SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 Supplementary Information to: Structural basis for the selectivity of the external thioesterase of the Surfactin-Synthetase Alexander Koglin 1,2, Frank Löhr 1, Frank Bernhard 1, Vladimir R. Rogov 1,3, Dominique P. Frueh 2, Eric R. Strieter 2, Mohammad R. Mofid 4, Peter Güntert 1,5, Gerhard Wagner 2, Christopher T. Walsh 2, Mohamed A. Marahiel 4 and Volker Dötsch* 1 1 Institute of Biophysical Chemistry, J.W. Goethe-University, Frankfurt am Main, Germany 2 Dept. of Biological Chemistry & Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115, USA 3 Institutes of Protein Research Puschino, Russia 4 Dept. of Chemistry/ Biochemistry, Philipps University, Marburg, Germany 5 Frankfurt Institute for Advanced Studies, Frankfurt am Main, Germany * Corresponding author: vdoetsch@em.uni-frankfurt.de Based on the available information from NOESY spectra showing two sets of partially different NOEs and the specific selection of one state by complex formation with the native substrate (Supplementary Fig. 4), we built models of the assumed two individual states of the SrfTEII enzyme most likely representing an open and a closed state (Supplementary Fig. 7). The two models differ slightly in the angle of the C-terminal helix and noticeable in the helix-turn-helix motif. In the closed state, both elements show an inward movement leading to a more compact structure in which the active site is less accessible. In the open state the residues of the active site are less buried and become accessible to the solvent. This opening also uncovers an interaction surface (Fig. 3a), which allows a tight complex formation with the misprimed carrier protein (Fig. 3b). As discussed in the main text, these models are based on the assumption of only two different conformations and on guesses which stretches of double resonances belong to which conformation. 1

2 Supplementary Figure 1 Assigned 15 N HSQC spectra and conformational exchange of SrfTEII. The 15 N-HSQC spectrum was recorded on a Bruker Avance NMR-spectrometer operating at 900 MHz proton frequency equipped with a cryogenic 5 mm z-axis gradient triple resonance probe at 298 K. DSS (4, 4-dimethyl-4-silapentane-1- sulfonate) was used as internal chemical shift reference. The spectral width was set to 12.5 ppm in the proton and 35 ppm in the nitrogen dimension. A total of 2048 points in the direct and 1024 points in the indirect dimension were collected. Conformational exchange is evident from the existence of doubled signals for N-H cross peaks or considerable line broadening of single amino acid residues. In b the area of some of these double peaks is shown as enlarged inserts in the fully assigned 15 N-HSQC spectrum of SrfTEII. In a amino acid residues showing either double peaks (highlighted in red) or broad lines (colored gradient from yellow to orange) are shown on a ribbon presentation of the mean structure of SrfTEII. 2

3 Supplementary Figure 2 Structural bundle and secondary structure of SrfTEII. The CYANA 1,2 derived structural bundle of 20 models of SrfTEII is shown from its front view (a) and rotated by 180 (b). The structure is colored from N-terminus (blue) to C-terminus (red) and shows an α/β-hydrolase fold with a conserved seven stranded β-sheet packed between 4 structurally conserved α-helices, excluding the sequentially and structurally diverse helix-turn-helix or lid region (green). In c the secondary structure and solvent accessibility (white: accessible; blue: buried) are shown. The presentation of the mean secondary structure for the CYANA derived set of 20 structures of SrfTEII and the solvent accessibility is taken from PROCHECK ,4. 3

4 Supplementary Figure 3 Chemical shift deviations detected in titration experiments. The combined 15 N and 1 H chemical shift deviation of 15 N-HSQC based titration experiments 5 of 15 N-labeled SrfTEII with unlabeled Myristoyl-CoA (a), unlabeled holo-tycc3-t domain (b), unlabeled holo-tycc3-t domain loaded with a 4 -PP cofactor mimic, where the thiol is replaced by an amine to prevent hydrolysis by the thioesterase 6-8 and modified with Alanine as a substrate analogue (c) and holo-tycc3-t domain loaded with a non-hydrolysable 4 -PP cofactor mimic modified with the tripeptide PheProPhe (Chi Scientific, Maynard, USA) (d) are shown. The specific binding of Myristoyl-CoA by SrfTEII (a) supports the previously assumed second function of SrfTEII as the starter enzyme, being involved in the loading of the β-hydroxy-fatty acid onto the first C-domain 9. The recognition involves the regions around the active site residues of the catalytic triad (Ser86, Asp189 and His216) and the loop region around Gly140 and Gly141 within the sequentially diverse helix-turn-helix motif. No recognition by the 4

