Figure S1. UPGMA dendrogram of 24 isolates used in this study based on 17 alleles

Transcription

1 Figure S1. UPGMA dendrogram of 24 isolates used in this study based on 17 alleles from seven genomic microsatellite markers. The scale indicates percent distance. Asterisks indicate isolates with reduced sensitivity to propiconazole.

2 Figure S2. Neighbor Joining phylogenetic tree of amino acid sequences of ShCYP51B and other CYP51 paralogs (CYP51A, CYP51B, and CYP51C) from Becher et al. (1). Sclerotiniaceae (Botryotinia fuckeliana, Sclerotinia sclerotiorum and Monilinia fructicola) only possess one CYP51, CYP51B. The genomes of other species included encode up to three CYP51 paralogs. The Saccharomyces cerevisiae CYP51 homolog, ERG11, is also included. Scale bar equals 0.1 percent distance.

3 JQ Sclerotinia homoeocarpa ShatrD* AJ Botrytis cinerea BcatrD* AB Penicillium digitatum PMR1* AJ Aspegillus nidulans AnAtrE* AF Magnaporthe grisea MgABC1 AJ Mycosphaerella graminicola Mgatr2* X77589 Candida albicans CaCDR1* CAU63812 Candida albicans CaCDR2* AF Candida albicans CaCDR4 CAU89714 Candida albicans CaCDR3 YSCPDR5X Saccharomyces cerevisiae ScPDR5* Z68904 Aspergillus nidulans AnAtrA X66732 Saccharomyces cerevisiae ScSNQ2* AAL80009 Monilinia fructicola MfABC1* AJ Botrytis cinerea BcatrB* Z68905 Aspergillus nidulans AnAtrB* AB Botrytis cinerea BMR1 AJ Mycosphaerella graminicola Mgatr1* Z68906 Botrytis cinerea BcatrA 0.2 Figure S3. Neighbor Joining phylogenetic tree of amino acid sequences of other ABC transporters from subfamily G with the dataset of Hayashi et al., and including S. homoeocarpa ShatrD and Monilinia fructicola MfABC1 (2, 3). Asterisks indicate transporters known to be involved with the efflux of DMI fungicides. Scale bar equals 0.2 percent distance.

4 Table S1. Primer name A Primer Sequence B Description ShCYP51B_F CGCAACATTAGACAACACTC Amplification and sequencing primer for ShCYP51B ShCYP51B_R GTCAATGGACACGGACAAGG Same as above ShCYP51B1_int GCTGAAGGATGTAAATGCGGAGG Sequencing internal region of above ShCYP51B2_int GGTCAGCACTCATCGTCTTC Same as above ShCYP51Bup_F CTTATCGCAGGCCGCTAAACATTGTG Amplification, sequencing upstream of ShCYP51B ShCYP51Bup_R GGAAGTTTCGCAGCCTTCGTTGTTCTC Same as above ShCYP51Bup1_int TGTGTATGCTCATTGCTCGT Sequencing internal region of above ShCYP51Bup2_int CGCAACATTAGACAACACTC Same as above ShatrD_F ATGGCGACCTCGACACCCTTTGAGGTTTTG Amplification and sequencing primer for ShatrD ShatrD_R AAGGGGAGAAGAAGAAGTGGTTTAGGAAGAAATAG Same as above ShatrD_int1 CTTCCCTCAATTGACGGTATCGCAAACTTT Sequencing internal region of above ShatrD_int2 GCAGTTTGGCAAAAGAGTGAAGATAGA Same as above ShatrD_int3 ATCTACGAAGGACACCGGCGAATTTTT Same as above ShatrD_int4 ATTTTCCATTGGGACGAAGTCAACTAT Same as above ShatrD_int5 ATCGACTGGCCACAAACTTGGAAGAAC Same as above ShatrD_int6 TTCTACTTGTTCACTTTGGTTTGCACA Same as above ShatrD_int7 ACTTGGCTACTTCCACTGTTAGGGAAG Same as above ShatrD_int8 CGTCAACAAGTCAAAGCTACCTTGGCA Same as above ShatrDup_F GATGGAGATTGAGGTTGAGATTGAGATTGA Amplification, sequencing upstream of ShatrD ShatrDup_R CAGCATCATATCAATCCTTTCTTTGGATCG Same as above ShatrDup1_int TGTGTCTTATTTGACCTTGCATCGCCTTAC Sequencing internal region of above ShatrDup2_int TGTGTCTTATTTGACCTTGCATCGCCTTAC Same as above ShAct_QF TCGTGATTTGACCGATTACCTC Quantitative PCR of Actin as housekeeping gene ShAct_QR GGAGAAGCTTTGTTACGTTGC Same as above ShCYP51B_QF GATTATGCTCCGTCTTGCTTCA Quantitative PCR of ShCYP51B ShCYP51B_QR ACACTCCGTCTCCACACTCCA Same as above ShatrD_QF CGGTCTTCAAAGAAACGCTG Quantitative PCR of ShatrD gene ShatrD_QR CGCGAACTTCATACAGAGAACG Same as above SSR8045F GTCGTGGAGAGGAGAGGTGA Microsatellite 8045 primer SSR8045R AGATAGTGTTGGCTCGCGTT Same as above SSR8400F CTATTCTCGCGCATCCTCAT Microsatellite 8400 primer SSR8400R CACTTGCTAGGATACCGTCGA Same as above SSR5848F TTGGTGTAGGTGGAGGCTAGA Microsatellite 5848 primer SSR5848R AGTGCGTGAGTGAACGTGAG Same as above SSR30326F GCAATGAGTGAGCGTCTTGT Microsatellite primer SSR30326R TGGATGCGTTTGATGATATGA Same as above SSR20624F AGTTGGGCGAACGAATAAGA Microsatellite primer SSR20624R TGTTCTTTCTCCCTTTCAGCC Same as above SSR8569F CCTCTCGTTCCTGGTTTCAC Microsatellite 8569 primer SSR8569R TGGATGGATGGATGGATATTG Same as above SSR21791F CCATTCGTTCTATGGGTTCG Microsatellite primer SSR21791R GAATGGGAAGGAGAAGTCCC Same as above

5 A An F or R at the end of the sequence name indicates forward or reverse primer, respectively. Primer name ending in int indicates a primer used for sequencing interior portions of the amplicon. B Listed in 5 to 3 orientation. Literature Cited 1. Becher R, Weihmann F, Deising HB, Wirsel, SGR Development of a novel multiplex DNA microarray for Fusarium graminearum and analysis of azole fungicide responses. BMC Genomics 12: Hayashi K, Schoonbeek H, De Waard MA Expression of the ABC transporter BcatrD from Botrytis cinerea reduces sensitivity to sterol demethylation inhibitor fungicides. Pestic. Biochem. Phys. 73: Luo CX, Schnabel G The cytochrome P450 lanosterol 14ɑ-demethylase gene is a demethylation inhibitor fungicide reduced sensitivity determinant in Monilinia fructicola field isolates from Georgia. Appl. Environ. Microbiol. 74: