Involvement of two-component signalling systems in the regulation of stomatal aperture by light in Arabidopsis thaliana

Transcription

1 Research Involvement of two-component signalling systems in the regulation of stomatal aperture by light in Arabidopsis thaliana Elodie Marchadier 1,2 and Alistair M. Hetherington 1 1 Department of Biological Sciences, University of Bristol, Woodland Road, Bristol, BS8 1UG, UK; 2 INRA-Institut National de la Recherche Agronomique, UMR 1318, Institut Jean-Pierre Bourgin, RD10, F Versailles, France Author for correspondence: Alistair M. Hetherington Tel: Alistair.Hetherington@bristol.ac.uk Received: 12 December 2013 Accepted: 14 March 2014 doi: /nph Key words: Arabidopsis, guard cells, light, signal integration, stomatal aperture, twocomponent signalling (TCS) systems. Summary Two-component signalling (TCS) systems play important roles in cytokinin and ethylene signalling in Arabidopsis thaliana. Although the involvement of histidine kinases (AHKs) in drought stress responses has been described, their role and that of histidine phosphotransferases (AHPs) in guard cell signalling remain to be fully elucidated. Here, we investigated the roles of TCS genes, the histidine phosphotransferase AHP2 and the histidine kinases AHK2 and AHK3, previously reported to play roles in cytokinin and abscisic acid (ABA) signalling. We show that AHP2 is present in the nucleus and the cytoplasm, and is involved in lightinduced opening. We also present evidence that there is some redistribution of AHP2 from the nucleus to the cytoplasm on addition of ABA. In addition, we provide data to support a role for the cytokinin receptors AHK2 and AHK3 in light-induced stomatal opening and, by inference, in controlling the stomatal sensitivity to ABA. Our results provide new insights into the operation of TCS in plants, cross-talk in stomatal signalling and, in particular, the process of light-induced stomatal opening. Introduction Stomata are pores on the surfaces of leaves that regulate the loss of water vapour and the uptake of CO 2. Through their ability to regulate gas exchange, stomata have the capacity to influence photosynthesis and dry matter accumulation, water relations, leaf temperature and the supply of nutrients to the aerial parts of the plant. The aperture of the stomatal pore is controlled by the turgor of the two guard cells that surround the pore. Guard cell turgor and hence aperture are regulated by a wide range of external environmental cues, such as light, atmospheric relative humidity, CO 2 concentration and local signals, such as hormones. Stomata set leaf gas exchange to suit the prevailing environmental conditions. In order to do this, stomatal guard cells integrate frequently conflicting and sometimes rapidly changing information from endogenous local signals and exogenous environmental cues (Hetherington & Woodward, 2003). The aim of the work described here is to investigate the possible mechanisms responsible for signal integration in guard cells. One of the most common mechanisms used for signal integration in microbes is the two-component signalling (TCS) system (Gross et al., 1989). The canonical bacterial TCS system consists of a transmembrane sensor histidine kinase (HK) and a response regulator (RR). The HK is composed of an input (sensor) domain and a histidine kinase domain. Activation of the input domain during signal perception results in the activation of the histidine protein kinase. This results in autophosphorylation on a histidine residue. The RR is also composed of two domains: a receiver domain and an output domain. After autophosphorylation of the HK, the phosphoryl group from the phosphorhistidine is transferred to an aspartate residue on the RR by a phosphor-relay reaction. This results in the activation of the output domain of the RR, which, in turn, leads to the final response, such as the activation of gene transcription (Schaller et al., 2011). The plant TCS system differs from the canonical microbial TCS system in that it typically employs a third signalling component. This is the histidine phosphotransferase (HP), which serves to mediate the transfer of a phosphoryl group from the HK to the RR. Arabidopsis possesses 11 HKs (AHKs), five HPs (AHPs) and 23 transcriptional RRs (ARRs) that have been implicated in numerous stress responses, but, most notably, in cytokinin and ethylene signalling (Schaller et al., 2011). The process of TCS has received attention