Evaluation of four phloem-specific promoters in vegetative tissues of transgenic citrus plants

Transcription

1 Tree Physiology 32, doi: /treephys/tpr130 Research paper Evaluation of four phloem-specific promoters in vegetative tissues of transgenic citrus plants M. Dutt, G. Ananthakrishnan, M.K. Jaromin, R.H. Brlansky and J.W. Grosser 1 Citrus Research and Education Center, University of Florida-IFAS, 700 Experiment Station Road, Lake Alfred, FL 33850, USA; 1 Corresponding author (jgrosser@ufl.edu) Received July 8, 2011; accepted November 15, 2011; published online January 6, 2012; handling Editor Chunyang Li Mexican lime (Citrus aurantifolia Swingle) was transformed with constructs that contained chimeric promoter-gus gene fusions of phloem-specific rolc promoter of Agrobacterium rhizogenes, Arabidopsis thaliana sucrose-h + symporter (AtSUC2) gene promoter of Arabidopsis thaliana, rice tungro bacilliform virus (RTBV) promoter and sucrose synthase l (RSs1) gene promoter of Oryza sativa (rice). Histochemical β-glucuronidase (GUS) analysis revealed vascular-specific expression of the GUS protein in citrus. The RTBV promoter was the most efficient promoter in this study while the RSs1 promoter could drive low levels of gus gene expression in citrus. These results were further validated by reverse transcription real-time polymerase chain reaction and northern blotting. Southern blot analysis confirmed stable transgene integration, which ranged from a single insertion to four copies per genome. The use of phloem-specific promoters in citrus will allow targeted transgene expression of antibacterial constructs designed to battle huanglongbing disease (HLB or citrus greening disease), associated with a phloem-limited Gram-negative bacterium. Keywords: Agrobacterium tumefaciens, AtSUC2, citrus, GUS, Mexican lime, rolc, RSs1, RTBV, transformation. Introduction In plant transformation studies, constitutive promoters are commonly used to target gene expression throughout the plant. These promoters can be obtained from numerous sources such as viruses (the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al. 1985) or figwort mosaic virus (FMV) promoter (Maiti et al. 1997)); bacteria (the Agrobacterium tumefaciens Ti plasmid mannopine synthetase (mas) promoter (DiRita and Gelvin, 1987) or nopaline synthase (NOS) promoter (Bevan et al. 1983)); or plants (the Arabidopsis thaliana Act 2 promoter (An et al. 1996) or Medicago truncatula MtHP promoter (Xiao et al. 2005)). In certain cases constitutive expression of a transgene may not be necessary, especially in cases where gene expression in a particular organ is sufficient to obtain desired results. Targeting transgenes in vascular organs for example is sufficient to express defenserelated proteins and/or peptides which could potentially confer resistance to pathogens that attack the vascular tissues (Guo et al. 2004). Several promoters that target phloem-specific gene expression have been described. These promoter elements are generally associated with genes that express specifically in phloem cells or from organisms that are phloem limited. The sucrose synthase protein has been observed to be localized in phloem cells (Nolte and Koch 1993) and its expression has been closely linked with vascular bundles (Hawker and Hatch 1965). Several promoters derived from sucrose synthase genes such as sucrose synthase l of rice (Wang et al. 1992) or maize (Yang and Russell, 1990) have been shown to be active in heterologous systems (Yang and Russell 1990; Shi et al. 1994). In addition, the Arabidopsis sucrose-h + symporter AtSUC2 has been described to be a phloem-loading transporter (Sauer and Stolz 1994) and has been observed to target phloem-specific gene expression in Arabidopsis, tobacco and strawberry (Truernit and Sauer 1995, Imlau et al. 1999, Zhao et al. 2004). The Glycine max sucrosebinding protein (GmSBP2) promoter and the Robinia pseudoacacia inner-bark lectin promoter also expressed β-glucuronidase (GUS) in the phloem of transgenic tobacco (Yoshida et al. 2002, The Author Published by Oxford University Press. All rights reserved. For Permissions, please journals.permissions@oup.com

2 84 Dutt et al. Waclawovsky et al. 2006). The phloem protein 2 is a major protein present in most plant species (for a review, see Dinant et al. 2003) and phloem-specific PP2 promoters have been isolated and characterized (Jiang et al. 1999, Thompson and Larkins 1996, Guo et al. 2004). The Agrobacterium rhizogenes rolc promoter (Schmulling et al. 1989) is a strong bacterium-derived phloem promoter. Several viruses also contain promoters that contain cis elements resulting in phloem-specific expression. Promoters from coconut foliar decay virus (Rohde et al. 1995), rice tungro bacilliform virus (RTBV; Bhattacharyya-Pakrasi et al. 1993), commelina yellow mottle virus (Medberry et al. 1992) or wheat dwarf geminivirus (Dinant et al. 2004) have been demonstrated to drive phloem-specific gene expression. Transgenic approaches to engineer citrus plants that can resist the many abiotic and biotic stresses have gained importance in recent years. This is due to numerous new problems being faced by the industry. In Florida, the major disease currently affecting citrus is citrus greening or huanglongbing (HLB) associated with Candidatus Liberibacter asiaticus, a phloemlimited bacterium (Chung and Brlansky 2009). This disease results in substantial economic losses to Florida s citrus industry. Huanglongbing affects all cultivated citrus varieties and genetic resistance is not present in commercial orange and grapefruit cultivars in Florida. Targeting of a defense-related protein to combat HLB would be desirable to maximize its expression to phloem and reduce or minimize expression in other parts of the plant, including fruit and juice subsequently consumed by humans (Shi et al. 1994). Targeting of the defense