The transcription factor MAFB antagonizes anti-viral responses by

Transcription

1 Supplementry normtion The trnscription ctor AFB ntgonizes nti-virl responses by blockde o coctivtor recruitment to RF3 wijin Kim & Brin Seed * Center or Computtionl nd ntegrtive Biology, sschusetts Generl ospitl, Boston A 2114, USA eprtment o Genetics rvrd edicl School, Boston A 2115, USA Phone: Fx: Emil: bseed@ccib.mgh.hrvrd.edu *Corresponding Author iling Address: CPZN , sschusetts Generl ospitl, 185 Cmbridge Street, Boston, A Phone: Fx: Emil: bseed@ccib.mgh.hrvrd.edu

2 12 1 ock AFB b 5 ock 4 b FN-β lucierse ctivity (old) n-β lucierse ctivity (RLU) None RG-(N) A5(N) None Poly(:C) None RG-(N) c Lucierse ctivity (old) ock AFB d NF-κB lucierse ctivity (old) ock AFB SRE SRE + poly(:c) RANTES RANTES + poly(:c) AP1 AP1 + poly(:c) ARE ARE + poly(:c) None Poly(:C) RG-(N) A5(N) y88 Supplementry Fig. 1

3 Supplementry Figure 1. AFB negtively regultes Type ntereron induction. () EC1B cells were trnsected with FN-β-Luc (1 ng) nd RG-(N) or A5(N) (1 ng ech) together with vector control or AFB expression plsmid (5 ng ech), nd lucierse ctivity ws mesured 32 h lter. (b) RAW cells were trnsected with mfn-β-luc (1 ng) together with empty control or mouse b (1 ng ech). Poly(:C) (25 μg/ml) ws dded t 24 h post-trnsection, nd RG-(N) (1 ng) ws cotrnsected t h. Lucierse ctivity ws mesured t 18 h ter stimultion. Equivlent results were obtined using J774A.1 cells (not shown). (c, d), Eect o AFB on ctivtion o (c) SRE-Luc, RANTES-Luc, AP1-Luc or ARE-Luc, nd (d) NF-κB- Luc by poly(:c), RG-(N), A5(N) or y ETN cells were trnsected with vector control or AFB expression plsmid (1 ng (c) or 5 ng (d) ech) together with the indicted lucierse reporter (1 ng ech). Poly(:C) ws dded t 24 h posttrnsection, nd RG-(N), A5(N) or y88 (1 ng ech) ws cotrnsected t h. Lucierse ctivity ws mesured t 48 h (c) or 32 h (d) post-trnsection. (, c, d), Lucierse ctivity ws mesured s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control without stimultion or ech reporter. (-d), t indicte the men nd the stndrd devition o t lest our within-plte replictes, nd results representtive o t lest two independent experiments re shown.

4 mrna (old) p <.4 p <.1 b +/ b / b Cspse 3 lucierse ctivity (old) p <.1 b +/ b / r7 Rig-. None Poly(:C) c A-AFB α-afb sh/sirna sh si-1 si-2 si-3 si-4 B: α-a d 2.5 e 2. FN-β lucierse ctivity (old) FN-β lucierse ctivity (old) ock α-afb shrna ock α-afb1 α-afb2 sirna α-afb3. ock α-afb3 el ock α-afb4 T-18 Supplementry Fig. 2

5 Supplementry Figure 2. Knockout or knockdown o AFB cilittes Type intereron induction. () Comprison o endogenous gene expression levels between b / nd b +/ EFs by RT-PCR. All smples were ssyed in triplicte. All vlues were normlized to β-ctin, nd the vlues o ech gene were urther normlized to the corresponding gene vlue rom b +/ EFs. t re expressed s men ± S, nd results representtive o t lest three independent experiments re shown. (b) Susceptibility o b / EFs to dsrna-induced poptosis. b / EFs were stimulted with poly(:c) (25 μg/ml), nd lucierse ctivity medited by ctive cspse 3 ws mesured t 8 h post-stimultion. Lucierse ctivity ws mesured s old increse reltive to the bsl level lucierse ctivity in b +/ EFs without stimultion. t indicte men ± S o t lest ive within-plte replictes, nd results representtive o t lest three independent experiments re shown. (c) AFB knockdown eiciency by α- AFB shrna or sirnas. 293ETN cells were trnsected with A-AFB in the bsence nd presence o α-afb shrna or sirnas, nd cell lystes were prepred t 72 h posttrnsection, ollowed by immunoblotting with nti-a ntibody. (d, e), Eect o AFB knockdown using α-afb shrna or sirnas on ctivtion o FN-β-Luc in (d) 293ETN nd (e) el or T-18 cells. Cells were trnsected with control, α-afb shrna (1 ng) or α-afb sirna (5 pmol) together with the lucierse reporter ((d) 1 ng nd (e) 25 ng). The cells were stimulted by poly(:c) (25 μg/ml) t 5 h (shrna) nd 6 h (sirna) post-trnsection, nd lucierse ctivity ws mesured 13.5 h lter. Lucierse ctivity ws mesured s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control or ech cell line. t indicte men ± S o t lest our within-plte replictes, nd results representtive o three independent experiments re shown.

6 FN-β lucierse ctivity (old) ock AFB RF3 RF3 + poly(:c) RF7 RF7 + poly(:c) RF3(5) RF3(5) + poly(:c) b Beore poly(:c) stimultion Ater poly(:c) stimultion (6 h) c Poly(:C) + + Loction cytoplsm nucleus cytoplsm nucleus B: α-afb Supplementry Fig. 3

7 Supplementry Figure 3. AFB intereres with RF3 nd RF7 ctivities. () Eect o AFB on ctivtion o FN-β-Luc medited by RF3, RF7 or RF3(5). 293ETN cells were trnsected with 1 ng o FN-β-Luc nd the expression vectors shown (1 ng ech). Poly(:C) (25 μg/ml) ws dded 24 h lter s indicted, nd lucierse ctivity ws mesured t 48 h post-trnsection (3 h or RF3(5)). Lucierse ctivity ws mesured s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control without poly(:c) stimultion or ech indicted expression vector (x-xis). t indicte men ± S o t lest our within-plte replictes, nd results representtive o t lest two independent experiments re shown. (b, c), Cellulr locliztion o RF3 nd AFB. (b) 293ETN cells were trnsected with pegfp-rf3 nd prfp-afb expression vectors, nd nlyzed using luorescence microscopy (63x resolution, Zeiss Axiopln 2) 36 h lter. (c) 293ETN cells were trnsected with AFB expression vector, nd nucler nd cytoplsmic extrcts were prepred using NE-PER Nucler nd Cytoplsmic Extrction Regents (PERCE) 36 h lter, ollowed by immunoblotting with nti-afb ntibody. Poly(:C) ws dded or 6 h s indicted.