5 SrfTEII or rather no chemical shift changes for this titration experiment could be observed for the loop (Gly49 Thr59) surrounding the N-terminus. The interaction of SrfTEII with holo-tycc3-t domain (b) is comparably weak and involves the loop connecting Gly49 and Thr59. This loop region seems specifically involved in the recognition of T domains. The chemical shift deviation for Ser86 is set to the maximum and indicated as a red bar, since no chemical shift perturbation could be measured in the complex, due to severe line broadening. The comparison with the diagrams representing the NMR titration experiments with Ala-NH-holo-TycC3-T domain (c) and PheProPhe-NH-TycC3-T domain (d) reveals the selectivity for small substrates by the SrfTEII, as already demonstrated by kinetic data 10. The interaction of SrfTEII with PheProPhe-holo-TycC3-T-domain is limited to residues involved also in holo T-domain recognition, which supports the described selection of small substrates driven by the limited size of the cavity. For residues with resonances broadened beyond detection in the 1:1 SrfTEII, Ala-holo-TycC3-T-domain complex, the chemical shift deviation is set to the maximum and indicated as red bars. Chemical shift differences of amino acids showing chemical shift perturbations are shown as blue bars. 5

6 Supplementary Figure 4 Specific recognition of the native substrate by SrfTEII. The combined 15 N and 1 H chemical shift deviation of 15 N-HSQC based titration experiments of 15 N-labeled SrfTEII S86A with unlabeled acetyl-holo-tycc3-t domain is shown in the diagram. The comparably large chemical shift perturbations indicate a tight complex formation and specific recognition of the native substrate by SrfTEII. The comparison of the 15 N-HSQC spectra of the free (blue) and complexed (red) SrfTEII also demonstrates the selection of one of the two observed states in the 1:1-complex. The coloring of the surface (Δppm: > 0.2: blue; residues showing complete suppressed lines: red) indicates the compact recognition and interaction surface of the SrfTEII protein. Titrations of the mutant SrfTEII S86A enzyme with holo-t showed virtually the same results as the titration of wild type SrfTEII with holo-t, demonstrating that the stronger interaction with the acetyl-holo-t domain is not caused by the mutation. 6

7 Supplementary Figure 5 Structural comparison of SrfTEI and SrfTEII. The crystal structure of SrfTEI 11 (a; PDB code: 1JMK) compared to the NMR solution structure of SrfTEII (b) shows significant differences in the N-terminal part including the relative position of the first two β-strands. Both structures are color coded from blue (Nterminus) to red (C-terminus). The central figure represents the superposition of the full β-sheet and the helix-turn-helix motif of SrfTEI (shown in red) and the SrfTEII (shown in blue) proteins and highlights the repositioning of the shortened helix-turn-helix motif of the SrfTEII protein. 7

8 Supplementary Figure 6 Structural comparison of the active site cavities of SrfTEII and SrfTEI. The active site of the SrfTEII enzyme (a) is located in a shallow groove and is ideally suited to interact with small molecules attached to the 4 -PP cofactor of the holo-t domain. In contrast the crystal structure of SrfTEI 11 (b; PDB code: 1JMK) shows a deep and wide cavity that can accommodate the entire peptide attached to the cofactor. The catalytically active residues of both enzymes are colored in red. 8

9 Supplementary Figure 7 Structural Models of the opened (green) and closed (red) state of SrfTEII in comparison to the calculated NMR structure (blue helix-turn-helix motif). Based on the available information from NOESY spectra showing two sets of partially different NOEs and the specific selection of one state during the performed NMR titration experiments, we built approximate models of the assumed two individual states of the SrfTEII enzyme most likely representing an open (green) and a closed state (red). The two models differ in the helix-turn-helix motif. In the closed state, the helix-turn-helix motif (red) is showing an inward movement leading to a more compact structure in which the active site is less accessible. In the open state (green helix-turn-helix motif) the residues of the active site are less buried and become more accessible to the solvent, compared to the closed state and the calculated averaged structure represented as the structural bundle with the blue helixturn-helix motif. This opening also uncovers an interaction surface, which allows a tight complex formation with the misprimed T-domain. As discussed in the main text, these models are based on the assumption of only two different conformations and on titration-supported guesses which stretches of double resonances belong to which conformation. 9

10 Supplementary Figure 8 The interface between the T-domain and the SrfTEII shows a tight channel for accommodating the co-factor. A cut through the interface of the complex between the T-domain and the SrfTEII enzyme at the indicated position reveals a tight channel that is lined with the active site residues of the thioesterase. This channel is optimally suited for accommodating the modified co-factor and further emphasizes that large modifications of the co-factor (such as entire peptides) would lead to severe distortions of the tight interface between both domains. All structure presentations are generated using UCSF Chimera

11 Table 1 NMR and refinement statistics for the isolated SrfTEII NMR distance and dihedral constraints Distance constraints 2442 Total NOE 7802 Intra-residue 497 Inter-residue 1945 Sequential ( i-j = 1) 461 Medium-range (1< i-j < 5) 686 Long-range ( i-j 5) 798 Hydrogen bonds 92 dihedral angle constraints phi 139 psi 139 SrfTEII Structure statistics Violations (mean and s.d.) Distance constraints (Å) / Dihedral angle constraints ( ) / Max. dihedral angle violation ( ) 2.31 Max. distance constraint violation (Å) 0.21 CYANA target function value 4.9 Ų Average pairwise r.m.s.d (Å) 20 among 150 refined structures (residues 3-238) Heavy / Backbone /

12 Table 2 NMR and refinement statistics for the complex SrfTEII : TycC3-PCP SrfTEII TycC3-PCP NMR distance and dihedral constraints Distance restraints Total NOE Intra-residue Inter-residue Sequential ( i-j = 1) Non-sequential ( i-j > 1 ) Hydrogen bonds Protein protein intermolecular (H N (PCP):H FILV (TEII)) 23 Total dihedral angle constraints Protein phi psi Structure statistics Violations (mean and s.d.) Distance constraints (Å) / Dihedral angle constraints ( ) 3.4 +/- 1.2 Max. dihedral angle violation ( ) 4.8 Max. distance constraint violation (Å) 0.36 Average pairwise r.m.s.d.** (Å) 20 among 200 refined structures Protein complex Heavy / Backbone / Intermolecular interface / Complex Buried Surface Area (Ų) /- 280 intermolecular energies E tot (kcal/mol) /

13 References 1. Güntert, P., Mumenthaler, C. & Wüthrich, K. Torsion angle dynamics for NMR structure calculation with the new program DYANA. J. Mol. Biol. 273, (1997). 2. Güntert, P. Automated NMR structure calculation with CYANA. Meth. Mol. Biol. 278, (2004). 3. Laskowski R A, MacArthur M W, Moss D S & Thornton J M. PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst., 26, (1993). 4. Morris A L, MacArthur M W, Hutchinson E G & Thornton J M. Stereochemical quality of protein structure coordinates. Proteins, 12, (1992). 5. Zuiderweg, E. R. P. Mapping Protein-Protein Interactions in Solution by NMR Spectroscopy. Biochemistry 41, 1-7 (2002). 6. Belshaw, P. J.; Walsh, C. T. & Stachelhaus, T. Aminoacyl-CoAs as probes of condensation domain selectivity in nonribosomal peptide synthesis. Science 284, (1999). 7. Sieber, S. A.; Walsh, C. T. & Marahiel, M. A. Loading peptidyl-coenzyme A onto peptidyl carrier proteins: a novel approach in characterizing macrocyclization by thioesterase domains. J. Am. Chem. Soc. 125, (2003). 8. Meier, J. L.; Mercer, A. C.; Rivera, H. & Burkart, M. D. Synthesis and evaluation of bioorthogonal pantetheine analogues for in vivo protein modification. J. Am. Chem. Soc. 128, (2006). 9. Steller, S., Sokoll, A., Wilde, C., Bernhard, F., Franke, P. & Vater, J. Initiation of surfactin biosynthesis and the role of the SrfD-thioesterase protein. Biochemistry 43, (2004). 10. Schneider, A. & Marahiel, M.A. Genetic evidence for a role of thioesterase domains, integrated in or associated with peptide synthetases, in non-ribosomal peptide biosynthesis in Bacillus subtilis. Arch Microbiol. 169, (1998). 11. Bruner, S. D., Weber, T., Kohli, R. M., Schwarzer, D., Marahiel, M. A., Walsh, C. T. & Stubbs, M. T. Structural basis for the cyclization of the lipopeptide antibiotic surfactin by the thioesterase domain SrfTE. Structure 10, (2002). 12. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C. & Ferrin, T. E. UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 25, (2004). 13

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/312/5771/273/dc1 Supporting Online Material for Conformational Switches Modulate Protein Interactions in Peptide Antibiotic Synthetases Alexander Koglin, Mohammad R.