protein would also decrease metabolic load on the plant (Glick 1995). The purpose of this study was to evaluate the activity of four phloem-specific promoters in citrus. We transformed in vitro derived epicotyl segments of Mexican lime (Citrus aurantifolia Swingle) and regenerated several plants with constructs containing rolc promoter of A. rhizogenes, RTBV promoter of the rice tungro bacilliform virus, RSs1 promoter of rice and AtSUC2 promoter of A. thaliana. Materials and methods Cloning of promoter fragments Genomic DNA of A. thaliana Col 0 ecotype was used as template for isolation of AtSUC2 promoter. AtSUC2 sequence was amplified by polymerase chain reaction (PCR) using AtSUC2- specific oligonucleotide primers (AT-F and AT-R; presented in Table 1). The forward primer introduced a HindIII site immediately upstream of the promoter fragment while the reverse primer introduced a BamHI site downstream. Similarly, RSs1 promoter fragment (1931 bp) was cloned from Oryza sativa Carolina Gold using RSs1-F and RSs1-R primers, and rolc promoter fragment (882 bp) was cloned from A. rhizogenes plasmid pria4 using RC-F and RC-R primers (Table 1). Both RSs1 and rolc promoters were also modified to introduce a HindIII site immediately upstream of the promoter fragment and a BamHI site downstream. The RTBV promoter was PCR amplified from plasmid pmb1709 (Yin and Beachy 1995) using RTV-F and RTV-R primers to introduce KpnI immediately upstream of the promoter fragment and a BglII site downstream. All PCR products were amplified with Ex Taq Polymerase (Clontech Laboratories, Inc., Mountain View, CA, USA). The promoter fragments were isolated, purified and cloned into pgem -T Easy plasmid vector (Promega Corp., Madison, WI, USA). The cloned promoters were verified first by restriction enzyme analysis and then by DNA sequencing performed at the Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida, Gainesville, FL, USA. Construction of expression vectors The 35S promoter of the nptii marker gene in pcambia2300 (Cambia, Canberra, Australia) was excised as an EcoRI/NcoI fragment and replaced with an NOS promoter to form the plasmid pcam-nos. A BamHI/EcoRI fragment containing a gus gene with the CaMV 35S terminator (35S-3 ) from a puc18- derived plasmid pdrg was cloned into a unique BamHI/EcoRI site of pcam-nos to form a promoterless binary plasmid, pcam-prom. This binary plasmid was used for subsequent cloning of all promoter fragments upstream of the gus gene to produce the binary plasmids pcam-atsuc, pcam-rss1, pcamrolc and pcam-rtbv. pbi434 (Datla et al. 1991) containing a gus-nptii fusion gene under the control of a 35S promoter was used as control. Binary plasmids (Figure 1) were introduced into A. tumefaciens strain EHA105 (Hood et al. 1993) by the freeze thaw method (Burrow et al. 1990). Plant transformation Nucellar seedlings of Mexican lime (C. aurantifolia Swingle) were used for transformation as described by Dutt and Grosser (2009). Agrobacterium EHA105 cultures containing a binary Table 1. Sequence of primers used to amplify the phloem-specific promoters and to detect the presence of nptii gene. Promoter/gene Name Forward primer 5 3 Name Reverse primer 5 3 Amplicon length (bp) AtSUC2 AT-F AAGCTTGCAAAATAGCACACCATTTATG AT-R AGGATCCTTTGACAAACCAAGAAAGTAAG 954 RSs1 RSs1-F TCAAGCTTCAATCCACCAAATCAAAC RSs1-R AGGATCCCATGACTCAATTTCAGGAAC 1931 rolc RC-F AAAGCTTAAAGTTGGCCCGCTATTG RC-R TAGGATCCGTTAACAAAGTAGGAAACAGG 882 RTBV RTV-F AGGATCCTTTGACAAACCAAGAAAGTAAG RTV-R AGATCTTGCTCTCTTAGAAGTTTGAGC S 35S-F AAGCTTCGGATTCCATTGCCCAGC 35S-R CCCTCTAGACCATGGTGGAAGTATTTGA 650 nptii NP-F ATCCATCATGGCTGATGCAATGCG NP-R AACTCGTCAAGAAGGCGATAGAAGGC 450 Tree Physiology Volume 32, 2012

3 Evaluation of phloem-specific promoters in citrus 85 Figure 1. Schematic representation of the T-DNA region of the binary vectors used in this study. The binary vector contained a gus gene driven by one of the test phloem-specific promoters. The T-DNA also contained nptii as a selectable marker gene driven by the NOS promoter. The arrow indicates the unique EcoRI site. The control vector contains a fusion gus-nptii gene driven by a 35S promoter (pbi434). plasmid were grown in liquid YEP medium supplemented with 100 mg l 1 kanamycin and 50 mg l 1 rifampicin for ~24 h with shaking. Two milliliters of overnight culture were pipetted into 48 ml of YEP medium containing appropriate antibiotics and 100 µm acetosyringone. Cultures were incubated for an additional 3 h at 28 C. After centrifugation, the pellet was resuspended in liquid co-cultivation medium (CM). Optical density (600 nm) was measured with a CO8000 cell density meter (WPA, Cambridge, UK) and adjusted to 0.3 before incubation with cut epicotyl Mexican lime segments. Explants were incubated on solid CM medium for 2 days before transfer to shoot regeneration (RM) medium. RM medium contained Murashige and Skoog (MS) medium (Murashige and Skoog 1962) supplemented with 13.2 µm 6-benzylaminopurine and 2.5 µm naphthyleneacetic acid. The medium was supplemented with 0.5 g l 1 2-(N-morpholino) ethanesulfonic acid, 30 g l 1 sucrose and 8 g l 1 agar. ph was adjusted to 5.8 before autoclaving. Antibiotics added to cooled medium included kanamycin (100 mg l 1 ) and timentin (400 mg l 1 ). Transgenic plant regeneration Emerging Mexican lime shoots in RM medium were excised and placed onto shoot elongation medium (RMG) for an additional 4 weeks (Dutt and Grosser 2009). Antibiotics added to this medium included kanamycin (75 mg l 1 ) and timentin (200 mg l 1 ). Elongated shoots that survived selection were subsequently tested for nptii expression using PCR. nptii-positive shoots were excised and transferred into rooting medium (RMM) containing 50 mg l 1 kanamycin. After 2 months in this medium, well-rooted shoots were transferred into a peat-based commercial potting medium (Metromix 500, Sun Gro Horticulture, Bellevue, WA, USA) and