in stomata where, in particular, AHK5 has been proposed to act as an integrator of hydrogen peroxide (H 2 O 2 )-dependent closure-inducing signals. Consistent with this, ahk5 stomata display reduced closure in response to H 2 O 2, darkness, nitric oxide (NO) and ethylene. Interestingly, although abscisic acid (ABA) action in guard cells is known to involve H 2 O 2 production, the ahk5 mutant displays wild-type (WT) behaviour in response to this closure-inducing signal (Desikan et al., 2008). In addition, a role for AHK1 in stomatal function is suggested by the greater water loss reported in the ahk1 mutant (Tran et al., 2007) compared with WT. Work by Desikan et al. (2006) has revealed that the hybrid HK ETR1 is involved in H 2 O 2 -induced stomatal closure. Subsequently, 462 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

2 New Phytologist Research 463 they showed that stomata of the etr1 and arr2 mutants failed to close in response to ethylene (Desikan et al., 2006). Most recently, Mira-Rodado et al. (2012) have demonstrated that AHP1, AHP2, AHP5, ARR4 and ARR7 are all involved in the mediation of H 2 O 2 and ethylene-induced stomatal closure downstream of AHK5. It was against the backdrop of this work that we decided to investigate TCS in guard cells. The results of our work reveal a role for TCS components in the mechanism that allows stomata to achieve maximal apertures during light-stimulated stomatal opening. Materials and Methods Plant material and growing conditions Arabidopsis thaliana (L.) Heynh seeds were surface sterilized by exposure to chlorine gas. Plants were grown in controlled environment chambers (Snidjers, Tilburg, the Netherlands) on a 3 : 1 mixture of compost and horticultural silver sand in 10 h : 14 h light : dark cycles, 70% relative humidity, with a photon irradiance of 100 lmol m 2 s 1 and day : night temperatures of 22 C:20 C. Unless otherwise specified, all the Arabidopsis lines used were in the Col-0 background. ahk2-1, ahk2-2, ahk3-3 and ahp2-2 SALK homozygous mutant lines were obtained from The European Arabidopsis Stock Center (N679715, N678484, N and N669293, respectively), and ahp2-1 mutant homozygous seeds were selected from the segregating N6975 and N seed batches. The ahp2-1 mutant was selected using AHP2-F (CGTC TTAAGGTCGATTGACGACATCG), AHP2-R (GGGTAGT AGCTCAAGGTATGTATCATGTCTCGC) and Salk-LBa1 primers. ahk3-1 is in the Ws background (Jeon et al., 2010); the 35S::AHP2-overexpressing ahp2-l10 line is described in Suzuki et al.(2002); the ProAHP2:AHP2-GFP line, in which green fluorescent protein (GFP) expression is driven under the control of the native AHP2 promoter in an ahp2 mutant background, is described in Punwani & Kieber (2010). The ahk2-2 ahk3-3 double mutant is described in Higuchi et al.(2004). Epidermal bioassays Bioassays were performed on 5 6-wk-old A. thaliana plants. The epidermis was removed from the lower surfaces of the leaves and incubated for 2 h in Petri dishes at 22 C in 10 mm Mes/KOH, 50 mm KCl, ph 6.15 at a photon irradiance of lmol m 2 s 1 and bubbled with CO 2 -free air. This treatment promoted stomatal opening. Further treatments were then applied for a period of 2 h to promote stomatal closure. The response to calcium was investigated by adding 10 mm (final concentration) CaCl 2 in 10 mm Mes/KOH, 50 mm KCl buffer. For the cold treatment, epidermal peels were transferred to 4 C pre-cooled Petri dishes containing 10 mm Mes/KOH, 50 mm KCl, ph 6.15 at a photon irradiance of lmol m 2 s 1 and bubbled with CO 2 -free air. Stomatal apertures were measured using a Zeiss Axiovert 200M fluorescence inverted microscope (940 magnification) employing XBO 75 Microscope Illuminating Systems and connected to a Hamamatsu camera controller and a computer. Images were captured using Volocity software (Perkin-Elmer, Waltham, MA, USA). Ten stomata were measured on 12 epidermal peels (six plants, two leaves per plant). Bar plots show the average of 120 data points. Bioassays were replicated three times independently. The average of each experiment is presented. Significance was established using Student s t-test. GFP quantification The AHP2-GFP signal was quantified using a Leica TCS SP5 inverted confocal microscope (940 magnification) connected to a computer running dedicated LAS AF software (Leica Microsystems, Wetzlar, Germany). These experiments were carried out twice using 15 stomata per condition to quantify the GFP signal. The average of these experiments is presented. Significance was established using Student s t-test. Transcriptome data and guard cell promoter detection Guard cell-specific transcriptome data were obtained from Leonhardt et al. (2004) and Yang et al. (2008). Arabidopsis thaliana genome-wide guard cell-specific promoter detection was obtained according to the criteria described in Galbiati et al. (2007). The number of triple occurrences of [T/A]AAAG motifs in 100-bp windows was investigated in the 1 kb upstream of the gene of interest. Associated P values were calculated using Fisher s exact test. Stomatal length measurements Arabidopsis thaliana abaxial surface leaf impressions were made on d-old plants using dental resin (President Jet Light Body, Coltene/Whaledent, Switzerland). Replicates were made using transparent nail varnish, transferred to microscope slides and observed under a microscope. Twelve leaves were used per genotype (four plants with three leaves each), and images were recorded at the tip, middle and basal regions of each leaf. Stomatal lengths were measured using Volocity software. Significance was established using Student s t-test. Thermal imaging experiments Thermal imaging experiments were carried out using a FLIR SC5000 camera (FLIR, Wilsonville, OR, USA) in a controlled environment cabinet (Snidjers) at 70% relative humidity, photon irradiance of 100 lmol m 2 s 1 and 22 C. A thermal image was recorded every 30 s for 2 h. Three plants per genotype were used per experiment, and experiments were carried out three times independently. Images were analysed using Altair software (FLIR). Whole plants were imaged and six leaves per plant were measured. For mutants, average leaf temperatures over the 2-h period were compared with the corresponding WT. Results of representative experiments for each mutant are presented. Statistical significance was investigated using Student s t-test.

3 464 Research New Phytologist Results Leaves of ahp2 are warmer than those of WT We used infrared thermography as a proxy measure to compare transpiration between two independent mutant alleles of AHP2 (ahp2-1 and ahp2-2) and an AHP2-overexpressing line AHP2- L10 (Suzuki et al., 2002), referred to hereafter as AHP2-OX. Leaves of the two mutant alleles of ahp2 were statistically significantly warmer than those of WT (in the range C), suggesting that transpiration in the mutant lines was reduced compared with WT. By contrast, the temperature of the AHP2- OX leaves was significantly cooler (> 0.1 C) than those of WT (Fig. 1), suggesting greater transpiration in this line. These results suggest a role for the AHP2 protein in the control of plant water loss and, possibly, in stomatal activity. The AHP2 gene is expressed in guard cells An in silico analysis was conducted to gain an insight into the expression pattern of the AHP2 gene. Previously published transcriptomic data (Leonhardt et al., 2004; Yang et al., 2008) report the presence of the AHP2 (At3g29350) transcript in guard cells and mesophyll cells. In addition to these published data, we found a significant over-representation of the guard cell promoter motif [T/A]AAAG clusters (Galbiati et al., 2007) in 100-bp windows, 1 kb upstream of the AHP2 gene (P = 6.384e-07). These observations strongly support the possibility that AHP2 is expressed in guard cells. This was confirmed using plants expressing an AHP2-GFP gene fusion under the control of the native AHP2 promoter in an ahp2 mutant background (ProAHP2: AHP2-GFP) (Punwani et al., 2010). The observation of epidermal peels from these plants revealed the GFP fluorescence signal in the nucleus of guard cells (Fig. 2). Taken together, these results provide strong evidence that AHP2 is expressed in Arabidopsis guard cells. Fig. 2 The AHP2 gene is expressed in guard cells. Bright field (left) and fluorescence (right) images of guard cells from Arabidopsis plants harbouring a transgene ProAHP2:AHP2-GFP. Green fluorescent protein (GFP) fluorescence images (right) recorded after 2 h of incubation in the light (to promote stomatal opening) show GFP localization in the nucleus and cytoplasm. The AHP2 gene plays a role in light-stimulated stomatal opening Having established that the AHP2 gene is expressed in guard cells, we decided to investigate whether it played a role in guard cell function. The apertures of stomata from WT and ahp2 mutants (ahp2-1 and ahp2-2) were measured after incubation in the light to promote stomatal opening. Figure 3(a) shows that the disruption of AHP2 led to a significantly narrower stomatal aperture than that in WT ( lm). Conversely, the stomatal aperture in the AHP2-overexpressing line, AHP2-OX, was wider than that in WT. As the stomatal lengths of the ahp2 mutants and AHP2-OX line are similar to that of WT (Fig. 3b), this suggests that the differences in aperture are not caused by differences in stomatal length. These data suggest that the AHP2 gene has a role to play in light-induced stomatal opening. There is no evidence that APH2 is involved in ABA-induced stomatal closure As we had uncovered evidence that the AHP2 gene product is involved in light-stimulated stomatal opening, we decided to investigate whether this gene is also involved in closure. To investigate this, we focused on the ability of ABA to induce stomatal closure (Fig. 4). Although the stomata of the ahp2-1 and ahp2-2 mutants were less open than those of WT, they, like those of the overexpresser line, AHP2-OX, exhibited responses to ABA (Fig. 4a) that were (after aperture normalization) indistinguishable from those of WT (Fig. 4b). Fig. 1 ahp2 mutants (ahp2-1 and ahp2-2) exhibit warmer leaves than Col-0, whereas an AHP2-overexpressing line, AHP2-OX, exhibits cooler leaves than the wild-type (Col-0). Histograms show means ( SE) of temperature from 18 leaves measured on three Arabidopsis plants (six leaves per plant). Significance: **, P < ABA treatment alters the nucleocytoplasmic distribution of AHP2 Our results suggest that AHP2 is required to support full lightinduced stomatal opening. To study this further, we decided to investigate the localization of AHP2. Our previous results had

4 New Phytologist Research 465 (a) (b) Fig. 3 AHP2 is involved in light-induced stomatal opening. (a) Stomatal aperture from epidermal peels of ahp2 mutants, an AHP2-OXoverexpressing line and wild-type (WT) Arabidopsis after 2 h of incubation in conditions designed to promote stomatal opening. Aperture in lm; error bars, SE. Significance: *, P < 0.05; **, P < (b) Stomatal length in ahp2 mutants, AHP2-OX and WT plants after 2 h of incubation in conditions designed to promote stomatal opening. Length in lm; error bars, SE. There were no significant differences between WT and any of the lines. revealed that AHP2 was most obviously localized to the guard cell nucleus after light-induced stomatal opening. To investigate whether this distribution altered during closure, we used an AHP2-GFP translational fusion under the control of the native AHP2 promoter (ProAHP2:AHP2-GFP). Our results confirmed the presence of AHP2-GFP fluorescence in the nucleus after the stomata were induced to open fully in the light. However, when the stomata were treated with ABA, this distribution altered, and there was a noticeable appearance of AHP2-GFP fluorescence in the cytoplasm (Fig. 5a). These data suggested that removal of AHP2 from the nucleus might be important during stomatal closure. To investigate this further, we decided to quantify AHP2- GFP distribution using GFP fluorescence. This revealed a small, but statistically significant, reduction in the ratio of nucleus to total cellular GFP fluorescence (0.32 to 0.25) (Fig. 5b). However, this was only true in the case of ABA treatment, as neither cold nor CaCl 2, both of which promote stomatal closure, had any effect on the guard cell distribution of GFP fluorescence (Fig. 5b). The role of the histidine kinases AHK2 and AHK3 in lightand ABA-mediated stomatal aperture control We next investigated the role of the sensor histidine kinases AHK2 and AHK3, which act as cytokinin receptors (Higuchi et al., 2004; Nishimura et al., 2004), in guard cell light and ABA signalling. With the exception of ahk2-1, which opened slightly less than WT, all alleles achieved the same apertures as WT during light-induced stomatal opening (Fig. 6). All mutant alleles also responded to 10 lm ABA, with ahk3-1, ahk3-3 and ahk2-2 exhibiting statistically significant hypersensitivity to this closureinducing signal. Interestingly, when we investigated the same response in the ahk2-2 ahk3-3 double mutant, although ABA induced closure, it was not a hypersensitive response. However, this mutant did exhibit a marked failure to open to the same extent as WT in the light. Discussion The results of this study reveal a new role for TCS and, in particular, the histidine phosphotransferase AHP2 in Arabidopsis guard cell function. Our infrared thermal imaging results showed