding intellectual property rights and reported results. Par/es presen/ng images, text and material represent they have the rights to do so.
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing
Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,
GeneMapper ID-X Software Version 1.1 (Mixture Analysis Tool)
Getting Started Guide GeneMapper ID-X Software Version 1.1 (Mixture Analysis Tool) Note: To improve the clarity of graphics in this PDF file, use the zoom tool to increase magnification to 150% or greater.
Characterization of Error Tradeoffs in Human Identity Comparisons: Determining a Complexity Threshold for DNA Mixture Interpretation
Characterization of Error Tradeoffs in Human Identity Comparisons: Determining a Complexity Threshold for DNA Mixture Interpretation Boston University School of Medicine Program in Biomedical Forensic
STRmix - MCMC Study Page 1
SDPD Crime Laboratory Forensic Biology Unit Validation of the STRmix TM Software MCMC Markov Chain Monte Carlo Introduction The goal of DNA mixture interpretation should be to identify the genotypes of
Population genetic studies on the tetrameric short tandem repeat loci D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317 and D7S820 in Egypt
Forensic Science International 104 (1999) 31 www.elsevier.com/ locate/ forsciint Population genetic studies on the tetrameric short tandem repeat loci D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818,
Evaluation of the STR typing kit PowerPlexk 16 with respect to technical performance and population genetics: a multicenter study
International Congress Series 1239 (2003) 789 794 Evaluation of the STR typing kit PowerPlexk 16 with respect to technical performance and population genetics: a multicenter study L. Henke a, *, A. Aaspollu
A gamma model for DNA mixture analyses
Bayesian Analysis (2007) 2, Number 2, pp. 333 348 A gamma model for DNA mixture analyses R. G. Cowell, S. L. Lauritzen and J. Mortera Abstract. We present a new methodology for analysing forensic identification
Cluster analysis of Y-chromosomal STR population data using discrete Laplace distributions
25th ISFG Congress, Melbourne, 2013 1,, Poul Svante Eriksen 1 and Niels Morling 2 1 Department of Mathematical,, 2 Section of Forensic Genetics, Department of Forensic Medicine, Faculty of Health and Medical,
Case-Control Association Testing. Case-Control Association Testing
Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies
Automated Illumina TruSight HLA v2 Sequencing Panel Library Preparation with the epmotion 5075t
SHORT PROTOCOL No. 41 Automated Illumina TruSight HLA v2 Sequencing Panel Library Preparation with the epmotion 5075t Introduction This protocol describes the workstation configuration and pre-programmed
Overview of the Ibis SNP Assay
Thomas Hall, Ph.D. Overview of the Ibis SNP ssay Objective PR/ESI MS based assay for human autosomal SNP analysis Exclude non contributors to a DN sample random profile match should have very low probability
Genotype Imputation. Class Discussion for January 19, 2016
Genotype Imputation Class Discussion for January 19, 2016 Intuition Patterns of genetic variation in one individual guide our interpretation of the genomes of other individuals Imputation uses previously
COMBI - Combining high-dimensional classification and multiple hypotheses testing for the analysis of big data in genetics
COMBI - Combining high-dimensional classification and multiple hypotheses testing for the analysis of big data in genetics Thorsten Dickhaus University of Bremen Institute for Statistics AG DANK Herbsttagung
High-throughput Quantification of DNA for NGS Library Prep with the Zephyr G3 Workstation and the VICTOR Nivo Plate Reader
TECHNICAL APPLICATION NOTE High-throughput Quantification of DNA for NGS Library Prep with the Zephyr G3 Workstation and the VICTOR Nivo Plate Reader NGS Automation Image or Color Block Area Next generation
Genotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview RJ Elshire, JC laubitz, Q Sun, JV Harriman ES Buckler, and SE Mitchell http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina
Adventures in Forensic DNA: Cold Hits, Familial Searches, and Mixtures