8 P AFB AFB b A-AFB Poly(:C) + 4h Flg-tgged Empty RF3 RF3 RF7 TBK1 KKε RF7 TBK1 KKε P: α-afb B: α-rf3 Poly(:C) P: α-a B: α-flg B: α-afb B: α-flg B: α-rf3 B: α-a c istidine Repet Extended omology Region N-A C P/S/T-Rich Activtion omin (-N1) Bsic B (-N2) Leucine Zipper (AFB) (-C1) (-C2) Flg-RF A-tgged Empty -N1 -N2 -C1 -C2 AFB P: α-flg B: α-a B: α-flg B: α-a Supplementry Fig. 4

9 Supplementry Figure 4. AFB intercts with RF3. () nterction o endogenous AFB with endogenous RF3 in epg2 cells t the indicted times ter poly(:c) stimultion. mmunoblots using 6% o input lyste re lso shown. (b) Eect o poly(:c) stimultion on interction o A-AFB with Flg-RF3, -RF7, -TBK1 or -KKε. mmunoblots using 3% o input lyste re lso shown (middle nd lower pnels). (c) nterction o Flg-RF3 with A-tgged AFB deletion mutnts in 293ETN cells. A schemtic digrm o AFB nd its deletion mutnts is shown t the top. The bnds indicted by * denote nonspeciic bnds.

10 FN-α4 lucierse ctivity (old) 2 No Poly(:C) Poly(:C) ock AFB RF3 RF7 RF7 + AFB b N-Flg Constitutive Activtion omin (CA) NA Binding omin (B) (N1) (N2) Signl Response omin (SR) nhibitory omin () (N3) Virus-Activted omin (VA) RF7 C (C1) (C2) A-AFB Flg-tgged Empty N1 N2 N3 C1 C2 RF7 P: α-a B: α-flg B: α-flg B: α-a Supplementry Fig. 5

11 Supplementry Figure 5. AFB intercts with RF7. () Eect o AFB on ctivtion o FN-α4-Luc medited by RF3 or RF7. 293ETN cells were trnsected with 1 ng o FN-α4-Luc nd the expression vectors shown (1 ng ech). Poly(:C) (25 μg/ml) ws dded 24 h lter s indicted, nd lucierse ctivity ws mesured t 48 h posttrnsection. Lucierse ctivity ws mesured s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control without poly(:c) stimultion. t indicte men ± S o t lest our within-plte replictes, nd results representtive o two independent experiments re shown. (b) nterction o A-AFB with Flg-tgged RF7 deletion mutnts in 293 ETN cells. A schemtic digrm o ull-length RF7 nd its deletion mutnts is shown t the top. mmunoblot nlysis showed tht ll the RF7 deletion mutnts were eiciently expressed. The bnds indicted by * denote nonspeciic bnds.

12 Flg-RF b RF3(5) + + A-RF Poly(:C) + + AFB + AFB + P: α-a B: α-flg B: α-rf3 B: α-flg B: α-a c RF3-Flg d RF3(5)-Flg Flg-AFB α-flg Ab + + α-flg Ab + + AFB + + Probe P31 ARE Probe P31 SG15 e is-afb α-is Ab Probe P31 PRV-P31 ARE * Supplementry Fig. 6

13 Supplementry Figure 6. Eect o AFB on dimeriztion nd NA binding o RF3. (, b), Eect o AFB on RF3 dimeriztion. () 293ETN cells were trnsected with Flg- nd A-RF3 in the bsence nd presence o AFB coexpression. Poly(:C) ws dded 24 h lter s indicted, nd cell lystes were prepred t 36 h post-trnsection. (b) Ntive PAGE to detect RF3 imeriztion. 293ETN cells were trnsected with RF3(5) in the bsence nd presence o AFB coexpression. Cell lystes were prepred t 36 h post-trnsection, nd ntive PAGE in the presence o 1% deoxycholte ws perormed. onomeric or dimeric orm o RF3(5) ws immunoprecipitted with nti- RF3 ntibody. (c-e) ESA nlysis using (c) 293ETN-expressed nd immunopuriied C-terminl Flg-RF3 nd N-terminl Flg-AFB proteins (.4 μg ech), (d) EC1B nucler extrcts trnsected with C-terminl Flg-RF3(5) in the bsence nd presence o AFB coexpression, nd (e) in vitro trnslted N-terminl is-afb (4 μl). Puriied proteins or nucler extrcts were incubted with the indicted 32 P-lbeled probe. All the nucler extrcts were prepred in the presence o 1% deoxycholte in order to uncouple the eect o CBP (or p3) on RF3 NA binding. Binding speciicity ws determined by supershit ssy using nti-flg 2 ntibody (c, d) or nti-is ntibody (e).

14 5 No Poly(:C) b 12 No Poly(:C) FN-β lucierse ctivity (old) Poly(:C) ARE lucierse ctivity (old) Poly(:C) Control WT N248S Control WT N248S Control WT N248S Control WT N248S c Flg-RF3(394) Poly(:C) + + AFB + P: α-cbp B: α-flg d FN-β lucierse ctivity (old) No Poly(:C) Poly(:C) B: α-cbp. ock CBP (ng) + AFB (25 ng) ock CBP (ng) + AFB (1 ng) RF3 (1 ng) B: α-flg e 4 35 PPRE lucierse ctivity (old) ock AFB PPARγ PPARγ + AFB PGC1α PGC1α + AFB FN-β lucierse ctivity (old) g FN-β lucierse ctivity (old) ock CBP (ng) + RF3 (1 ng) Control WT K32R K297R K32,297R ock Control CBP (ng) + AFB (1 ng) WT K32R K297R K32,297R No Poly(:C) Poly(:C) Supplementry Fig. 7

15 Supplementry Figure 7. echnisms underlying AFB-medited suppression o Type FN induction. (, b) Eect o NA binding-deective mutnt o AFB (N248S) on ctivtion o () FN-β-Luc nd (b) ARE-Luc. 293ETN cells were trnsected with the indicted lucierse reporter (1 ng ech) nd AFB vrint vector (1 ng ech), nd poly(:c) ws dded 24 h lter. Lucierse ctivity ws mesured t 48 h post-trnsection s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control without poly(:c) stimultion. (c) Eect o AFB on the interction between Flg- RF3(394) nd endogenous CBP. 293ETN cells were trnsected with Flg-RF3(394) in the bsence nd presence o untgged AFB, nd poly(:c) ws dded 24 h lter s indicted. Cell lystes were prepred t 36 h post-trnsection, nd endogenous CBP ws immunoprecipitted using nti-cbp ntibody A22, ollowed by immunoblotting with nti-flg 2. (d) Eect o CBP overexpression on AFB-medited repression o the RF3-triggered FN-β ctivtion. 293ETN cells were trnsected with FN-β-Luc (1 ng) nd RF3 vector (1 ng) together with indicted mounts o AFB nd CBP expression vectors, nd poly(:c) ws dded 24 h lter. Lucierse ctivity ws mesured t 48 h post-trnsection s old chnge reltive to the lucierse ctivity in mock-trnsected control. The cses in the bsence nd presence o poly(:c) stimultion were independently normlized reltive to the respective mock-trnsected controls. (e) Eect o CBP coexpression on RF3- or AFB-medited ctivtion o FN-β-Luc. 293ETN cells were trnsected with FN-β-Luc (1 ng) nd RF3 or AFB vector (1 ng ech) together with indicted mounts o CBP expression vectors. () Eect o AFB on PPARγ or PGC1α-medited ctivtion o PPRE-Luc. 293ETN cells were trnsected with PPRE-Luc (5 ng) together with PPARγ or PGC1α vector (1 ng ech) in the bsence nd presence o AFB coexpression (1 ng). (e, ), Lucierse ctivity ws mesured t 48 h post-trnsection s old chnge reltive to the lucierse ctivity in mocktrnsected control. (g) Eect o sumoyltion-deicient mutnts o AFB on ctivtion o FN-β-Luc. 293ETN cells were trnsected with FN-β-Luc (1 ng) nd AFB vrint vector (1 ng ech), nd poly(:c) ws dded 24 h lter. Lucierse ctivity ws mesured t 48 h post-trnsection s old increse reltive to the bsl level lucierse ctivity in mock-trnsected control without poly(:c) stimultion. (, b, d-g), t indicte men ± S o t lest our within-plte replictes, nd results representtive o t lest two independent experiments re shown.