acclimated to greenhouse conditions. Polymerase chain reaction and Southern blot analysis Genomic DNA from 12-month-old greenhouse-grown transgenic plants was isolated. Young leaves (100 mg) were used for DNA extraction using the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich Corp., St Louis, MO, USA). Duplex PCR to confirm presence of promoter was carried out using GoTaq Green Master PCR Mix (Promega Corp., Madison, WI, USA) and the primers outlined in Table 1. In addition, primers to amplify a fragment of the nptii gene were included. Amplified DNA fragments were electrophoresed on a 1% agarose gel containing GelRed TM Nucleic Acid Gel Stain (Biotium Inc., Hayward, CA, USA) and visualized under ultraviolet light. Southern blot analysis was carried out for confirmation of copy number in selected transgenic citrus plants. Genomic DNA was isolated using the Qiagen DNeasy Plant Maxi Kit (Qiagen, Valencia, CA, USA). EcoRI digested genomic DNA (15 µg) was immobilized on a positively charged nylon membrane and probed with a DIGlabeled gus probe. Following hybridization to the probe, chemiluminescence substrate CDP-Star was used for immunological detection of hybridization signals using X-ray film autography. Reverse transcription real-time PCR assay RNA was isolated from 100 mg of leaf tissue using an RNeasy Mini Kit (Qiagen). After treatment with DNAse 1 (Qiagen) to remove contaminating DNA, RNA was quantified spectrophotometrically. RNA Tree Physiology Online at

4 86 Dutt et al. concentration of each sample was adjusted to 500 ng ml 1 and quality checked by agarose gel electrophoresis. Reverse transcription real-time PCR (RT-qPCR) assay was designed using the PrimerQuest SM online software (Integrated DNA Technologies Inc., Coralville, IA, USA) to detect the gus gene. The probe was labeled at the 5 end with FAM (6-carboxy-fluorescein) reporter dye and at the 3 end with Black Hole Quencher (BHQ)-1. The cytochrome oxidase gene (cox) (GenBank accession number CX297817) primers and probe designed by Li et al. (2006) were used to quantify mrna from citrus as an internal standard. The cox probe was labeled at the 5 end with JOE (2,7 dimethoxy-4,5-dichloro-6-carboxyfluorescein) reporter dye and at the 3 end with BHQ-2. All primers and probes were synthesized by Integrated DNA Technologies Inc. The sequences of primers and probes including the reporter fluorescent dye and the dark quencher dye are shown in Table 2. Different concentrations of primers and probes were tested and optimized. Total RNA from each sample was used in 10-fold serial dilutions for optimization and standardization. Initially, simplex PCR was performed with the target gene alone, but subsequently the internal control cox gene was combined and optimized in a single assay. Reverse transcription real-time PCR reactions were performed with a final volume of 20 µl using the TaqMan RNA-to-Ct TM one-step kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer s instructions. The one-step kit parameters consisted of 20 min incubation at 48 C followed by 10 min incubation at 95 C and 40 cycles at 95 C for 15 s and 60 C for 1 min. Each RT-qPCR contained negative and non-template/water controls in addition to the sample being tested. Experimental sample no. 7 (a non-transgenic greenhouse plant sample) was used as a calibrator sample. Experiments were repeated at least twice with two replicates, and data were analyzed using Applied Biosystems software Version Relative quantitation was measured using the comparative Cq method also referred to as the 2 ΔΔCt. The fold change in the relative expression was then determined by calculating 2 ΔΔCt (Livak and Schmittgen, 2001). Evaluation of GUS expression Leaves were histochemically stained for GUS activity as described by Jefferson (1989) with minor modifications. X-Gluc (5-bromo- Table 2. Primers used in real-time PCR assay of transgenic citrus plants. Target gene Amplicon length (bp) Primer/probe sequence 5 3 Forward Probe Reverse gus 87 ACCTCGCATTACCCTTACGCTGAA FAM- AGATGCTCGACTGGGCAGATGAACAT -BHQ1 GCCGACAGCAGCAGTTTCATCAAT cox 69 GTATGCCACGTCGCATTCCAGA JOE-ATCCAGATGCTTACGCTGG-BHQ2 GCCAAAACTGCTAAGGGCATTC 4-chloro-3 indolyl-β-d-glucuronide) dissolved in dimethyl sulfoxide was added at a final concentration of 1 mg ml 1 in a phosphate buffer solution (200 mm NaH 2 P0 4, ph. 7.0; 10 mm EDTA and 0.2% triton X-100). Vacuum infiltration of explants was carried out for 5 min in this solution before being incubated in the dark at 37 C overnight. After incubation, explants were de-stained in ethanol:acetic acid (3:1) for 12 h to eliminate background chlorophylls and other pigments present in stained tissues. A quantitative fluorometric GUS assay was performed as outlined in the FluorAce β-glucuronidase Reporter Assay Kit (Bio-Rad Laboratories, Hercules, CA, USA). Approximately µg of total protein obtained from leaf petioles was added to 500 µl of assay buffer. Samples were incubated in a 37 C water bath for 30 min before the reaction was terminated by the addition of 1x stop buffer. Total soluble protein of each sample was determined using the Coomassie (Bradford) Protein Assay Kit (Fisher Scientific Inc., Pittsburg, PA, USA). Relative GUS activity was calculated relative to the amount of total protein and reaction time period and expressed in pmol MU/mg protein/min. Northern blot analysis Total RNA from 12-month-old greenhouse-grown transgenic citrus plants was isolated using an RNeasy Mini Kit (Qiagen). Polymerase chain reaction was used to incorporate T7 promoter sequence (5 TAATACGACTCACTATAGGG3 ) at the 5 end of the antisense strand of gus and cox fragments. Digoxigenin (DIG)- labeled RNA probes were prepared according to the in vitro transcription labeling technique in the DIG Northern Starter Kit (Roche Applied Science, Indianapolis, IN, USA) using the PCR product as template. Total RNA (500 ng) was subjected to