that the leaves of ahp2-1 and ahp2-2 are warmer than those of WT, suggesting that there is less transpiration in these mutants, whereas, in the AHP2-OX line, the converse is true (Fig. 1). After confirming that AHP2 is expressed in guard cells (Fig. 2), we compared light-induced stomatal opening and, consistent with our infrared thermal imaging results, found that light-induced stomatal opening was smaller in the two mutant alleles of AHP2 than in WT (Fig. 3). In the supplemental results of Mira-Rodado et al. (2012), raw (un-normalized) stomatal aperture data from light-induced stomatal experiments are presented. These data show that ahp1, ahp3 and ahp5 also fail to open to the same extent as WT after 2 h of incubation in the light. However, the ahp2 mutant allele used in Mira-Rodado et al. (2012), unlike the two independent alleles employed in the current work, exhibited a WT response. When we normalized our data to take account of differences in stomatal opening in the ahp2-1 and ahp2-2 lines, we observed WT responses to 10 lm ABA in ahp2-1, ahp2-2 and AHP2-OX. Our results with the ahp2 mutant alleles are in full agreement with the recent work by Nishiyama et al. (2013), who carried out a wide-ranging investigation into the role of AHP2, AHP3 and AHP5 in Arabidopsis stress responses. Loss of function of these genes was associated with increased tolerance to drought stress, indicating negative and redundant control over these responses. However, although loss of function resulted in increased drought tolerance, increased cell membrane integrity and greater germination sensitivity to ABA, the stomatal response was, as in the present study, similar to that of WT. We next investigated AHP2 protein localization. The results presented in Fig. 5(a,b) are consistent with a localization of the AHP2 protein in the nucleus and cytoplasm. This is consistent with previous work (Punwani et al., 2010). Initial investigations suggested that AHP1 and AHP2 migrated from the cytoplasm to the nucleus in response to cytokinin treatment, allowing them to

5 466 Research New Phytologist (a) (b) Fig. 4 AHP2 is involved in light-stimulated stomatal opening, but not in abscisic acid (ABA)-induced stomatal closure. Stomata were incubated in the light to promote stomatal opening, and then ABA was applied. (a) ABA-induced stomatal closure in ahp2 mutants (ahp2-1 and ahp2-2), AHP2- OX and wild-type (WT) Arabidopsis. Aperture in lm; error bars, SE. Significance: *, P < 0.05; **, P < (b) ABA-induced stomatal closure in ahp2 mutants (ahp2-1 and ahp2-2), AHP2-OX and WT. Aperture in percentage of the initial aperture (normalized). (a) (b) Fig. 5 AHP2 distribution in Arabidopsis guard cells. (a) Bright field and fluorescence images from ProAHP2:AHP2-GFP epidermal peels incubated in the light for 2 h to promote stomatal opening (left) or for a further 2 h in 10 lm abscisic acid (ABA) (right). (b) Stomatal aperture and the ratio of green fluorescent protein (GFP) fluorescence (nucleus to total guard cell fluorescence) in ProAHP2:AHP2-GFP guard cells after 2 h of incubation in conditions designed to promote stomatal opening (control) and subsequent (2 h duration) exposure to 10 mm CaCl 2, cold or 10 lm ABA. Grey bars, stomatal aperture ( SE); black circles ( SE), the proportion of the total GFP signal which localizes at the nucleus. Significance: **, P < interact with their cognate RRs (Hwang & Sheen, 2001). However, more recent work suggests that AHPs do not relocalize in response to cytokinin (Punwani et al., 2010). Our data suggest that, in the case of ABA, there is a small but statistically significant redistribution of AHP in guard cells, such that there is a reduction in overall nuclear localization. However, the relocation of AHP2 during closure is unlikely to be a general part of the closure response, as we did not see it during cold- or CaCl 2 -induced stomatal closure. On the basis of our results, we conclude that, to achieve full light-stimulated stomatal opening, functional AHP2 is required in the nucleus, and that AHP is therefore a positive regulator of light-stimulated stomatal opening. From our work on ABA-induced stomatal closure, we see no evidence for a role of AHP2 in this process. It will be interesting to investigate whether AHP2 participates in the ABA inhibition of stomatal opening and, if it does, this may shed light on whether the redistribution of AHP2 in response to ABA observed here has physiological significance.