16 3 ock b 2. Untreted FN-β lucierse ctivity (old) Control Poly(:C) RG-(N) A5(N) AFB c-af(s) c-af(l) NRL AFA Stndrdized vlue (z) n-α/β r7 b c- Nrl Poly(:C) c 2. Untreted d 2. nctive SeV Stndrdized vlue (z) LPS Stndrdized vlue (z) Active SeV r7 b c- Nrl n-α/β r7 b c- Nrl e 2. Untreted 1 Stndrdized vlue (z) LPS mrna induction (old) r7 b c- Nrl g c-af expression (old) uh7 uh7 + CsA Clone A Clone A + CsA Probe 1 Probe 2 Probe 3 Time ter poly(:c) induction (h) FN-β AFB Supplementry Fig. 8

17 Supplementry Figure 8. Regultion o AFB expression in response to pthogenmimetic stimuli. () Eect o lrge AF trnscription ctors on ctivtion o FN-β-Luc by poly(:c), RG-(N), or A5(N). 293ETN cells were trnsected with FN-β-Luc (1 ng) nd indicted lrge AF expression vectors (1 ng ech). c-af(s) nd c-af(l) denote shorter nd longer isoorms o c-af, respectively. The trnsected cells were either stimulted with poly(:c) (25 μg/ml) 24 h lter, or cotrnsected with RG-(N) or A5(N) (1 ng ech) t h, nd lucierse ctivity ws mesured t 36 h posttrnsection s old increse reltive to the bsl level lucierse ctivity in mocktrnsected control beore stimultion. t indicte men ± S o t lest six withinplte replictes, nd results representtive o t lest two independent experiments re shown. (b-e), Regultory ptterns o expression o AFB nd other lrge AF trnscription ctors in response to pthogen-mimetic stimultion in vriety o cell types. (b) murine peritonel mcrophges in response to poly(:c) 1, n gonist or TLR3 nd A5, (c) murine RAW mcrophges in response to LPS 2, (d) murine tissue mcrophges in response to Sendi virus (SeV) 3, nd (e) murine spleen tissue in response to lipopolyscchride (LPS) 4, n TLR4 gonist. icrorry expression vlues were stndrdized (to Z-vlues) or ech probe set seprtely, nd dt re expressed s men ± S o ech tretment or ech indicted probe (x-xis). () n el cells, the levels o FN-β nd AFB mrnas were mesured by RT-PCR t the indicted times ter poly(:c) induction. All smples were ssyed in triplicte. Expression levels were normlized to β-ctin, nd urther normlized to the corresponding gene vlue beore poly(:c) stimultion. t re expressed s men ± S. (g) Expression ptterns o c- AF in nïve nd CV-replicon-contng (Clone A) uh7 cells. icrorry expression vlues (mesured in triplicte) 5 were normlized to the vlues o nïve uh7.

18 CBP RF3 (1-ε ih )k k pe CBP ε k ih k k d RF3 RNAP RNAP k elo FN-β RNAP k pe k d RF3 RF3 AFB k k pe ih RF3 AFB RNAP ih k pe ih RNAP k elo FN-β RNAP k d AFB k k d k k pe GTF k pe k elo RNAP AFB AFB RNAP RNAP FN-β b FN-β lucierse ctivity (RLU x 1 4 ) AFB (ng) No Poly(:C) Poly(:C) c RLU 2.5 x AFB (ng) Supplementry Fig. 9

19 d RLU 2 x AFB (ng) e Extent o AFB-medited nhibition (ε ih ) r = 1 r = 1.5 r = AFB (ng) x r = 1 r = 1.5 r = 2 g 2 x q = 1 q = q = (grdul) RLU RLU AFB (ng) AFB (ng) h RLU x k rtio = 1, q = 1 k rtio = 12.9, q = k rtio = 16., q = (grdul) AFB (ng) i RLU x 1 5 No Chnge ownregultion Time (hr) Supplementry Fig

20 j 2.5 x k = k = 3 * s 1 k = 3 * s 1 k RLU 1 ε ih Time (hr).25 k =.2 k = 3 * s 1 k = 3 * s Time (hr) l m % Reduction in ε ih RLU % RF3 Activtion k ( -1 s -1 ) % RF3 Activtion x k ( -1 s -1 ) n o % Chnge in RLU % RF3 Activtion 2 1 k ( -1 s -1 ) 3 % Chnge in RLU % RF3 Activtion 5 k ( -1 s -1 ) Supplementry Fig. 9

21 Supplementry Figure 9. themticl modeling o Type FN induction nd its regultion by AFB. () Schemtic illustrtion o the AFB-medited regultion o Type FN induction. (b) Eect o AFB on ctivtion o FN-β-Luc. 293ETN cells were trnsected with FN-β-Luc (1 ng) together with empty pcv control or the indicted mounts o AFB expression vector, nd poly(:c) (25 μg/ml) ws dded to cell medi 24 h lter s shown. Lucierse ctivity ws mesured t 44 h posttrnsection. t indicte men ± S o t lest ive within-plte replictes. (c, d), Nonliner lest-squre itting o the mthemticl model to the lucierse ctivity dt (rom (b)) in the bsence (c) nd presence (d) o poly(:c) stimultion. The dt (open circles) nd the best-it curve generted rom the model re shown. (e) ependency o AFB-medited inhibition o RF3-CBP pretition complex ormtion (ε ih = r r /( K + r ih )) on AFB concentrtion () nd the kinetic order o AFB intercting with RF3 (r) when K ih = s. () Eect o dierent ssumptions or r on model itting when K ih = s. (g) Eect o the AFB binding order to the FN-β promoter (q) on model AFB( ng ) 1 ( ) itting. grdul indictes q = q 1. (h) Eect o the processivity o n RF3- medited pretition complex ( 3 k ) on model itting. k rtio denotes 3 pe k pe / k pe. (i) Eect o virl elicitor-induced AFB downregultion on the FN-β ctivtion. The dt (open circles) nd time proiles o model-predicted lucierse ctivities re shown. Number on ech curve denotes AFB concentrtion (, 25 nd 75 ng). (j, k), Eect o RF3-AFB hetero-complex ormtion ( k ) on model-predicted (j) lucierse ctivities nd (k) ε ih. (l, m), Eect o k nd RF3 ctivtion rte on (l) percent reduction in the cpcity o AFB to inhibit the RF3-CBP pretition complex ormtion, deined s RE = 1*(ε ih,min ( k =) ε ih,min ( k )) / ε ih,min ( k =), nd (m) the corresponding FN-β lucierse ctivity. Results were obtined under the ssumption tht the RF3-AFB hetero-complex cn bind to the FN-β promoter with the sme rte constnt s tht o ree RF3. y-xis lbel is the percentge o the bseline vlue o RF3 ctivtion rte ( 3,in = molecule/min). (n, o) Eect o k nd RF3 ctivtion rte on the FN-β lucierse ctivity when the mounts o AFB overexpression were (n) ng nd (o) 75 ng. Results were obtined in the limit o zero binding o the RF3-AFB hetero-complex to the FN-β promoter. Percent chnges in the FN-β lucierse ctivity, deined s 1*(LA( k ) LA( k =)) / LA( k =), were plotted on z-xis. LA = lucierse ctivity. ence, positive (or negtive) number denotes tht the FN-β lucierse ctivity or given vlue is higher (or lower) thn the ctivity or =. k k

22 Reporter Trnscription ctor response element Reerence FN-β-Luc umn FN-β promoter ( 112 to 1) 6,7 FN-β-Luc(m) RF3 nd 7 binding-deicient humn FN-β promoter (substitution o PR-PR o FN-β-Luc with 8 GGCCAACTCCAAGGCCAAAGTCCCCGTG) PR-Luc PR moti o humn FN-β promoter (deletion o PR-PR nd PRV rom FN-β-Luc) mfn-β-luc urine n-β promoter (-125 to +55) 9 RANTES-Luc umn RANTES promoter (-397 to 15) 1 FN-α4-Luc umn FN-α4 promoter (-62 to 65) 1 P31CS-Luc 6x o consensus RF3 binding domin, 1 plus synthetic TATA element (stata) SRE-Luc 12x o SRE o SG54, plus stata 11 ARE-Luc 3x o consensus AF response element, plus stata 12,13 p53-luc 12x o p53-responsive element, plus stata 14 PPRE-Luc 3x o R1 element, plus stata 15 AP1-Luc* 4x o AP1 moti, plus stata 16 NF-κB-Luc* 4x o NF-κB moti, plus stata 17 (Gl4) 5 -Luc 5x o Gl4 binding site (pfr-luc, Strtgene) Supplementry Tble 1. Trnscriptionl lucierse reporters. An indicted response element ws inserted into the pgl4 vector (Promeg). * AP1 nd NF-κB motis were inserted into the peak vector.

23 Gene Forwrd () or Bckwrd (b) Sequence (5 3 ) mouse n-α 18 CCTTCCACAGGATCACTGTGTACCT b TTCTGCTCTGACCACCTCCC mouse n-β 18 CACAGCCCTCTCCATCAACT b TCCCACGTCAATCTTTCCTC mouse β-ctin 18 GGACTCCTATGTGGGTGACGAGG b GGGAGAGCATAGCCCTCGTAGAT AACGACCCCTTCATTGAC mouse Gpdh b TCCACGACATACTCAGCAC TTTCCTCGCCTGCTTCTTC mouse Emr1 b CCCCGTCTCTGTATTCAACC GAGACTGGCTATTGGGGGAG mouse r7 b GACCGAAATGCTTCCAGGG ATTGTCGGCGTCCACAAAG mouse Rig- b GTGCATCGTTGTATTTCCGCA AGCAGTTGGTGACCATGTCG mouse c- b TGGAGATCTCCTGCTTGAGG CTGGAACGGTGAAGGTGACA humn β-ctin b AAGGGACTTCCTGTAACAATGCA GGAGCCAAACGGGTCATCATCTC humn GAP b GAGGGGCCATCCACAGTCTTCT ACGCCGCATTGACCATCTATG humn FN-β b CGGAGGTAACCTGTAAGTCTGT GCCTCGCCCTTTGCTTTACT humn FN-α1 b CTGTGGGTCTCAGGGAGATCA GCAATGAGCAACTCCGACCTG humn c-af humn & mouse AFB b b GCCGGTCATCCAGTAGTAGTCT GACGCAGCTCATTCAGCAG CCGGAGTTGGCGAGTTTCT Supplementry Tble 2. Rel-time PCR Primers. Primer sequences were selected using the G PrimerBnk (pg.mgh.hrvrd.edu/primerbnk/) unless otherwise speciied.

24 Probe irection Sequence (5 3 ) P31 sense GAAAACTGAAAGGGAGAAGTGAAAGTG ntisense CACTTTCACTTCTCCCTTTCAGTTTTC PRV- sense AAATGACATAGGAAAACTGAAAGGGAGAAGTGAAAGTG P31 ntisense CACTTTCACTTCTCCCTTTCAGTTTTCCTATGTCATTT SG15 19 sense GATCGGGAAAGGGAAACCGAAACTGAAGCC ntisense GGCTTCAGTTTCGGTTTCCCTTTCCCGATC ARE 2 sense CATTTCTGCTGACTCAGCAACTTTA ntisense TAAAGTTGCTGAGTCAGCAGAAATG Supplementry Tble 3. Electrophoresis obility Shit Assy (ESA) probes

25 themticl odeling o AFB-medited Regultion o Type FN Activtion ss-ction Kinetic odel To develop insights into how AFB regultes the FN-β ctivtion triggered by RF3, we developed mechnistic kinetic model s ollows, which is schemticlly summrized in Supplementry Fig. 9: The model includes essentil etures o the RNA polymerse trnscription in vivo 21, such s recruitment o AFB nd RF3 to the FN-β promoter, ormtion o Pol pre-tition complexes, trnscription tition nd escpe o Pol rom the promoter nd potentil proximl puse sites, productive Pol elongtion nd nucler export o mture trnscripts nd their trnsltion. Further, the model includes mechnisms or interction o AFB nd RF3 both on the promoter nd in the nucleoplsm. Appendix A1 provides complete list o vribles nd prmeters used in the model.

26 d / dt = k d / dt = d d d 3 d d d d dr dr / dt = k / dt = k / dt = 3, in / dt = k CBP Elo N C / dt = ε k / dt = / dt = k / dt = k / dt = (1 ε ) k tl in elo R exp dl / dt = k R C 3 ih R k deg deg N q k k q pe Elo k + k L deg + q( k 3 k ih k d k pe R deg R deg L d k k d k R k + R C 3 ih pe N k k + k k k pe k pe + k pe R exp q d CBP R + k ih CBP N + k k d k ih + k k pe ih 3 k 3 d CBP ih pe + k pe k ih k + k + k 3 elo pe ih 3 Elo CBP + k ) + r( ε k ih pe + k ih pe ih + k ih pe (1) (3) (4) (5) (6) (7) (8) (9) (1) (11) (12) ) (2) LA = p L, LA r ih L r ε ih = r K + (A1) (A2) The model includes representing the FN-β promoter contng NA templtes, AFB proteins in the nucleoplsm, AFB-bound NA, AFBmedited pretition complex, 3 ctivted RF3 proteins in the nucleoplsm, 3 RF3- bound NA, CBP RF3-medited nd CBP-recruited pretition complex, RF3-medited but AFB-bound pretition complex, R N nd R C (lucierse or FN-β) mrnas in the nucleus nd cytoplsm, respectively, nd L lucierse (or FN-β) proteins. To describe ully productive RNA polymerse elongtion complexes, we deined new vrible Elo s NA-bound Pol complexes right ter escpes rom the FN-β promoter nd ny potentil proximl puse site nd t the beginning o productive elongtion cycle o Pol. This method then llows us to uncouple events occurring t or