formaldehyde denaturation and was electrophoretically resolved in a 2% agarose formaldehyde denaturing gel with 1 MOPS buffer. The RNA was transferred to a positively charged nylon membrane by capillary transfer. Hybridizations were performed overnight at 68 C as described in the DIG Northern Starter Kit. The chemiluminescence substrate CDP-Star was used for immunological detection of hybridization signals using X-ray film autography. Results Production of transgenic plants Agrobacterium-mediated transformation of Mexican lime epicotyl explants resulted in the production of a large number of putative kanamycin-resistant transgenic plants. There was no difference in ability to regenerate shoots following cocultivation and incubation with any of the vectors. In order to confirm development of non-chimeric transgenic plants, shoots were excised from epicotyl segments, bases were cut off and transferred into RMG medium. Most shoots could be transferred into RMM medium within 4 weeks of transfer to RMG. It was necessary to subculture several transgenic shoots twice into fresh RMM medium before they could root and be trans- Tree Physiology Volume 32, 2012

5 ferred into soil. All plants grew normally and there was no phenotypic abnormality observed between transgenic plants and non-transgenic controls. Rooted plants developed slowly in the first 6 months of transfer to soil followed by rapid plant growth and development. Six transgenic lines from each construct were hardened off in the greenhouse. Polymerase chain reaction and Southern blot analyses of transgenic Mexican lime plants Putative transgenic plants were evaluated by duplex PCR with primers mentioned earlier. Results demonstrated the presence of a test promoter in each transgenic plant evaluated. In addition, the nptii gene was also detected in transgenic plants that were positive for the promoter (Figure 2). Stable gene integration and copy number from four transgenic lines of each construct was evaluated using Southern blot analyses (Figure 3). Genomic DNA (15 µg) was digested with EcoRI and probed with a DIGlabeled gus probe. Among four transgenic plants analyzed containing the AtSUC2-gus construct (Figure 3a), line 2 was single copy, lines 1 and 4 had two copies and line 3 had three copies of the transgene stably incorporated into the genome. In transgenic lines containing the RSs1-gus construct (Figure 3b), line 1 was single copy, line 4 had two copies, line 3 had three copies and line 2 had four copies of the transgene. With plants containing the rolc-gus construct (Figure 3c), line 4 was single copy while line 2 had two, line 1 had three and line 3 had four copies of the transgene. Lines 2 and 3 were single copy while lines 1 and 4 contained two copies of the transgene in plants containing the RTBV-gus construct (Figure 3d). Evaluation of phloem-specific promoters in citrus 87 Analysis of GUS expression in transgenic Mexican lime plants Visualization of GUS activity was successfully done by overnight staining. We stained 6-week-old transgenic citrus plants. Expression of the constructs was observed in leaves and remained restricted to vascular tissues (Figure 4). Phloemspecific GUS expression was also observed in overnight stained cross-sections of tender 6-week-old stems (Figure 5). Histochemical GUS analysis demonstrated that staining of vascular tissues of young in vitro leaves was similar to that observed using greenhouse plants (data not shown). Four transgenic citrus plants obtained from each construct were analyzed. Relative GUS activity ranging from 7 to 250 pmol MU/mg/min was obtained after transformation using gus gene-containing vectors. There was no significant difference in relative GUS activity of plants transformed with either RTBV promoter or 35S control (pbi434; Figure 6). Of the four phloem-specific promoters evaluated in this study, GUS activity was highest in plants expressing RTBV promoter, followed by rolc promoter, AtSUC2 promoter and RSs1 promoter. The RSs1 promoter was not very active in citrus (19 pmol MU/mg protein/ min). GUS activity was not detected in plants transformed with pc2300 that contained a construct with an nptii cassette only. A comparison of relative GUS activity in stems, roots and leaves of transgenic citrus revealed that plants transformed with pcam-rolc construct yielded about half the GUS activity of pcam-rtbv in leaves (Table 3). GUS activity was 10 times lower in plants transformed with pcam-rss1 and 4 times lower in plants with pcam-atsuc2. GUS activity levels were Figure 2. Amplification products obtained from duplex PCR of transgenic Mexican lime genomic DNA with promoter-specific oligonucleotide primers as outlined in Table 1. A fragment of the nptii gene (450 bp) was also amplified. M, 1 kb marker; 1 4 are four individual transgenic lines containing the RSs1 promoter; 5 8 are four individual transgenic lines containing the AtSUC2 promoter; 9 12 are four individual transgenic lines containing the RTBV promoter; are four individual transgenic lines containing the rolc promoter. Figure 3. Southern hybridization analysis of total DNA of transgenic Mexican lime lines transformed with one of the four phloem-specific promoters. (a) AtSUC2, (b) RSs1, (c) rolc and (d) RTBV. The * indicates a line with single copy number. Tree Physiology Online at

6 88 Dutt et al. Reverse transcription real-time PCR of transgenic Mexican lime plants Figure 4. Phloem-specific gus expression in 6-week-old transgenic Mexican lime leaves. Leaves were incubated in the dark at 37 C overnight in a phosphate buffer solution containing 1 mg ml 1 X-Gluc. After incubation, the explants were de-stained in ethanol:acetic acid (3:1) for 12 h to eliminate background chlorophylls and other pigments present in stained tissues. AtSUC2: transgenic leaf expressing GUS under control of the AtSUC2 promoter; RSs1: transgenic leaf expressing GUS under control of the RSs1 promoter; rolc: transgenic leaf expressing GUS under control of the rolc promoter; RTBV: transgenic leaf expressing GUS under control of the RTBV promoter; 35S: transgenic leaf expressing GUS under control of the 35S promoter; CON: leaf obtained from a non-transgenic control at a similar stage of development. Figure 5. GUS expression in phloem tissues in a 6-week-old transgenic Mexican lime stem cross-section. The plant was transformed with a construct containing the gus gene under control of the AtSUC2 promoter. similar in leaves and stem. GUS activity in roots followed a different trend. Plants transformed with pcam-rolc had relatively higher GUS activity than pcam-rtbv while others lower. Initially, primer evaluations and standardizations were performed by RT-qPCR with SYBR Green I dye (data not shown) and then TaqMan RT-qPCR was performed as duplex reactions. The optimized concentration of primers (300 nm each both forward and reverse) and probe (150 nm) provided good results for the target gene. The internal control gene (cox) was optimized with primers (300 nm each both forward and reverse) and probe (150 nm). No non-specific or cross-reaction/ amplification of targets was observed, and only targeted regions of the gene were amplified by the duplex reactions. No signal was detected using total RNA from healthy non-transgenic control plants or from a non-template control/water sample. Using the 2 ΔΔCt Ct method (Livak and Schmittgen 2001), overall relative quantification level was highest (upregulated) in plants expressing a gus gene driven by the 35S promoter followed by RTBV, rolc, AtSUC2 and RSs1. The relative quantification of the specific promoter varied among the individual lines tested. The 35S and RTBV promoters had above log (relative quantification) and other promoters had log or below. All promoters consistently expressed above log The cox gene served as a good endogenous reference and was expressed and detected consistently. The internal reference gene measured 0 on a log 10 scale. A greenhouse healthy control plant sample was used as a calibrator sample. Results are shown in the graph/table by specific promoter (Figure 7). Northern blot of transgenic Mexican lime plants Northern blot was essentially performed to confirm relative levels of promoter-driven gus expression in different tissues of transgenic Mexican lime plants in selected single copy transgenic plants obtained from each construct. We analyzed vascular leaf tissues and roots of greenhouse-derived plants in order to evaluate expression levels. Blots were also probed with a fragment of the cox gene. The cox gene served as a loading control for amount of total RNA. Good expression levels were observed in leaf vascular tissues (Figure 8). gus expression in roots was different from that observed in leaves. Expression levels were relatively lower in roots with the exception of the rolc construct (Figure 9). As observed earlier using fluorometric analysis, plants containing the RSs1-gus construct had the lowest mrna expression levels among all promoters evaluated. Discussion Citrus in Florida is currently under a severe threat from citrus HLB (greening disease) associated with the Gram negative, phloem-limited bacterium Candidatus Liberibacter asiaticus, which has now become endemic. Huanglongbing affects all Tree Physiology Volume 32, 2012

7 Evaluation of phloem-specific promoters in citrus 89 Figure 6. Fluorometric assay for relative GUS activity in fully expanded leaves of greenhouse grown Mexican lime plants. Midrib and petioles were used for sampling after 1 year of transfer to the greenhouse. Vertical lines represent standard errors. pc2300: transgenic plants containing a nptii cassette; pcam-atsuc: transgenic plants expressing GUS under control of the AtSUC2 promoter; pcam-rss1: transgenic plants expressing GUS under control of the RSs1 promoter; pcam-rolc: transgenic plants expressing GUS under control of the rolc promoter; pcam-rtbv: transgenic plants expressing GUS under control of the RTBV promoter; pbi434: transgenic plants expressing GUS under control of the 35S promoter. Table 3. Relative GUS activity in stems, roots and leaves of transgenic Mexican lime. GUS activity from individual promoter-gus constructs is expressed as a percentage of mean relative GUS activity from RTBV-GUS. Promoter construct 1 Leaves Stem Roots pcam-atsuc2 28 ± 3 25 ± 4 48 ± 5 pcam-rss1 10 ± 3 10 ± 3 21 ± 5 pcam-rolc 51 ± 7 44 ± ± 2 pcam-rtbv pbi ± 5 84 ± ± 5 1 All constructs contain the gus gene driven by an individual test promoter. The construct pcam-atsuc contains the AtSUC2 promoter, pcam-rss1 contains the RSs1 promoter, pcam-rolc contains the rolc promoter, pcam-rtbv contains the RTBV promoter and pbi434 contains the 35S promoter. cultivated citrus varieties and cannot be currently controlled due to a lack of resistant cultivars. The Asian citrus psyllid (ACP) (Diaphorina citri Kuwayama) is responsible for its spread. Infected psyllids and their nymphs transmit the bacterium into phloem tissues of the plant (Xu et al. 1988, Manjunath et al. 2008). The disease is then spread to different parts of the plant via phloem (Tatineni et al. 2008). Expression of a strong antimicrobial product in phloem and especially in younger tissues could help control this disease. Our present study was conducted to evaluate the performance of four phloem-specific promoters for subsequent delivery of antimicrobial products against Candidatus Liberibacter asiaticus. We selected promoters originating from diverse sources (dicot and monocot plants, bacteria and virus) for phloem-specific gene expression. We were able to successfully generate a population of transgenic Mexican lime plants containing our promoter-gus constructs using a protocol that has been described previously (Dutt and Grosser 2009). Non-transgenic escape plants were successfully eliminated