Adventures in Forensic DNA: Cold Hits, Familial Searches, and Mixtures Departments of Mathematics and Statistics Northwestern University JSM 2012, July 30, 2012 The approach of this talk Some simple conceptual
MtDNA profiles and associated haplogroups
A systematic approach to an old problem Anita Brandstätter 1, Alexander Röck 2, Arne Dür 2, Walther Parson 1 1 Institute of Legal Medicine Innsbruck Medical University 2 Institute of Mathematics University
1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:
.5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the
Supplementary Information for Discovery and characterization of indel and point mutations
Supplementary Information for Discovery and characterization of indel and point mutations using DeNovoGear Avinash Ramu 1 Michiel J. Noordam 1 Rachel S. Schwartz 2 Arthur Wuster 3 Matthew E. Hurles 3 Reed
Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;
Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin
Workshop: Kinship analysis First lecture: Basics: Genetics, weight of evidence. I.1
Workshop: Kinship analysis First lecture: Basics: Genetics, weight of evidence. I.1 Thore Egeland (1),(2), Klaas Slooten (3),(4) (1) Norwegian University of Life Sciences, (2) NIPH, (3) Netherlands Forensic
Improved Throughput and Reproducibility for Targeted Protein Quantification Using a New High-Performance Triple Quadrupole Mass Spectrometer
Improved Throughput and Reproducibility for Targeted Protein Quantification Using a New High-Performance Triple Quadrupole Mass Spectrometer Reiko Kiyonami, Mary Blackburn, Andreas FR Hühme: Thermo Fisher
Calculation of IBD probabilities
Calculation of IBD probabilities David Evans University of Bristol This Session Identity by Descent (IBD) vs Identity by state (IBS) Why is IBD important? Calculating IBD probabilities Lander-Green Algorithm
p(d g A,g B )p(g B ), g B
Supplementary Note Marginal effects for two-locus models Here we derive the marginal effect size of the three models given in Figure 1 of the main text. For each model we assume the two loci (A and B)
Forensic Genetics. Summer Institute in Statistical Genetics July 26-28, 2017 University of Washington. John Buckleton:
Forensic Genetics Summer Institute in Statistical Genetics July 26-28, 2017 University of Washington John Buckleton: John.Buckleton@esr.cri.nz Bruce Weir: bsweir@uw.edu 1 Contents Topic Genetic Data, Evidence,
Microsatellite data analysis. Tomáš Fér & Filip Kolář
Microsatellite data analysis Tomáš Fér & Filip Kolář Multilocus data dominant heterozygotes and homozygotes cannot be distinguished binary biallelic data (fragments) presence (dominant allele/heterozygote)
Genotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing
Stochastic Models for Low Level DNA Mixtures
Original Article en5 Stochastic Models for Low Level DNA Mixtures Dalibor Slovák 1,, Jana Zvárová 1, 1 EuroMISE Centre, Institute of Computer Science AS CR, Prague, Czech Republic Institute of Hygiene
Whole genome sequencing (WGS) - there s a new tool in town. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) - there s a new tool in town Henrik Hasman DTU - Food Welcome to the NGS world TODAY Welcome Introduction to Next Generation Sequencing DNA purification (Hands-on) Lunch (Sandwishes
AALBORG UNIVERSITY. Investigation of a Gamma model for mixture STR samples
AALBORG UNIVERSITY Investigation of a Gamma model for mixture STR samples by Susanne G. Bøttcher, E. Susanne Christensen, Steffen L. Lauritzen, Helle S. Mogensen and Niels Morling R-2006-32 Oktober 2006
The statistical evaluation of DNA crime stains in R
The statistical evaluation of DNA crime stains in R Miriam Marušiaková Department of Statistics, Charles University, Prague Institute of Computer Science, CBI, Academy of Sciences of CR UseR! 2008, Dortmund
Devyser Index Plate A. Instructions for Use
Devyser Index Plate A Art. No.: 8-A200 Instructions for Use Page 1 of 17 TABLE OF CONTENTS TABLE OF CONTENTS 2 1. INTRODUCTION TO DEVYSER INDEX PLATE A 3 1.1 Intended use 3 1.2 Kit configuration Devyser
Ion Sphere Assay on the Qubit 3.0 Fluorometer
USER GUIDE Ion Sphere Assay on the Qubit 3.0 Fluorometer for use with: Ion Sphere Quality Control Kit (Cat. No. 4468656) Publication Number MAN0016388 Revision A.0 Ion Sphere Assay overview... 2 Materials