27 ner promoter rom productively elongting Pol complexes, nd thereby mkes it theoreticlly possible to describe multiple productively elongting polymerse complexes on single gene, s observed in RNA polymerse trnscription, i.e., iller spreds 22. n uninected cells, endogenous AFB protein () is expressed t rte in, nd decys t rte k deg. AFB binds to nd dissocites rom the FN-β promoter () with k k d rte constnts nd, respectively. AFB-bound promoter ( ) then recruits generl trnscription ctors nd co-ctors to orm pretition complex ( ). We ssumed tht cells provide n excess o ll the required ctors, nd thus terms denoting these cellulr ctors were not explicitly include in the model. The pretition complex then undergoes trnscription tition nd escpes rom the promoter nd potentil proximl puse sites, t rte k pe. We ssumed tht only rction,, o Pol enters into the productive elongtion phse Elo ( 1, with = being completely bortive). n ddition, during this process AFB nd cellulr ctors were ssumed to be relesed rom NA such tht they cn prticipte in subsequent round o promoter recognition nd trnscription tition. Full-length trnscript (R N ) is produced Elo t rte k, nd then exported to the cytoplsm (R C elo ) t rte R R N, nd trnslted to k exp yield lucierse (or FN-β) proteins (L). First-order kinetics ws ssumed or the export process. Upon virus inection, ltent RF3 is ctivted nd ccumulted in the nucleus ( 3 ) t rte 3,in. RF3 then ctivtes the FN-β promoter ollowing the sme procedure s

28 described or AFB. Unlike AFB, however, RF3 irst recruits the CBP (or p3) coctivtor to orm n RF3-CBP pretition complex ( CBP ). CBP ws ssumed to be present in excess, nd thus ws not explicitly include in the model s n independent vrible. We showed in the present work tht AFB negtively regultes the FN-β ctivtion primrily by interering with the RF3-CBP interction (Fig. 4). We implemented this mechnism by ssuming tht AFB in the nucleoplsm blocks the RF3-medited CBP recruitment on the FN-β promoter with n extent ε ih ( ε ih 1, with ε ih = 1 being complete inhibition), presumbly in AFB concentrtiondependent mnner: the ormtion o unctionl pretition complex ( reduced by (1-ε ih ), nd insted AFB-bound RF3 pretition complex ( CBP ) is ) is produced t rte ε k 3 3 ih. We used ichelis-enten expressions to describe the dependence o ε ih on AFB concentrtion (Eqn. A12), where r denotes the binding order o AFB or its interction with RF3 on the FN-β promoter. t hs been shown tht RF3 coopertes with NF-κB, ATF2 nd c-jun, nd G (Y) to orm n stble enhnceosome on the FN-β promoter 23. We suspect tht this enhnceosome ormtion cn be credited, t lest in prt, or the displcement o wekly bound AFB rom the FN-β promoter upon virus inection, s observed in Fig. 4b nd d. n the model, we implemented this mechnism by llowing ctivted RF3 to bind to AFB-bound promoter ( ) t rte k (presumbly with 3 ih 3 k 3 ih k ), during which AFB is dissocited rom the promoter.

29 Pre-nection Stedy Stte By ssuming tht system vribles re t qusi-stedy stte prior to virus inection, reltions existing mong model prmeters cn be identiied, which cn be used to limit the rnges o vlues prmeters cn tke. For exmple, beore ny perturbtion o cells such s AFB overexpression nd virus inection, the endogenous AFB production rte ( in,s ) nd the mounts o ree NA ( s ) nd AFB-NA s complexes ( nd ) in dynmic equilibrium with endogenous AFB protein ( s ), s cn be clculted by the ollowing equtions: in, s s s = ( k, s = k deg = ( k deg deg = ( k deg s + k + k Tot ) k + k ( k deg pe + ) k Tot pe ) k k Tot pe + k k pe k + k + ) k pe ( k + k k ( k k s ( k s k pe + k ) pe + k ) pe s s ) s (13) (14) (15) (16) where the subscript s is used to denote qusi-stedy stte vlue beore cellulr perturbtion. Unless otherwise speciied, we ssumed tht the totl mount o NA templtes ( Tot ) remined constnt over the period o time considered in this study, i.e., Tot = constnt = + +. s s, s

30 odel Prmeters irect mesurements o the hl-lie (t 1/2 ) o AFB protein re not vilble. owever, bsed on n estimte or AFA (t 1/2 = 2.95 h) 24 nd unstble nture o AFB compred to AFA 25, we chose t 1/2 (AFB) = 1.5 h (or equivlently =.77 min -1 ). Becuse AFB interction kinetics with the FN-β promoter is not known, observtions mde on AFG interctions with ARE-relted sequences hve been dopted 26. While AFG exhibited considerbly dierent ties or dierent ARE sequences (with k deg highest ty to ARE25, k = 1.36* s -1 ), the dissocition rte constnts were very similr independent o the sequences ( = * 1-4 s -1 ). Bsed on weker binding o AFB to the PRV moti thn to ARE, s observed in Supplementry Fig. 6e, we chose k k d =.1 * 1.36* s -1 s bseline vlue. The model sensitivity to this prmeter will be discussed lter. We dopted the k d vlue or ARE25, i.e., k d = 3.13 * 1-4 s -1. We took tht the dimeter o 293 cell nucleus to be 5 μm when perorming unit conversion rom molr concentrtion to the number o molecules in the nucleus. For AFB pretition complex ormtion ( ), observtions mde on the interction o yest TF with the consensus TATA box sequence hve been dopted 27 : the hl-time o stble TF-TATA box complex ormtion ws 1 min t sturting k concentrtions o TF. We ssumed hl-time o 1 min (or equivlently =.6931 min -1 ). This vlue my serve s n upper bound or, since the TF-TATA complex ormtion becme slower s TF concentrtion decresed 27 nd the time required or recruitment o multiple cellulr ctors should be considered or better estimte. k k

31 The hl-lie o ctivted RF3 ws set to 5 h, n estimte in 293 cells 28. For ctivted RF3 binding to the FN-β promoter, we dopted n estimte or RF3(5), K d = 5.8 n 29. ue to the lck o direct mesurements o k nd k d, we chose 3 = = 3.13 * 1-4 s -1 such tht the binding ties o AFB nd RF3 cn be compred directly in k d k d terms o their ssocition constnts. The corresponding 3 k ws clculted s 3 k = / 5.4 * s (implying 4 (bseline)). For pretition complex ormtion, we ssumed the sme rte constnt or both RF3 nd AFB k k d k ( 3 = ). K 3 d k k Elo The rte constnt or synthesis o ull-length trnscript rom ( k ) ws pproximted by dividing typicl eukryotic RNA polymerse elongtion rte, 2-4 bses/s (3 bses/s ws pplied here), by the length o gene (1653 bp or lucierse) For the nucler export rte constnt ( R k exp ), we dopted n in vivo estimte or the rbbit β-globin gene, with hl-lie o min 33. n our nlysis we chose t 1/2 = 1 min elo (or equivlently R k exp =.693 min -1 ) in order to compenste or time dely ssocited with trnsltion tition nd the time required to rech stedy stte trnsltion tht were not explicitly include in the model. The stedy stte trnsltion rte ( k tl ) 34 ws obtined by dividing typicl eukryotic ribosome elongtion rte, 1 ~ 2 AA/min (2 AA/sec ws pplied here) 35, by the spce between eukryotic ribosomes, ~ 1 ribosome / 8 bses (or 1 protein product / 8 bses) 36, in poly-ribosoml sttes. The hl-lives o irely lucierse mrna nd protein were dopted rom estimtes in epg2 cells (6 h or mrna nd 3 h or protein) 37.