after multiple rounds of kanamycin-based selection. Production of escape plants is a major problem in citrus transformation research (Domínguez et al. 2004) since non-transformed cells can be protected from the selective agent by neighboring transformed cells (Jordan and McHughen 1988). Use of reporter genes such as EGFP enables visual nondestructive identification of transgenic lines and can mitigate the problem of escape plant regeneration (Dutt and Grosser 2009). When visual reporter genes are not used, a selection regime that includes optimum levels of selection agent coupled with proper incubation time is necessary for efficient selection (Mitić et al. 2004). We report herein the expression patterns of several phloem-specific promoters in citrus. None of the promoters were active in non-vascular tissues (data not shown). The 35S promoter is an efficient promoter and is constitutively expressed in citrus (Peňa et al. 1995, Dutt et al. 2011). High levels of gene expression occur by interaction of a series of cis elements in the promoter (Benfey et al. 1989). Yin et al. (1997) suggested that high levels of phloem-specific pararetrovirus (RTBV) expression are mainly due to three cis elements: Box II, ASL box and GATA motif. Differences in Tree Physiology Online at

8 90 Dutt et al. Figure 7. Quantification of gus activity using RT-qPCR. Total RNA from Mexican lime leaf midrib and petioles was used as template. The sequence of primers used to amplify the gus gene is detailed in Table 2. Four independent lines were tested from each construct. Lanes 1 4 are individual transgenic lines containing the AtSUC2 promoter; 5 8 are four individual transgenic lines containing the RSs1 promoter; 9 12 are four individual transgenic lines containing the rolc promoter; are four individual transgenic lines containing the RTBV promoter; are four individual transgenic lines containing the 35S promoter. Lane 21 is the calibrator sample. Total RNA from a Mexican lime plant transformed with pc2300 (lane 22) and a water sample (lane 23) was also included to verify the accuracy of the amplification process. Figure 8. Northern blot analysis of gus gene expression in leaf midrib and petioles of transgenic Mexican lime. Total RNA (500 ng) was probed with a gus DIG-labeled RNA probe (top panel). Northern blot was probed with the cytochrome oxidase gene (lower panel). AtSUC2: transgenic plants expressing gus under control of the AtSUC2 promoter; RSs1: transgenic plants expressing gus under control of the RSs1 promoter; rolc: transgenic plants expressing gus under control of the rolc promoter; RTBV: transgenic plants expressing gus under control of the RTBV promoter; CON: leaf obtained from a non-transgenic control at a similar stage of development. Figure 9. Northern blot analysis of gus gene expression in roots of transgenic Mexican lime. Total RNA (500 ng) was probed with a gus DIG-labeled RNA probe (top panel). Northern blots were probed with the cytochrome oxidase gene (lower panel). AtSUC2: transgenic plants expressing gus under control of the AtSUC2 promoter; RSs1: transgenic plants expressing gus under control of the RSs1 promoter; rolc: transgenic plants expressing gus under control of the rolc promoter; RTBV: transgenic plants expressing gus under control of the RTBV promoter; CON: roots obtained from a non-transgenic control at a similar stage of development. tissue specificity between the two promoters (RTBV and 35S) are also due to the presence of different cis elements such as activation sequence-1 (as-1) site, a CA-rich region and a GATA region, both of which are key elements that bind nuclear factors for constitutive expression in 35S (Lam and Chua 1989). Relatively lower levels of GUS expression were obtained from plants transformed with the two plant-derived promoters. The AtSUC2 promoter is localized in companion cells (Stadler and Sauer 1996) and expressed strongly in midrib and secondary veins (Srivastava et al. 2008). GUS activity was observed in both young and older leaves, contrary to that reported in transgenic strawberries, where GUS activity was absent in young leaves (Zhao et al. 2004). The RSs1 promoter was the least effective of the four promoters evaluated in this study in driving transgene expression. Monocot promoters that exhibit a highly regulated expression pattern in monocots can function at a reduced level in dicots (Hauptmann et al. 1988, Shimamoto 1994). The rolc promoter produced adequate levels of GUS expression in both leaves and roots of citrus. This promoter is activated by sucrose in phloem cells (Yokoyama et al. 1994). High levels of sucrose in actively growing parts result in rapid translocation of photosynthates from source to sink tissues and play a role in up-regulating gene expression. Activity of the rolc promoter was superior to that of AtSUC2 and RSs1. Gene Tree Physiology Volume 32, 2012

9 expression regulated by the rolc promoter has been reported to be higher than the RSs1 promoter in both monocots and dicots (Saha et al. 2007). We further corroborated our observations on gus expression in citrus by RT-qPCR. Protocols were optimized to detect variations among plants. Major differences were not observed between various transgenic lines transformed with a specific promoter, and variation observed in different groups was similar to that obtained in fluorometric assays. Agrobacterium-mediated transformation is a random process, and incorporation of a set number of transgenes is not currently possible by this method (Nagaya et al. 2005). One to four copies of the gus gene were detected by Southern blotting. However, none of these transgenic lines exhibited gene silencing. Gene silencing occurs in plants containing numerous copies of a transgene integrated at one or multiple unlinked loci (Nagaya et al. 2005) or repetitive T-DNA structures (Jorgensen et al. 1996). In many cases, multiple copies of a transgene result in gene silencing (Schubert et al. 2004). In citrus, we did not observe any silencing when 1 4 copies of the transgene were present in the genome. Similar results were obtained by Tang et al. (2007). They observed post-transcriptional gene silencing in transgenic lines with more than three copies of T-DNA. To minimize variability of transgene expression and to confirm our results, we evaluated transgenic plants that were observed to contain a single copy of a transgene stably incorporated into the genome as evaluated through Southern blot analyses. Our results mirrored those observed using fluorometric GUS analysis. High levels of GUS expression were observed in leaf petioles and veins and there was no difference in expression levels between this and stem phloem tissues. In conclusion, we evaluated four phloem-specific promoters from diverse sources. Each of the promoters was able to drive vascular-specific gene expression in vegetative parts of the plant. Expression levels depended on the promoter, with a virus derived promoter exhibiting the highest transgene expression, followed by a bacterial rolc promoter. The two plant-based AtSUC2 and RSs1 promoters were comparatively weak in directing vascularspecific gene expression. However, a weaker plant-based promoter that is able to drive adequate levels of gene expression may be preferable to the consumer than stronger non-plantbased promoters. Citrus is a long-lived perennial, and further analyses are required on transgene stability during different growing seasons. Acknowledgments We thank Dr E. Etxeberria for providing us with facilities to conduct GUS fluorometric analysis, Gary Barthe for excellent technical assistance and Dr Roger Beachy for providing us with the pmb1709 plasmid. Evaluation of phloem-specific promoters in citrus 91 Funding This work was partially supported by funds provided by the Citrus Research and Development Foundation, Inc. (CRDF). References An, Y.Q., J.M. McDowell, S. Huang, E.C. McKinney, S. Chambliss and R.B. Meagher Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J. 10: Benfey, R.N., L. Ren and N.H. Chua, The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J. 8: Bevan, M.W., R.B. Flavell and M.D. Chilton A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature 304: Bhattacharyya-Pakrasi, M., J. Peng, J.S. Elmer, G. Laco, P. Shen, M.B. Kaniewska, H. Kononowicz, F. Wen, T.K. Hodges and R.N. Beachy Specificity of a promoter from the rice tungro bacilliform virus for expression in phloem tissues. Plant J. 4: Burrow, M.D., C.A. Chlan, P. Sen and N. Murai High frequency generation of transgenic tobacco plants after modified leaf disk cocultivation with Agrobacterium tumefaciens. Plant Mol. Biol. Rep. 8: Chung, K.R. and R.H. Brlansky Citrus diseases exotic to Florida: Huanglongbing (Citrus Greening) Fact Sheet PP ifas.ufl.edu/pp133. Datla, R.S.S., J.K. Hammerlindl, L.E. Pelcher, W.L. Crosby and G. Selvaraj A bifunctional fusion between beta-glucuronidase and neomycin phosphotransferase: a broad-spectrum marker enzyme for plants. Gene 101: Dinant, S., A.M. Clark, Y. Zhu, F. Vilaine, J.C. Palauqui, C. Kusiak and G.A. Thompson Diversity of the superfamily of phloem lectins (phloem protein 2) in angiosperms. Plant Physiol. 131: Dinant, S., Ripoll, C., Pieper, M. and C. David Phloem specific expression driven by wheat dwarf geminivirus V-sense promoter in transgenic dicotyledonous species. Physiol. Plant. 121: DiRita, V.J. and S.B. Gelvin Deletion analysis of the mannopine synthase gene promoter in sunflower crown gall tumors and Agrobacterium tumefaciens. Mol. Gen. Genet. 207: Domínguez, A., M. Cervera, R.M. Pérez, J. Romero, C. Fagoaga, J. Cubero, M.M. López, J.A. Juárez, L. Navarro and L. Peña Characterization of regenerants obtained under selective conditions after Agrobacterium-mediated transformation of citrus explants reveals production of silenced and chimeric plants at unexpected high frequencies. Mol. Breeding 14: Dutt, M. and J.W. Grosser Evaluation of parameters affecting Agrobacterium-mediated transformation of citrus. Plant Cell Tiss. Organ Cult. 98: Dutt, M., M. Vasconcellos and J.W. Grosser, Effects of antioxidants on Agrobacterium-mediated transformation and accelerated production of transgenic plants of Mexican lime (Citrus aurantifolia Swingle). Plant Cell Tiss. Organ Cult. 107: Glick, B.R Metabolic load and heterologous gene expression. Biotech. Adv. 13: Guo, H., X. Chen, H. Zhang, R. Fang, Z. Yuan, Z. Zhang and Y. Tian Characterization and activity enhancement of the phloemspecific pumpkin PP2 gene promoter. Transgenic Res. 13: Hauptmann, R.M., M. Ashraf, V. Vasil, L.C. Hannah, I.K. Vasil and R. Ferl Promoter strength comparisons of maize shrunken I and Tree Physiology Online at

10 92 Dutt et al. alcohol dehydrogenase I and 2 promoters in mono- and dicotyledonous species. Plant Physiol. 88: Hawker, J.S. and M.D. Hatch Mechanism of sugar storage by mature stem tissue of sugarcane. Physiol. Plant. 18: Hood, E.E., S.B. Gelvin, L.S. Melchers and A. Hoekema New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res. 2: Imlau, A., E. Truernit and N. Sauer Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell 11: Jefferson, R.A The GUS reporter gene system. Nature 342: Jiang, H., H.M. Qin, H.M. Yu and Y.C. Tian Cloning and function of the phloem protein gene promoter from Cucurbita maxima. J. Agric. Biotechnol. 