The E-M Algorithm in Genetics. Biostatistics 666 Lecture 8
The E-M Algorithm in Genetics Biostatistics 666 Lecture 8 Maximum Likelihood Estimation of Allele Frequencies Find parameter estimates which make observed data most likely General approach, as long as
New imputation strategies optimized for crop plants: FILLIN (Fast, Inbred Line Library ImputatioN) FSFHap (Full Sib Family Haplotype)
New imputation strategies optimized for crop plants: FILLIN (Fast, Inbred Line Library ImputatioN) FSFHap (Full Sib Family Haplotype) Kelly Swarts PAG Allele Mining 1/11/2014 Imputation is the projection
Optimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 2200 TapeStation
Optimization of Covaris Settings for Shearing Bacterial Genomic DNA by Focused Ultrasonication and Analysis Using Agilent 22 TapeStation Application Note Authors Richard Jeannotte, Eric Lee, Narine Arabyan,
Levels of genetic variation for a single gene, multiple genes or an entire genome
From previous lectures: binomial and multinomial probabilities Hardy-Weinberg equilibrium and testing HW proportions (statistical tests) estimation of genotype & allele frequencies within population maximum
Statistical Methods and Software for Forensic Genetics. Lecture I.1: Basics
Statistical Methods and Software for Forensic Genetics. Lecture I.1: Basics Thore Egeland (1),(2) (1) Norwegian University of Life Sciences, (2) Oslo University Hospital Workshop. Monterrey, Mexico, Nov
Lecture 1: Case-Control Association Testing. Summer Institute in Statistical Genetics 2015
Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2015 1 / 1 Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits.
Breeding Values and Inbreeding. Breeding Values and Inbreeding
Breeding Values and Inbreeding Genotypic Values For the bi-allelic single locus case, we previously defined the mean genotypic (or equivalently the mean phenotypic values) to be a if genotype is A 2 A
Genotype Imputation. Biostatistics 666
Genotype Imputation Biostatistics 666 Previously Hidden Markov Models for Relative Pairs Linkage analysis using affected sibling pairs Estimation of pairwise relationships Identity-by-Descent Relatives
DEVELOP YOUR LAB, YOUR WAY
Technical brochure DEVELOP YOUR LAB, YOUR WAY The FLOW Solution: Expand your potential today Redesign your lab with the FLOW Solution The FLOW Solution is a highly flexible modular, semi-automated data
Chem 4331 Name : Final Exam 2008
Chem 4331 Name : Final Exam 2008 Answer any seven of questions 1-8. Each question is worth 15 points for a total of 105 points. 1. A crime has been committed, and a blood sample has been found at the crime
TruSight Cancer Workflow on the MiniSeq System
TruSight Cancer Workflow on the MiniSeq System Prepare Library Sequence Analyze Data TruSight Cancer 1.5 days ~ 24 hours < 2 hours TruSight Cancer Library Prep MiniSeq System Local Run Manager Enrichment
Computations with Markers
Computations with Markers Paulino Pérez 1 José Crossa 1 1 ColPos-México 2 CIMMyT-México June, 2015. CIMMYT, México-SAGPDB Computations with Markers 1/20 Contents 1 Genomic relationship matrix 2 3 Big Data!
Phasing via the Expectation Maximization (EM) Algorithm
Computing Haplotype Frequencies and Haplotype Phasing via the Expectation Maximization (EM) Algorithm Department of Computer Science Brown University, Providence sorin@cs.brown.edu September 14, 2010 Outline
DNA commission of the International Society of Forensic Genetics: Recommendations on the interpretation of mixtures
Forensic Science International 160 (2006) 90 101 www.elsevier.com/locate/forsciint DNA commission of the International Society of Forensic Genetics: Recommendations on the interpretation of mixtures P.
2. Map genetic distance between markers
Chapter 5. Linkage Analysis Linkage is an important tool for the mapping of genetic loci and a method for mapping disease loci. With the availability of numerous DNA markers throughout the human genome,
for XPS surface analysis
Thermo Scientific Avantage XPS Software Powerful instrument operation and data processing for XPS surface analysis Avantage Software Atomic Concentration (%) 100 The premier software for surface analysis
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
How to analyze many contingency tables simultaneously?