32 Estimtion o odel Prmeters Other model prmeters o the proposed model were chosen to mtch observtions in the present study, s will be explined below. We irst considered dt in Supplementry Fig. 9b, which show how the FN-β promoter ctivity depends on AFB concentrtion either in the bsence or presence o poly(:c) induction, nd were mesured t 44 h post-trnsection. 1 ng o the FN-β lucierse reporter used in the experiment corresponds to *1 9 plsmids. To mke progress with our nlysis, we ssumed tht only 1% o the totl NA dded to cell medi becomes vilble or trnscription tition, yielding *1 7 plsmids/4 x 1 4 cells plsmids/cell. irect mesurements o AFB expression rte per its expression vector re not vilble. owever, we ound tht the dependence o the FN-β promoter ctivity on AFB concentrtion ws close to liner beore poly(:c) stimultion (Supplementry Fig. 9b). Thereore, we ssumed tht AFB expression rte ( in ) increses linerly rom its endogenous vlue ( in,s ) s the mount o AFB expression vector increses, whose slope (s) needs to be speciied. For dynmic simultions o the model, we chose s = 1 molecules/cell s bseline vlue, which, together with the corresponding vlues or, nd (Eqn. s s, s 14-16), were used s the til conditions. in,s ws clculted using Eqn. 13, nd AFB binding to the FN-β promoter ws ssumed to be irst order with respect to AFB (q = 1). 3,in ws ssumed to be zero prior to poly(:c) stimultion, nd we estimted unknown prmeters, nd s by nonliner lest-squre itting o the proposed model to the k pe lucierse ctivity dt without poly(:c) stimultion (Supplementry Fig. 9b). To

33 convert the model prediction, the mount o lucierse protein (L) per cell, to the mesured quntity, lucierse ctivity (LA) per well, we simultneously estimted proportionl constnt p L, LA between these two quntities. The dt (open circles) nd the best-it curve generted rom the model re shown in Supplementry Fig. 9c; the corresponding prmeter estimtes re = *1-4, =.346 min -1 (t 1/2 2.3 min), s =.6619* in,s per 1 ng o AFB expression vector, nd = , with goodness-o-it (R 2 ) = k pe p L, LA To it the model to the lucierse ctivity dt with poly(:c) stimultion (Supplementry Fig. 9b), we mde the ollowing pproximtions: irst, RF3 ctivtion upon poly(:c) stimultion nd its trnsient nture were modeled by using pulse input signl or 3,in, o which durtion nd mgnitude need to be speciied. n ddition, we ssumed tht non-zero vlue o 3,in begn t one hour post-stimultion to consider the time required or phosphoryltion nd nucler locliztion o ltent RF3. We chose one hour o pulse durtion such tht model predictions o the level o cytoplsmic mrna (R C ) pek round h post-stimultion, s observed in Fig. 1d. The pulse mgnitude remins to be speciied. Second, we ssumed 3 = such tht the eiciencies o k pe k pe AFB- nd RF3-tited trnscriptions cn be compred directly in terms o 3 3. Under this ssumption, is expected to be greter thn since the RF3 enhnceosome-dependent recruitment o CBP hs been known to medite the recruitment o SW nd SNF nd bsl trnscription ctors, which in turn cilitte nucleosome repositioning nd trnscription tition 38. Third, or the extent o AFB-medited nd

34 inhibition o CBP recruitment by RF3 on the FN-β promoter (ε ih = r /( + r )), two prmeters K ih nd r should be speciied. We ssumed K ih = s, which indictes tht 5% o the RF3-medited CBP recruitment is blocked with the endogenous level o AFB beore poly(:c) stimultion, i.e., ε ih =.5 when = s. For the order o AFB intercting with RF3 on the FN-β promoter (r), it hs been suggested tht AFB cn orm homodimer or heterodimers with other bzp proteins 13,39, implying tht 1 r 2. Unless otherwise speciied, we ssumed second-order kinetics with respect to AFB (r = 2). Fourth, the AFB-bound RF3 pretition complex ( ) ws ssumed to behve ih ih similr to the AFB-tited pretition complex, i.e., = nd =. Fith, we ssumed tht ctivted RF3 binds to AFB-bound promoter ( rte constnt s to AFB-Free promoter (), i.e., k 3 ih = ) with the sme. Sixth, we ssumed tht the endogenous AFB production rte ( in,s ) remins constnt irrespective o poly(:c) stimultion. Vlidity o these ssumptions nd the model sensitivity to vritions in these nd other prmeter vlues will be discussed lter. Under these ssumptions, we 3 k r K ih k pe k pe estimted prmeters 3 nd 3,in by nonliner lest-squre itting o the model to the post-stimultion dt, s shown in Supplementry Fig. 9d; the corresponding prmeter estimtes re =.54 nd 3,in = molecule/min with R 2 3 = Numericl integrtion o the system o ordinry dierentil equtions nd nonliner lest-squre itting o the model to the dt were perormed using ATLAB. Appendix A2 provides complete list o prmeters used in the simultion.

35 Prmeter Sensitivity Anlysis We investigted how dierent ssumptions or vritions in some prmeter vlues cn impct estimtion o other prmeters nd resulting model predictions. First, to ssess the sensitivity o our model to vritions in ε ih -relted prmeters r nd K ih, we vried r over the rnges o 1-2, nd estimted K ih, together with 3 nd 3,in, by nonliner lest-squre itting o the model to the post-stimultion dt. The best-it prmeter estimtes re s ollows: or r = 1, K ih =.53* s (nd 3 =.2492, 3,in = molecule/min with R 2 =.9251). For r = 1.5, K ih =.13* s ( 3 =.517, 3,in = molecule/min with R 2 =.9693). For r = 2, K ih =.22* s ( 3 =.366, 3,in = molecule/min with R 2 =.9869). These results indicte tht or the physiologicl rnge o r vlues, n optiml K ih is typiclly locted in rnge less thn s (K ih < s ), implying tht even the endogenous level o AFB ( s ) is exerting considerble inhibitory eect on the RF3-medited CBP recruitment: ε ih >.94 or r = 1-2 nd AFB overexpression ng. owever, we resoned tht it is not physiologicl tht nerly complete inhibition o the RF3 ctivity cn be chieved even with endogenous AFB. Thereore, to mke progress with our nlysis, we ssumed K ih = s such tht endogenous AFB cn chieve only 5% inhibition o the RF3 ctivity (ε ih =.5 when = s ). Supplementry Fig. 9e shows the dependence o the extent o AFB-medited inhibition o RF3-CBP pretition complex ormtion on the FN-β promoter (ε ih ) on AFB concentrtion or dierent vlues o r. Under this ssumption, the best-it curve ws obtined with r = (nd 3 =.47 nd 3,in = molecule/min, with R 2 =.9682), nd or r , higher r vlue yielded better