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

PROTEIN'STRUCTURE'DETERMINATION'

PROTEIN'STRUCTURE'DETERMINATION' PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

Biomolecules: lecture 10

Biomolecules: lecture 10 Biomolecules: lecture 10 - understanding in detail how protein 3D structures form - realize that protein molecules are not static wire models but instead dynamic, where in principle every atom moves (yet

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Substrate recognition by nonribosomal peptide synthetase multi-enzymes

Substrate recognition by nonribosomal peptide synthetase multi-enzymes Microbiology (2004), 150, 1629 1636 DOI 10.1099/mic.0.26837-0 Review Substrate recognition by nonribosomal peptide synthetase multi-enzymes Sylvie Lautru and Gregory L. Challis Correspondence Sylvie Lautru

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are

More information

Nature Structural & Molecular Biology: doi: /nsmb.3194

Nature Structural & Molecular Biology: doi: /nsmb.3194 Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

Supplemental Information

Supplemental Information Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao

More information

Details of Protein Structure

Details of Protein Structure Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

Useful background reading

Useful background reading Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns

More information

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

Sequential Assignment Strategies in Proteins

Sequential Assignment Strategies in Proteins Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei

More information

Physiochemical Properties of Residues

Physiochemical Properties of Residues Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

Packing of Secondary Structures

Packing of Secondary Structures 7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling

More information

BSc and MSc Degree Examinations

BSc and MSc Degree Examinations Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1 Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/309/5743/2054/dc1 Supporting Online Material for Structure of PTB Bound to RNA: Specific Binding and Implications for Splicing Regulation Florian C. Oberstrass, Sigrid

More information

A prevalent intraresidue hydrogen bond stabilizes proteins

A prevalent intraresidue hydrogen bond stabilizes proteins Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

Secondary and sidechain structures

Secondary and sidechain structures Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR

More information

Model Mélange. Physical Models of Peptides and Proteins

Model Mélange. Physical Models of Peptides and Proteins Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

Targeting protein-protein interactions: A hot topic in drug discovery

Targeting protein-protein interactions: A hot topic in drug discovery Michal Kamenicky; Maria Bräuer; Katrin Volk; Kamil Ödner; Christian Klein; Norbert Müller Targeting protein-protein interactions: A hot topic in drug discovery 104 Biomedizin Innovativ patientinnenfokussierte,

More information

NMR spectroscopy in the structure elucidation of natural productsthe Hassalidins

NMR spectroscopy in the structure elucidation of natural productsthe Hassalidins 2/50 NMR spectroscopy in the structure elucidation of natural productsthe assalidins Growing resistance against antibiotics is an increasing risk to public health New compounds or new scaffolds for lead

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Resonance assignment and NMR spectra for hairpin and duplex A 6 constructs. (a) 2D HSQC spectra of hairpin construct (hp-a 6 -RNA) with labeled assignments. (b) 2D HSQC or SOFAST-HMQC

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor

LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should

More information

The wonderful world of NUCLEIC ACID NMR!

The wonderful world of NUCLEIC ACID NMR! Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically

More information

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,

More information

Supporting Information

Supporting Information Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of

More information

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013

Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India. 1 st November, 2013 Hydration of protein-rna recognition sites Ranjit P. Bahadur Assistant Professor Department of Biotechnology Indian Institute of Technology Kharagpur, India 1 st November, 2013 Central Dogma of life DNA

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

SUPPLEMENTARY ONLINE DATA

SUPPLEMENTARY ONLINE DATA SUPPLEMENTARY ONLINE DATA Secreted Isoform of Human Lynx1 (SLURP-2): Spatial Structure and Pharmacology of Interaction with Different Types of Acetylcholine Receptors E.N. Lyukmanova 1,2,*, M.A. Shulepko

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

Supporting Information

Supporting Information Supporting Information German Edition: DOI: Sampling of Glycan-Bound Conformers by the Anti-HIV Lectin Oscillatoria agardhii agglutinin in the Absence of Sugar** Marta G. Carneiro, Leonardus M. I. Koharudin,