6 New Phytologist Research 467 Fig. 6 Histidine kinase (AHK) receptors are regulators of stomatal aperture. Arabidopsis ahk2, ahk3, the double mutant ahk2 ahk3 and their respective wild-types, either Col-0 or Ws-2, were incubated in the light to promote stomatal opening (2 h) and subsequently treated with 10 lm abscisic acid (ABA) for 2 h. Values are means; error bars, SE. Significance: *, P < 0.05; **, P < Next, the roles of the cytokinin receptors AHK2 and AHK3, which are known to interact with AHP2 in cytokinin signalling (Dortay et al., 2006; Hwang et al., 2012) in the control of stomatal aperture, were studied. In the context of the current work, it is interesting to note that interactions between cytokinin and ABA in the control of stomatal aperture have been reported (Acharya & Assmann, 2009). For example, Radin et al. (1982) reported that elevated concentrations of cytokinin in the xylem decrease stomatal sensitivity to ABA. We investigated the ability of ABA to induce stomatal closure in ahk2 and ahk3 mutants, and found, with the exception of the ahk2-1 mutant, that all were hypersensitive to ABA (Fig. 6). These results are consistent with a role for cytokinin in the control of stomatal sensitivity to ABA, as first revealed by Radin et al. (1982). When we carried out the same experiment in the ahk2-2 ahk3-3 double mutant, although significant ABA-induced stomatal closure took place, the most obvious response was a marked and significant inability of the double mutant to open fully in response to light (Fig. 6). A possible explanation for the failure to observe this lesion in the single mutants may well be found in the phenomenon of functional redundancy among the AHKs. The failure of ahp2 mutants, which are also part of the cytokinin signalling pathway, to open fully in the light has, of course, already been reported in this article (Figs 1, 3, 4). Indeed, the failure of ahp1, ahp3 and ahp5 to achieve the full light-induced levels of opening attained by WT has already been noted (Mira-Rodado et al., 2012). Overall, the results of our work point to a role for AHP2 and, through the work of Mira-Rodado et al. (2012), the other phosphotransferases, AHP1, AHP3 and AHP5, in light-induced stomatal opening. When these are taken together with the results in Fig. 6, showing that ahk2-2 ahk3-3 also displays a lesion in lightinduced opening, and further results in Mira-Rodado et al. (2012), showing the same phenomenon in the RR mutants arr4 and arr7, the most obvious explanation is that there is a requirement for these TCS components in guard cell light-induced stomatal opening. Given that all these gene products have been implicated in cytokinin signalling it is tempting to suggest that a role for cytokinin is to promote full light-induced stomatal opening. A rigorous test of this hypothesis would require experiments using cytokinin biosynthesis mutants. Based on the current evidence, it is not yet possible to provide a mechanistic explanation for the results reported here. It could be that the cytokinin pathway impacts positively on the pathway for blue light-induced stomatal opening (Shimazaki et al., 2007). The TCS components described here may also act together to ultimately regulate the transcription of gene products involved in the regulation of the mechanical properties of the guard cell wall that facilitate full stomatal opening. In this context, it is useful to remember that the R2R3 Myb family transcriptionfactoratmyb60isknowntobeinvolvedinthecontrol of stomatal aperture by light (Cominelli et al., 2005), whereas AtMyb61 is involved in dark-induced closure (Liang et al., 2005). It is also possible that full stomatal opening by the gene products investigated here is achieved by decreasing the sensitivity of stomata to ABA, as suggested by Radin et al. (1982). Additional work will be required before it is possible to distinguish between these explanations. However, overall, our work identifies a new role for TCS components in the signalling pathway which is responsible for light-induced stomatal opening. Acknowledgements A.M.H. would like to acknowledge support from the UK Biotechnology and Biological Sciences Research Council (BBSRC) (grant BB/J002364/1). E.M. acknowledges INRA (France) for the ASC fellowship. Both authors would like to acknowledge the constructive and insightful comments from anonymous referees during the review process. References Acharya BR, Assmann SM Hormone interactions in stomatal function. Plant Molecular Biology 69:

7 468 Research New Phytologist Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M, Leonhardt N, Dellaporta SL, Tonelli C A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Current Biology 15: Desikan R, Horak J, Chaban C, Mira-Rodado V, Witthoft J, Elgass K, Grefen C, Cheung MK, Meixner AJ, Hooley R et al The histidine kinase AHK5 integrates endogenous and environmental signals in Arabidopsis guard cells. PLoS ONE 3: e2491. Desikan R, Last K, Harrett-Williams R, Tagliavia C, Harter K, Hooley R, Hancock JT, Neill SJ Ethylene-induced stomatal closure in Arabidopsis occurs via AtrbohF-mediated hydrogen peroxide synthesis. Plant Journal 47: Dortay H, Mehnert N, Burkle L, Schmulling T, Heyl A Analysis of protein interactions within the cytokinin-signaling pathway of Arabidopsis thaliana. FEBS Journal 273: Galbiati M, Simoni L, Pavesi G, Cominelli E, Francia P, Vavasseur A, Nelson T, Bevan M, Tonelli C Gene trap lines identify Arabidopsis genes expressed in stomatal guard cells. Plant Journal 53: Gross R, Arico B, Rappuoli R Families of bacterial signal-transducing proteins. Molecular Microbiology 3: Hetherington AM, Woodward FI The role of stomata in sensing and driving environmental change. Nature 424: Higuchi M, Pischke MS, Mahonen AP, Miyawaki K, Hashimoto Y, Seki M, Kobayashi M, Shinozaki K, Kato T, Tabata S et al In planta functions of the Arabidopsis cytokinin receptor family. Proceedings of the National Academy of Sciences, USA 101: Hwang I, Sheen J Two-component circuitry in Arabidopsis cytokinin signal transduction. Nature 413: Hwang I, Sheen J, M uller B Cytokinin signaling networks. Annual Review of Plant Biology 63: Jeon J, Kim NY, Kim S, Kang NY, Novak O, Ku SJ, Cho C, Lee DJ, Lee EJ, Strnad M et al A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. Journal of Biological Chemistry 285: Leonhardt N, Kwak JM, Robert N, Waner D, Leonhardt G, Schroeder JI Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. Plant Cell 16: Liang YK, Dubos C, Dodd IC, Holroyd GH, Hetherington AM, Campbell MM AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana. Current Biology 15: Mira-Rodado V, Veerabagu M, Witth oft J, Teply J, Harter K, Desikan R Identification of two-component system elements downstream of AHK5 in the stomatal closure response of Arabidopsis thaliana. Plant Signaling & Behavior 7: Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C Histidine kinase homologs that act as cytokinin receptors possess overlapping functions in the regulation of shoot and root growth in Arabidopsis. Plant Cell 16: Nishiyama R, Watanabe Y, Leyva-Gonzalez MA, Ha CV, Fujita Y, Tanaka M, Seki M, Yamaguchi-Shinozaki K, Shinozaki K, Herrera-Estrella L et al Arabidopsis AHP2, AHP3, and AHP5 histidine phosphotransfer proteins function as redundant negative regulators of drought stress response. Proceedings of the National Academy of Sciences, USA 110: Punwani JA, Hutchison CE, Schaller GE, Kieber JJ The subcellular distribution of the Arabidopsis histidine phosphotransfer proteins is independent of cytokinin signaling. Plant Journal 62: Punwani JA, Kieber JJ Localization of the Arabidopsis histidine phosphotransfer proteins is independent of cytokinin. Plant Signaling & Behavior 5: Radin JW, Parker LL, Guinn G Water relations of cotton plants under nitrogen deficiency: V. Environmental control of abscisic acid accumulation and stomatal sensitivity to abscisic acid. Plant Physiology 70: Schaller GE, Shiu SH, Armitage JP Two-component systems and their co-option for eukaryotic signal transduction. Current Biology 21: R320 R330. Shimazaki K, Doi M, Assmann SM, Kinoshita T Light regulation of stomatal movement. Annual Review of Plant Biology 58: Suzuki T, Ishikawa K, Yamashino T, Mizuno T An Arabidopsis histidine-containing phosphotransfer (HPt) factor implicated in phosphorelay signal transduction: overexpression of AHP2 in plants results in hypersensitiveness to cytokinin. Plant and Cell Physiology 43: Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K, Yamaguchi-Shinozaki K Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proceedings of the National Academy of Sciences, USA 104: Yang Y, Costa A, Leonhardt N, Siegel RS, Schroeder JI Isolation of a strong Arabidopsis guard cell promoter and its potential as a research tool. Plant Methods 4:6. New Phytologist is an electronic (online-only) journal owned by the New Phytologist Trust, a not-for-profit organization dedicated to the promotion of plant science, facilitating projects from symposia to free access for our Tansley reviews. Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged. We are committed to rapid processing, from online submission through to publication as ready via Early View our average time to decision is <25 days. There are no page or colour charges and a PDF version will be provided for each article. The journal is available online at Wiley Online Library. Visit to search the articles and register for table of contents alerts. If you have any questions, do get in touch with Central Office (np-centraloffice@lancaster.ac.uk) or, if it is more convenient, our USA Office (np-usaoffice@ornl.gov) For submission instructions, subscription and all the latest information visit