36 model-it (R 2 ) (Supplementry Fig. 9): or r = 1, R 2 =.8115 (with 3 =.43 nd 3,in = molecule/min). For r = 1.5, R 2 =.92 (with 3 =.123 nd 3,in = molecule/min). For r = 2, R 2 =.9425 (with 3 =.54 nd 3,in = molecule/min). For this reson, combined with the potentil o AFB to orm homo- or hetero-dimer 13,39, we chose r = 2 nd the corresponding estimtes o bseline vlues o our nlyses unless otherwise speciied. nd 3,in s We next exmined how the proposed model is ected by vritions in the AFB binding constnt to the FN-β promoter ( ). For exmple, when we ssumed =.5 * 1.36* s -1 (implying k k ), the best model it to the pre-stimultion dt k ws obtined with = 2.695*1-4, =.2159 min -1 (t 1/ min), s = k pe k.6619* in,s per 1 ng o AFB vector nd p L,LA = , with R 2 = This result suggests tht the primry eect o incresing n til ssumption o the AFB binding constnt ws decrese in the time required to produce ully productive Pol k elongtion complex ( Elo ) rom (or equivlently n increse in ) such tht the k pe dependence o the FN-β promoter ctivity on AFB concentrtion in the bsence o poly(:c) stimultion remins qulittively the sme, lthough lower vlue or the proportionl constnt p L,LA ws required becuse o n overll incresed yield o lucierse protein (L). The corresponding best estimtes o RF3-relted prmeters were 3 =.36 nd 3,in = molecule/min with R 2 = n spite o these quntittive chnges, one o the key properties o the system, the reltive eiciency

37 between RF3- nd AFB-medited trnscriptions ( 3 / ), remined very similr: 3 k / 13.4 or =.5 * 1.36* s -1 k, s compred to / 12. or =.1 * 1.36* s -1. We lso investigted how the proposed model is ected by dierent ssumption in the NA trnsection eiciency. For exmple, when we ssumed 1% trnsection eiciency (or equivlently plsmids/cell per 1 ng o the FN-β reporter), the best estimtes or AFB-relted prmeters (or k =.1 * 1.36* s -1 ) were = *1-5, =.346 min -1 (t 1/2 2.3 min), s =.6619* in,s per k pe pl,la 1 ng o AFB vector nd = 1.583, with R 2 = For RF3 prmeters, = *1-4 nd 3,in = molecule/min with R 2 =.9156 were obtined. Although individul trnscription eiciencies ( nd 3 ) per NA templte were reduced to preserve the overll dependence o the FN-β promoter ctivity on AFB 3 concentrtion in this incresed NA environment, their rtio ( / ) remined essentilly the sme independent o trnsection eiciency: 3 / 13.1 or 1% trnsection, s compred to 3 / 12. or 1% trnsection. Tken together, essentil system etures remined invrint under dierent ssumptions in unknown prmeter vlues, indicting the robustness o the proposed model nd nlysis methods. We lso exmined how dierent ssumptions in ect the model. We ound tht the primry consequence o ssuming tht AFB-bound ih

38 RF3 pretition complex hs similr trnscription eiciency to AFB pretition ih complex ( = ) ws to prevent the FN-β promoter ctivity rom being hypersensitive to AFB concentrtion, resulting in n improved model it to the dt, s compred to the ssumption o completely bortive trnscription ( ih = ). For this ih reson, we ssumed = unless otherwise speciied. dentiiction o Key System Prmeters We observed tht ter certin threshold o AFB concentrtion (5-1 ng), the AFB-medited inhibition o the FN-β ctivtion becme less eicient s AFB concentrtion incresed (Supplementry Fig. 9b nd d). Although this pprent increse in the FN-β promoter ctivity with incresing AFB did not rech sttisticlly signiicnt level, or exmple, p.12 (one-wy ANOVA) or AFB 1 ng, we consistently observed this phenotype. We resoned tht it might be cused by the binding o AFB to the FN-β promoter with kinetic order greter thn one with respect to AFB (q > 1). To exmine this, we re-estimted the AFB binding order to NA (q) while other prmeters were kept t their bseline vlues (K ih = s, r = 2, 3 =.54 nd 3,in = molecule/min), yielding slightly improved model-it, R 2 =.9512 or q = , s compred to R 2 =.9425 when q = 1 (Supplementry Fig. 9g). owever, it is more likely tht higher order binding o AFB to NA occurs only ter certin threshold level o AFB is reched, presumbly in AFB concentrtion-dependent mnner. ere we implemented this mechnism by ssuming tht the AFB binding order (q) grdully increses rom q = 1 t AFB = 1 ng to AFB( ng ) 1 ( ) 1 q = q s AFB

39 concentrtion increses. The ormul or q ws chosen such tht the q vlue t AFB = 15 ng hs the geometric men o those t AFB = 1 ng nd 2 ng. The q vlue ws then re-estimted while other prmeters ixed, yielding q = with slight improvement in the model-it (R 2 =.956). t lso cptured qulittive etures o the dt better thn the ixed q vlues. Similr results were obtined with dierent ssumptions o the AFB binding constnt ( k ) nd trnsection eiciency. For exmple, when =.5 * 1.36* s -1, the best estimtes o q were q = k with R 2 =.9529, nd q = or AFB( ng ) 1 ( ) 1 q = q with R 2 =.958, s compred to R 2 =.9411 or q = 1. When we ssumed 1% trnsection eiciency (with =.1 k * 1.36* s -1 ), q = with R 2 =.9369, nd q = or q = q AFB( ng ) 1 ( ) 1 with R 2 =.9356, s compred to R 2 =.9156 or q = 1. These results support the view tht the threshold-dependent higher order binding o AFB to the FN-β promoter is responsible, t lest in prt, or the observed increse in the post-stimultion ctivity o the FN-β promoter with incresing AFB. Next, we loosened the ssumption o 3 = to explore the possibility tht the RF3-medited recruitment o CBP nd the resulting chromtin remodeling my improve k pe k pe the processivity o Pol to enter productive elongtion ( 3 > ) s well s its eiciency ( 3 > 12* ). We ound tht re-estimtion o k 3 nd q, while other prmeters were ixed ( 3 =.54 nd 3,in = molecule/min), improved the model it only slightly: R 2 =.9545 when q = nd *, s compred to k pe k pe pe k pe k pe

40 R 2 =.9425 or q = 1 nd R 2 =.9512 or q = when 3 =. owever, when 3 3 ws llowed to chnge together with nd q or ixed 3,in (= molecule/min), the model it ws substntilly improved, yielding R 2 =.9811 when q = , * k nd =.38, nd it ws urther improved by ssuming k pe pe k pe k pe k pe q = q AFB(ng ) 1 ( ) 1, yielding R 2 =.9825 when q = (or AFB( ng ) 1 ( ) 1 q = q ), 3 k pe 16.* nd 3 =.37 (Supplementry Fig. 9h). Under these conditions, the rtio k pe o overll productivity o RF3- nd AFB-medited trnscriptions (PR = k 3 / pe k pe ) re PR 19.1 with 3 / 8.5 or q = , nd PR with 3 / 8.2 or ( ng ) 1 ( ) q AFB 1 = q with q = These results suggest tht rpid cellulr induction o FN-β upon virus inection cn be credited, t lest in prt, to highly productive RF3-medited trnscription tht results rom both the enhnced processivity nd higher eiciency o n RF3-medited pretition complex on the FNβ promoter compred to its bckground levels. We next investigted the eect o cellulr regultion o AFB expression in response to virus inection on the FN-β ctivtion. To exmine this, we ssumed tht in cn tke new vlue beginning t one hour post-stimultion nd is kept t this vlue until the mesurement time. We ound tht the contribution o AFB down-regultion ( reduced in ), s observed in Fig. 5, to the RF3-medited FN-β ctivtion ws more signiicnt or lower AFB concentrtion. For exmple, when AFB expression ws ssumed to be down-regulted by 25% upon poly(:c) stimultion ( in =.75* in,s ),