7: Jordan, M.C. and A. McHughen Transformed callus does not necessarily regenerate transformed shoots. Plant Cell Rep. 7: Jorgensen, R.A., P.D. Cluster, J. English, Q. Que and C.A. Napoli Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and singlecopy vs. complex T-DNA sequences. Plant Mol. Biol. 31: Lam, E., and N.H. Chua ASF-2: a factor that binds to the cauliflower mosaic virus 355 promoter and a conserved GATA motif in Cab promoters. Plant Cell 1: Li, W., J.S. Hartung and L. Levy Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Methods 66: Livak, K.J. and T.D. Schmittgen Analysis of relative gene expression data using real-time quantitative PCR and the 2 ΔΔCt method. Methods 25: Maiti, I.B., S. Gowda, J. Kiernan, S.K. Ghosh and R.J. Shepherd Promoter/leader deletion analysis and plant expression vectors with the figwort mosaic virus (FMV) full length transcript (FLt) promoter containing single or double enhancer domains. Transgenic Res. 6: Manjunath, K.L., S.E. Halbert, C. Ramadugu, S. Webb and R.F. Lee Detection of Candidatus Liberibacter asiaticus in Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology 98: Medberry, S.L., B. Lockhart and N.E. Olszewski The commelina yellow mottle virus promoter is a strong promoter in vascular and reproductive tissues. Plant Cell 4: Mitić, N., R. Nikolić, S. Ninković, J. Miljuš-Djukić and M. Nešković Agrobacterium-mediated transformation and plant regeneration of Triticum aestivum L. Biol. Plant. 48: Murashige, T. and F. Skoog A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol. Plant. 15: Nagaya, S., K. Kato, Y. Ninomiya, R. Horie, M. Sekine, K. Yoshida and A. Shinmyo Expression of randomly integrated single complete copy transgenes does not vary in Arabidopsis thaliana. Plant Cell Physiol. 46: Nolte, K.D. and K.E. Koch Companion-cell specific localization of sucrose synthase in zones of phloem loading and unloading. Plant Physiol. 101: Odell, J.T., F. Nagy and N.H. Chua Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313: Peňa, L., M. Cervera, J. Juárez, C. Ortega, J. Pina, N. Durán-Vila and L. Navarro High efficiency Agrobacterium-mediated transformation and regeneration of citrus. Plant Sci. 104: Rohde, W., D. Becker and J.W. Randles The promoter of coconut foliar decay-associated circular single-stranded DNA directs phloem-specific reporter gene expression in transgenic tobacco. Plant Mol. Biol. 27: Saha, P., D. Chakraborti, A. Sarkar, I. Dutta, D. Basu and S. Das Characterization of vascular-specific RSs1 and rolc promoters for their utilization in engineering plants to develop resistance against hemipteran insect pests. Planta 226: Sauer, N. and J. Stolz SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana: expression and characterization in baker s yeast and identification of the histidine-tagged protein. Plant J. 6: Schmulling, T., J. Schell and A. Spena Promoters of the rol A, B, and C genes of Agrobacterium rhizogenes are differentially regulated in transgenic plants. Plant Cell 1: Schubert, D., B. Lechtenberg, A. Forsbach, M. Gils, S. Bahadur and R. Schmidt Silencing in Arabidopsis T-DNA transformants the predominant role of a gene-specific RNA sensing mechanism versus position effects. Plant Cell 16: Shi, Y., M.B. Wang, K.S. Powell, E. Van Damme, V.A. Hilder, A.M.R. Gatehouse, D. Boulter, and J.A. Gatehouse, Use of the rice sucrose synthase-1 promoter to direct phloem-specific expression of β-glucuronidase and snowdrop lectin genes in transgenic tobacco plants. J. Exp. Bot. 45: Shimamoto, K Gene expression in transgenic plants. Curr. Opin. Biotechnol. 5: Srivastava, A.C., S. Ganesan, I.O. Ismail and B.G. Ayre Functional characterization of the Arabidopsis AtSUC2 sucrose/h+ symporter by tissue-specific complementation reveals an essential role in phloem loading but not in long-distance transport. Plant Physiol. 148: Stadler, R. and N. Sauer, The Arabidopsis thaliana AtSUC2 gene is specifically expressed in companion cells. Bot. Acta. 109: Tang, W., R.J. Newton and D.A. Weidner Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine. J. Exp. Bot. 58: Tatineni, S., U.S. Sagaram, S. Gowda, C.J. Robertson, W.O. Dawson, T. Iwanami and N. Wang In planta distribution of Candidatus Liberibacter asiaticus as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology 98: Thompson, G.A. and B.A. Larkins Phloem-specific promoter. US patent US A. Truernit, E. and N. Sauer The promoter of the Arabidopsis thaliana SUC2 sucrose-h+ symporter gene directs expression of beta-glucuronidase to the phloem: evidence for phloem loading and unloading by SUC2. Planta 196: Waclawovsky, A.J., R.L. Freitas, C.S. Rocha, L.A.S. Contim and E.P.B. Fontes Combinatorial regulation modules on GmSBP2 promoter: a distal cis-regulatory domain confines the SBP2 promoter activity to the vascular tissue in vegetative organs. BBA-Gene Struct. Expr. 1759: Wang, M.B., D. Boulter and J.A. Gatehouse A complete sequence of the rice sucrose synthase-1 (RSsl) gene. Plant Mol. Biol. 19: Xiao, K., C. Zhang, M. Harrison and Z.Y. Wang Isolation and characterization of a novel plant promoter that directs strong constitutive expression of transgenes in plants. Mol. Breeding 15: Xu, C.F., K.B. Li and C. Ke Further study of the transmission of citrus huanglongbing by a psyllid, Diaphorina citri Kuwayama. Proceedings of 10th Conference of the International Organization of Citrus Virologists. pp Yang, N.S. and D. Russell Maize sucrose synthase-1 promoter directs phloem specific expression of gus gene in transgenic tobacco plants. Proc. Natl Acad. Sci. USA 87: Tree Physiology Volume 32, 2012

11 Evaluation of phloem-specific promoters in citrus 93 Yin, Y. and R.N. Beachy The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.). Plant J. 7: Yin, Y., L. Chen and R.N. Beachy Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice. Plant J. 12: Yokoyama, R., T. Hirose, N. Fujii, E.T. Aspuria, A. Kato and H. Uchimiya The rolc promoter of Agrobacterium rhizogenes Ri plasmid is activated by sucrose in transgenic tobacco plants. Mol. Gen. Genet. 244: Yoshida, K., T. Mohri, M. Nishiguchi and K. Tazaki Robinia pseudoacacia inner-bark lectin promoter expresses GUS also predominantly in phloem of transgenic tobacco. J. Plant Physiol. 159: Zhao, Y., Q. Liu and R.E. Davis Transgene expression in strawberries driven by a heterologous phloem-specific promoter. Plant Cell Rep. 23: Tree Physiology Online at