How to analyze many contingency tables simultaneously? Thorsten Dickhaus Humboldt-Universität zu Berlin Beuth Hochschule für Technik Berlin, 31.10.2012 Outline Motivation: Genetic association studies Statistical
Introduction to analyzing NanoString ncounter data using the NanoStringNormCNV package
Introduction to analyzing NanoString ncounter data using the NanoStringNormCNV package Dorota Sendorek May 25, 2017 Contents 1 Getting started 2 2 Setting Up Data 2 3 Quality Control Metrics 3 3.1 Positive
Multiple paternity and hybridization in two smooth-hound sharks
Multiple paternity and hybridization in two smooth-hound sharks Ilaria A. M. Marino 1, Emilio Riginella 1, Michele Gristina 2, Maria B. Rasotto 1, Lorenzo Zane 1*, Carlotta Mazzoldi 1 1 Department of Biology,
Y-STR: Haplotype Frequency Estimation and Evidence Calculation
Calculating evidence Further work Questions and Evidence Mikkel, MSc Student Supervised by associate professor Poul Svante Eriksen Department of Mathematical Sciences Aalborg University, Denmark June 16
Your mass spec s sidekick
ZipChip Give your mass spec some zip Your mass spec s sidekick The ZipChip platform prepares and separates a wide range of biological samples, then electrosprays them into your mass spec for analysis.
A paradigm shift in DNA interpretation John Buckleton
A paradigm shift in DNA interpretation John Buckleton Specialist Science Solutions Manaaki Tangata Taiao Hoki protecting people and their environment through science I sincerely acknowledge conversations
Validation Overview. Presentation Outline. Overview of This Section. NIST and NIJ Disclaimer. NRC II Recommendation 3.1. Prepared by John M.
Presentation Outline Introductions: Presenters and Participants Validation Workshop Validation Overview John M. Butler, PhD National Institute of Standards and Technology (NIST) john.butler@nist.gov 301-975-4049
Multivariate analysis of genetic data an introduction
Multivariate analysis of genetic data an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London Population genomics in Lausanne 23 Aug 2016 1/25 Outline Multivariate
1. Understand the methods for analyzing population structure in genomes
MSCBIO 2070/02-710: Computational Genomics, Spring 2016 HW3: Population Genetics Due: 24:00 EST, April 4, 2016 by autolab Your goals in this assignment are to 1. Understand the methods for analyzing population
Pyrobayes: an improved base caller for SNP discovery in pyrosequences
Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The
Bridget Algee-Hewitt
Senior Research Scientist, Ctr for Comparative Studies in Race and Ethnicity (CCSRE) CONTACT INFORMATION Alternate Contact Email bridget.algee-hewitt@stanford.edu Bio BIO Bridget F.B. Algee-Hewitt is a
SNP Association Studies with Case-Parent Trios
SNP Association Studies with Case-Parent Trios Department of Biostatistics Johns Hopkins Bloomberg School of Public Health September 3, 2009 Population-based Association Studies Balding (2006). Nature
Targeted protein quantification
Targeted Quantitative Proteomics Targeted protein quantification with high-resolution, accurate-mass MS Highly selective Very sensitive Complex samples HR/AM A more complete quantitative proteomics picture
Unleash the Power of Real-Time PCR
The LightCycler 480 Real-Time PCR System Unleash the Power of Real-Time PCR Steven van Konynenburg Field Applications Specialist LightCycler 480 System Overview 1. General Description 2. LightCycler 480
Humans have two copies of each chromosome. Inherited from mother and father. Genotyping technologies do not maintain the phase
Humans have two copies of each chromosome Inherited from mother and father. Genotyping technologies do not maintain the phase Genotyping technologies do not maintain the phase Recall that proximal SNPs
Supporting Information Text S1