41 with other prmeters ixed t the bseline vlues (q = 1, 3 =.54 nd 3,in = molecule/min), we could obtin bout 2.5% increse in the FN-β ctivtion or the endogenous level o AFB, nd this stimulting eect grdully dimshed s the AFB concentrtion incresed (Supplementry Fig. 9i). This phenotype is relection o the dependence o ε ih on AFB concentrtion, supporting our indings tht AFB- RF3 interction nd the resulting inhibition o RF3-medited CBP recruitment is one o the principle mechnisms by which AFB ntgonizes the intereron response. n summry, the potency o AFB s n inhibitor o the FN-β induction is determined by the reltive contributions o the eects o high order AFB-RF3 interction on the promoter nd low order AFB-promoter interction. These ctors ect the FN-β promoter ctivity in opposing directions, leding to n typicl dose response curve o AFB tht suggests the existence o rnge o AFB concentrtion tht mmizes virus-induced FN-β ctivtion (Supplementry Fig. 9b nd d). At low level o AFB, such s the endogenous level in 293 cells, AFB binds wekly to the FN-β promoter, probbly ollowing ner irst-order kinetics with respect to AFB (q 1), nd thereore its contribution to the FN-β promoter ctivity s n ctivtor my be mml. owever, AFB my still interct with RF3 s homodimer (r = 2) on the promoter, exerting substntil inhibitory eect on RF3-medited recruitment o CBP upon virus inection. AFB downregultion, depending on cell type, my serve s mechnism to relieve this inhibitory eect o AFB. For n intermedite level o AFB, incresing AFB generlly leds to more potent inhibition o the FN-β ctivtion by enhncing interction o AFB with RF3 on the promoter nd thereby incresing the

42 extent o inhibition o the RF3-CBP pretition complex ormtion (ε ih ). owever, this improvement in AFB-medited inhibition dimshs s AFB concentrtion increses. n ddition, the FN-β stimulting eect o virus-induced AFB downregultion grdully dimshes with incresing AFB. Once certin threshold level o AFB is reched, the binding o AFB to the FN-β promoter my begin to ollow higher order kinetics (q > 1), presumbly cused by replcement o heterodimer o AFB nd bzp protein lcking trnsctivtion potentil, such s smll AF protein, with AFB homodimer or simply by potentil nonlinerity in AFB-NA interction itsel. As result, the ormtion o AFB-NA complex becomes ccelerted with incresing AFB. By contrst, AFB-medited inhibition o RF3-CBP interction becomes nerly sturted (ε ih 1), nd thus no signiicnt improvement in this inhibition cn be chieved with incresing AFB concentrtion. Thereore, once the eect o the enhnced AFB- NA complex ormtion domintes, the pprent ctivity o n extr mount o AFB becomes wek but FN-β stimultory, rther thn FN-β inhibitory, cused by its wek trnsctivtion potentil. We lso resoned tht this pprent FN-β stimulting ctivity o AFB might be chieved by reduced hl-lie o ctivted RF3. owever, under the current pproximtion tht trnsient RF3 ctivtion ws modeled by using pulse input or 3,in with durtion o one hour, no detectble improvement in model it ws observed or incresed decy rtes o ctivted RF3 (dt not shown). Eects o RF3-AFB etero-complex Formtion in the Nucleoplsm We extended the model to study how interction between RF3 nd AFB in the nucleoplsm my ect the FN-β ctivtion. We deined new vrible s protein

43 complex o ctivted RF3 nd AFB in the nucleoplsm, which is distinct rom, RF3-medited but AFB-bound pretition complex on the FN-β promoter. n ddition, the proposed model ws modiied s ollows: d / dt = k d / dt = RS o (1) k d / dt = RS o (2) r( k d d 3 d / dt = RS o (3) k / dt = RS o (5) ( k 3 d / dt = RS o (6) + k r k ( k ih 3 deg 3 r + k r k + k deg k d ih ) k d ) + rk ) + k deg k ih + ( q + r) k ih (17) (1') (2') (3') (5') (6') An ctivted RF3 (n RF3 homodimer) binds to nd dissocites rom r*afb (r = 2 in the simultion) in the nucleoplsm with rte constnts nd, respectively. k k d For k d, we dopted n estimte or the ormtion o heterodimeric leucine zipper t intermedite ionic strength, k d =.2 s -14. We ssumed tht RF3 nd AFB in decy with the sme rte constnts s those o the corresponding unbound orms, k nd, respectively, nd tht RF3 is recovered rom once AFB is decyed becuse o > deg deg k deg k deg 3* k. As irst pproximtion we ssumed tht cn bind to both ree () nd AFB- bound ( ) promoters with the sme rte constnts s those o ree RF3, 3 nd 3, respectively, during which AFB is relesed rom both nd exmine the cse in which hs reduced binding ties to the promoters. k k ih. Lter, we will

44 Under these conditions, we exmined how the poly(:c)-induced FN-β ctivtion could be ected by the extent o RF3-AFB hetero-complex ormtion, s speciied by k, with other prmeters ixed t the bseline vlues (q = 1, r = 2, =.54 nd 3,in = molecule/min). Supplementry Fig. 9j shows the time proiles o modelpredicted FN-β lucierse ctivities or the cse without AFB overexpression. The hetero-complex ormtion enhnces the FN-β ctivtion, which is cused by decrese in the level o ree AFB vilble or the inhibition o RF3-medited CBP recruitment on the FN-β promoter nd the resulting reduction in ε ih (= r r /( + r )) (Supplementry Fig. 9k). The observed decrese in ε ih is lso contributed by trnsient consumption o ree AFB or the inhibition o the RF3-CBP pretition complex ormtion, s evidenced by the proile or no hetero-complex ormtion ( = ). To quntiy how much the hetero-complex ormtion contributes to the totl decrese in ε ih, we considered the dierence between the trnsient mmum vlues o ε ih obtined with certin vlue nd =. We lso deined percent reduction in the cpcity o k AFB to inhibit the RF3-CBP pretition complex ormtion (RE) s RE = k k k k 1*(ε ih,min ( =) ε ih,min ( )) / ε ih,min ( =), where RE = denotes tht the heterocomplex ormtion hs no eect on the inhibitory cpcity o AFB, wheres RE = 1 k K ih % denotes tht there is complete loss o the AFB inhibitory cpcity (ε ih,min ( ) = ). Supplementry Fig. 9l nd m shows how RE nd the corresponding FN-β lucierse ctivity re ected by the extent o the hetero-complex ormtion ( ) or rnge o the production rte o ctivted RF3 (or equivlently RF3 ctivtion rte), 3,in, where the percentge o the bseline vlue o 3,in (= molecule/min) is shown on y-xis. k k