More information

[Urea] (M) k (s -1 )

[Urea] (M) k (s -1 ) BMB178 Fall 2018 Problem Set 1 Due: 10/26/2018, noon Office hour: 10/25/2018, SFL GSR218 7 9 pm Problem 1. Transition state theory (20 points): Consider a unimolecular reaction where a substrate S is converted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr

Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr 188 Bulletin of Magnetic Resonance Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr Chang-Shin Lee and Chin Yu* Department of Chemistry, National Tsing Hua University

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the

More information

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics. Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond

More information

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate

More information

Supporting Information. for. Angew. Chem. Int. Ed. Z Wiley-VCH 2002

Supporting Information. for. Angew. Chem. Int. Ed. Z Wiley-VCH 2002 Supporting Information for Angew. Chem. Int. Ed. Z19311 Wiley-VCH 2002 6941 Weinheim, Germany A highly enantioselective receptor for N-protected glutamate and anomalous solvent-dependent binding properties

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

More information

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain

More information

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

Basics of protein structure

Basics of protein structure Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu

More information

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat Redox-Responsive Complexation between a Pillar[5]arene with Mono ethylene oxide Substituents and Paraquat Xiaodong Chi, Min Xue, Yong Yao and Feihe Huang* MOE Key Laboratory of Macromolecular Synthesis

More information

Supplemental data for

Supplemental data for Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan

More information

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Experimental approach for enhancement of unbiased Fo Fc maps.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Experimental approach for enhancement of unbiased Fo Fc maps. Supplementary Figure 1 Experimental approach for enhancement of unbiased Fo Fc maps. a, c, Unbiased Fo-Fc maps of the Tth 70S post-catalysis complex at 2.55 Å resolution with (a) or without (c) bulk solvent

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Structural characterization of NiV N 0 P in solution and in crystal.

Structural characterization of NiV N 0 P in solution and in crystal. Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,

More information

Objective: Students will be able identify peptide bonds in proteins and describe the overall reaction between amino acids that create peptide bonds.

Objective: Students will be able identify peptide bonds in proteins and describe the overall reaction between amino acids that create peptide bonds. Scott Seiple AP Biology Lesson Plan Lesson: Primary and Secondary Structure of Proteins Purpose:. To understand how amino acids can react to form peptides through peptide bonds.. Students will be able

More information

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015 Biotechnology of Proteins The Source of Stability in Proteins (III) Fall 2015 Conformational Entropy of Unfolding It is The factor that makes the greatest contribution to stabilization of the unfolded

More information

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,

More information

Computational Protein Design

Computational Protein Design 11 Computational Protein Design This chapter introduces the automated protein design and experimental validation of a novel designed sequence, as described in Dahiyat and Mayo [1]. 11.1 Introduction Given

More information

Supersecondary Structures (structural motifs)

Supersecondary Structures (structural motifs) Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric

More information

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and

More information

DATE A DAtabase of TIM Barrel Enzymes

DATE A DAtabase of TIM Barrel Enzymes DATE A DAtabase of TIM Barrel Enzymes 2 2.1 Introduction.. 2.2 Objective and salient features of the database 2.2.1 Choice of the dataset.. 2.3 Statistical information on the database.. 2.4 Features....

More information

- Basic understandings: - Mapping interactions:

- Basic understandings: - Mapping interactions: NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis

More information

Molecular Modelling. part of Bioinformatik von RNA- und Proteinstrukturen. Sonja Prohaska. Leipzig, SS Computational EvoDevo University Leipzig

Molecular Modelling. part of Bioinformatik von RNA- und Proteinstrukturen. Sonja Prohaska. Leipzig, SS Computational EvoDevo University Leipzig part of Bioinformatik von RNA- und Proteinstrukturen Computational EvoDevo University Leipzig Leipzig, SS 2011 Protein Structure levels or organization Primary structure: sequence of amino acids (from

More information

Application of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor

Application of automated NOE assignment to three-dimensional structure refinement of a 28 kda single-chain T cell receptor Journal of Biomolecular NMR, 5: 0, 999. KLUWER/ESCOM 999 Kluwer Academic Publishers. Printed in the Netherlands. 0 Application of automated NOE assignment to three-dimensional structure refinement of a

More information

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target. HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

More information