Supporting Information Text S1 List of Supplementary Figures S1 The fraction of SNPs s where there is an excess of Neandertal derived alleles n over Denisova derived alleles d as a function of the derived
Population Genetics. with implications for Linkage Disequilibrium. Chiara Sabatti, Human Genetics 6357a Gonda
1 Population Genetics with implications for Linkage Disequilibrium Chiara Sabatti, Human Genetics 6357a Gonda csabatti@mednet.ucla.edu 2 Hardy-Weinberg Hypotheses: infinite populations; no inbreeding;
GBLUP and G matrices 1
GBLUP and G matrices 1 GBLUP from SNP-BLUP We have defined breeding values as sum of SNP effects:! = #$ To refer breeding values to an average value of 0, we adopt the centered coding for genotypes described
Comparative Genomics of Fagaceae
Fagaceae Images.google.com Linkage Map www.quia.com TM www.clipartlord.com Selection of mapping parents SM2 SM1 Predominant pollinator? Progeny Exclusion for Full Sib Linkage Mapping Year Acorns genotyped
AUTHORIZATION TO LEND AND REPRODUCE THE THESIS. Date Jong Wha Joanne Joo, Author
AUTHORIZATION TO LEND AND REPRODUCE THE THESIS As the sole author of this thesis, I authorize Brown University to lend it to other institutions or individuals for the purpose of scholarly research. Date
NGS Made Easy. Optimize your NGS library preparation with the epmotion Automated liquid handling system
NGS Made Easy Optimize your NGS library preparation with the epmotion Automated liquid handling system NGS Library Preparation Made Easy and Reliable Next-generation sequencing sample preparation is a
Fei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
Variant visualisation and quality control
Variant visualisation and quality control You really should be making plots! 25/06/14 Paul Theodor Pyl 1 Classical Sequencing Example DNA.BAM.VCF Aligner Variant Caller A single sample sequencing run 25/06/14
For 5% confidence χ 2 with 1 degree of freedom should exceed 3.841, so there is clear evidence for disequilibrium between S and M.
STAT 550 Howework 6 Anton Amirov 1. This question relates to the same study you saw in Homework-4, by Dr. Arno Motulsky and coworkers, and published in Thompson et al. (1988; Am.J.Hum.Genet, 42, 113-124).
Recent advances in statistical methods for DNA-based prediction of complex traits
Recent advances in statistical methods for DNA-based prediction of complex traits Mintu Nath Biomathematics & Statistics Scotland, Edinburgh 1 Outline Background Population genetics Animal model Methodology
BIO Lab 5: Paired Chromosomes
Paired Chromosomes Of clean animals and of animals that are not clean.two and two, male and female, went into the ark with Noah as God had commanded Noah. Genesis 7:8-9 Introduction A chromosome is a DNA
The Minimum k-colored Subgraph Problem in Haplotyping and DNA Primer Selection
The Minimum k-colored Subgraph Problem in Haplotyping and DNA Primer Selection M.T. Hajiaghayi K. Jain K. Konwar L.C. Lau I.I. Măndoiu A. Russell A. Shvartsman V.V. Vazirani Abstract In this paper we consider
Navigating between patents, papers, abstracts and databases using public sources and tools
Navigating between patents, papers, abstracts and databases using public sources and tools Christopher Southan 1 and Sean Ekins 2 TW2Informatics, Göteborg, Sweden, Collaborative Drug Discovery, North Carolina,
A Strategy for an Unknown Screening Approach on Environmental Samples using HRAM Mass Spectrometry
A Strategy for an Unknown Screening Approach on Environmental Samples using HRAM Mass Spectrometry O. Scheibner, 1 P. van Baar, 2 F. Wode, 2 U. Dünnbier, 2 K. Akervik, 3 J. Humphries, 3 M. Bromirski 1
CRISPR-SeroSeq: A Developing Technique for Salmonella Subtyping
Department of Biological Sciences Seminar Blog Seminar Date: 3/23/18 Speaker: Dr. Nikki Shariat, Gettysburg College Title: Probing Salmonella population diversity using CRISPRs CRISPR-SeroSeq: A Developing
Q Expected Coverage Achievement Merit Excellence. Punnett square completed with correct gametes and F2.
NCEA Level 2 Biology (91157) 2018 page 1 of 6 Assessment Schedule 2018 Biology: Demonstrate understanding of genetic variation and change (91157) Evidence Q Expected Coverage Achievement Merit Excellence
MiSeq System. Denature and Dilute Libraries Guide
MiSeq System Denature and Dilute Libraries Guide Overview 3 Protocol A: Standard Normalization Method 4 Protocol B: Bead-Based Normalization Method 6 Denature and Dilute PhiX Control 7 Supplemental Information
Calculation of IBD probabilities
Calculation of IBD probabilities David Evans and Stacey Cherny University of Oxford Wellcome Trust Centre for Human Genetics This Session IBD vs IBS Why is IBD important? Calculating IBD probabilities
BIOINFORMATICS. Discrepancies in dbsnp confirmation rates and allele frequency distributions from varying genotyping error rates and patterns
BIOINFORMATICS Vol. 2 no. 7 24, pages 122 132 DOI: 1.193/bioinformatics/bth34 Discrepancies in dbsnp confirmation rates and allele frequency distributions from varying genotyping error rates and patterns
theta H H H H H H H H H H H K K K K K K K K K K centimorgans
Linkage Phase Recall that the recombination fraction ρ for two loci denotes the probability of a recombination event between those two loci. For loci on different chromosomes, ρ = 1=2. For loci on the
Performance of the RNA and the High Sensitivity RNA ScreenTape Assay for the Agilent 4200 TapeStation System
Performance of the RNA and the High Sensitivity RNA ScreenTape Assay for the Agilent TapeStation System Technical Overview Introduction The Agilent TapeStation system provides an automated system for fast
Getting Started. Starting the Game. Controls
1 Important Information Getting Started 2 Introduction 3 Game Modes Starting the Game 4 Main Menu 5 Saving and Erasing Data Controls 6 Basic Controls 7 Serving 8 Returning the Ball Types of Shots 9 Tennis
Processes of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
Achieve confident synthesis control with the Thermo Scientific ISQ EC single quadrupole mass spectrometer
APPLICATION NOTE 72385 Achieve confident synthesis control with the Thermo Scientific ISQ EC single quadrupole mass spectrometer Authors Stephan Meding, Katherine Lovejoy, Martin Ruehl Thermo Fisher Scientific,
of mass spectrometry
Thermo Scientific 253 Ultra High resolution isotope ratio MS Discover a new world of mass spectrometry Paleoclimatology Atmospheric science Biogeochemistry Petrology Discover the isotopic anatomy of molecules
THE RARITY OF DNA PROFILES 1. BY BRUCE S. WEIR University of Washington
The Annals of Applied Statistics 2007, Vol. 1, No. 2, 358 370 DOI: 10.1214/07-AOAS128 Institute of Mathematical Statistics, 2007 THE RARITY OF DNA PROFILES 1 BY BRUCE S. WEIR University of Washington It
Physical Science Packet Chapter 15: Composition of Matter
Physical Science Packet Chapter 15: Composition of Matter Name: Due: Date of Chapter 15 Test 1 Composition of Matter Study Guide Major topics on the test will include: A. Pure Substance vs. Mixtures a.
Part IVB Quality Assurance/Validation of Analytical Methods
1. Introduction Part IVB Quality Assurance/Validation of Analytical Methods 1.1 Definition and purpose of validation Validation is the confirmation by examination and the provision of objective evidence
Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5
Association Testing with Quantitative Traits: Common and Rare Variants Timothy Thornton and Katie Kerr Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 1 / 41 Introduction to Quantitative
Applications Note 224 April 2010
Applications Note 224 April 21 Validation of the Eppendorf epmotion 575 TMX System for use with the Applied Biosystems Prepfiler Automated Forensic DNA Extraction Kit Nicole Bolin, Melissa Beddow, MSFS,
Statistics 246 Spring 2006
Statistics 246 Spring 2006 Meiosis and Recombination Week 3, Lecture 1 1 - the process which starts with a diploid cell having one set of maternal and one of paternal chromosomes, and ends up with four
Lecture 9. QTL Mapping 2: Outbred Populations
Lecture 9 QTL Mapping 2: Outbred Populations Bruce Walsh. Aug 2004. Royal Veterinary and Agricultural University, Denmark The major difference between QTL analysis using inbred-line crosses vs. outbred
Objectives. Announcements. Comparison of mitosis and meiosis
Announcements Colloquium sessions for which you can get credit posted on web site: Feb 20, 27 Mar 6, 13, 20 Apr 17, 24 May 15. Review study CD that came with text for lab this week (especially mitosis
EXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?
Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population