Eukaryotes January 2014
|
|
- Lee Miles
- 6 years ago
- Views:
Transcription
1 Slide 1 / 143
2 Slide 2 / 143 Eukaryotes January
3 Slide 3 / 143 Vocabulary Click on each word below to go to the definition. 5' cap exocytosis adhering junction exon alternative splicing extracellular matrix cell junction food vacuole central vacuole fungi chitin gap junction chloroplast glycoprotein chromatin golgi appartus chromatin modifying enzyme histone contractile vacuole hydrolytic enzyme cytoskeleton intermediate filament endocytosis intermembrane space endomembrane system intron endosymbiosis lumen eukaryote lysosome
4 Slide 4 / 143 Vocabulary Click on each word below to go to the definition. matrix poly-a tail microfilament pre-mrna microtubule protist mitochondrion receptor-mediated endocytosis mrna processing RNA splicing nuclear envelope rough endoplasmic reticulum nuclear pore smooth endoplasmic reticulum nucleolus stroma nucleosome tight junction nucleus transcription factor organelle transport vesicle peroxisome turgor pressure phagocytosis pinocytosis plasmodesmata
5 Slide 5 / 143 Eukaryotes Unit Topics The Eukaryotic Cell The Nucleus & Gene Expression The Endomembrane System Energy-Converting Organelles Other Organelles & Cell Structures Click on the topic to go to that section
6 Slide 6 / 143 The Eukaryotic Cell Return to Table of Contents
7 Slide 7 / 143 All Cells All cells have 4 things in common. They are surrounded by a plasma membrane (or cell membrane). They contain a semifluid substance called the cytosol/cytoplasm. They contain structures called chromosomes, which carry the cell's genes. They have ribosomes, which assemble amino acids into proteins.
8 Slide 8 / 143 Eukaryotes vs. Prokaryotes There are 3 key differences between prokaryotic and eukaryotic cells. Eukaryotic cells are usually larger than prokaryotic cells. Eukaryotic cells have small compartments inside them call organelles. Most eukaryotes (but not all) are multi-cellular organisms.
9 Slide 9 / 143 1Which is NOT a basic feature of all cells? A B C D All cells are surrounded by a plasma membrane. Al cells contain a semifluid substance called the cytoplasm. All cells contain structures called chromosomes, which are contained the nucleus. All cells have ribosomes.
10 Slide 10 / 143 Cell Size Eukaryotic cells are, on average, much larger than prokaryotic cells. The average diameter of most prokaryotic cells is between 1 and 10µm. By contrast, most eukaryotic cells are between 5 to 100µm in diameter. Animal Cell (Eukaryote) Bacterium (Prokaryote)
11 Slide 11 / 143 Surface Area to Volume Ratio At the time when prokaryotic cells were evolving, there were most likely different sizes of cells. A cell's efficiency and ability to survive depended on its surface area to volume ratio. The volume of the cell determines the amount of chemical activity it can carry out per unit time. The surface area of the cell determines the amount of substances the cell can take in from the environment and the amount of waste it can release. As a cell grows in size, it's surface area to volume ratio decreases. It performs chemical reactions faster, but it has a harder time getting nutrients in and waste out.
12 Slide 12 / 143 Limits of Cell Size We know that cells need to be small enough so that they have an increased surface area to volume ratio, but be large enough to perform the chemical reactions of metabolism. Most Efficient Least Efficient The smaller the cell, the larger its surface area and the smaller its volume. The bigger the cell, the smaller the surface area is compared to its large volume inside.
13 To increase efficiency in the larger cell, eukaryotes evolved many bacterium-sized parts known as organelles. Organelles subdivide the cell into specialized compartments. Slide 13 / 143 Organelles They play many important roles in the cell. Some transport waste to the cell membrane. Others keep the molecules required for specific chemical reactions located within a certain compartment so they do not need to diffuse long distances to be useful.
14 Slide 14 / 143 Organelles Organelles making up Eukaryotic cells include: Nucleus Lysosomes Ribosomes Peroxisomes Mitochondria Vacuoles Smooth Endoplasmic Reticulum Rough Endoplasmic Reticulum Chloroplasts Golgi Apparatus
15 Slide 15 / 143 Multicellular Organisms Even with organelles, the size of the cell is limited to about 1000µm 3. This is why large organisms must consist of many smaller cells.
16 Slide 16 / 143 Diversity of Eukaryotes Protists: The first eukaryotic cells. Protists are single-celled eukaryotes. They range from protozoans to algae. Fungi: These organisms evolved second in time along with plants. Examples include mushrooms, molds, and mildews. Plants: Plants vary in type from the first plants called mosses to the modern flowering plants. Animals : Animals were the last eukaryotes to evolve. Animals range from ancient sponges and hydra to primates.
17 Slide 17 / 143 2Which of the following are prokaryotic cells? A B C D Plants Fungi Bacteria Animals
18 Slide 18 / How did eukaryotes solve the problem of small surface area to volume ratio? A by remaining the same size as prokaryotes B by becoming multicellular organisms C by compartmentalizing functions into organelles D they haven't solved the problem
19 Slide 19 / All eukaryotes are multi-cellular. True False
20 Slide 20 / 143 The Nucleus & Gene Expression Return to Table of Contents
21 Slide 21 / 143 The Nucleus The defining organelle in eukaryotic cell is the nucleus. The nucleus of the cell contains the DNA and controls the cell's activities by directing protein synthesis from DNA. prokaryotes: pro: before karyon: kernel/seed (nucleus) eukaryote: eu: true karyon: kernel/seed (nucleus) So prokaryote = "before a nucleus" And eukaryote = "true nucleus"
22 Slide 22 / 143 The Biological Nucleus The nucleus from chemistry with protons and neutrons is not the same nucleus involved with cells. Biological Nucleus The biological nucleus is usually, but not always, in the center of a cell and it is sometimes referred to as the "control center" of the cell.
23 Slide 23 / 143 Inside the Nucleus The nucleus is enclosed by a double cell membrane structure called the nuclear envelope. The nuclear envelope has many openings called nuclear pores. Nuclear pores help the nucleus "communicate" with other parts of the cell. Inside the nucleus is a dense region known as the nucleolus. The nucleolus is where rrna is made and ribosomes are assembled. They then exit through the nuclear pores.
24 Slide 24 / Main Functions of the Nucleus 1. To keep and contain a safe copy of all chromosomes (DNA) and pass them on to daughter cells in cell division. 2. To assemble ribosomes (specifically in the nucleolus). 3. To copy DNA instructions into RNA (via transcription).
25 Slide 25 / 143 5Cells that contain a "true nucleus" and other membrane bound organelles are. A B C D archaea. bacteria. eukaryotes. prokaryotes.
26 Slide 26 / Where is the DNA of a eukaryote found? A Nucleus B Nucleolus C Nucleoid D Mitochondria
27 Slide 27 / How does the nucleus control the activities of the cell? A B C D By making DNA. By directing protein synthesis. By allowing DNA to leave the nucleus to make proteins. By sending instructions to the mitochondria.
28 Slide 28 / 143 Many Cells = Same DNA All cells in a multicellular eukaryote contain the same genome. Every cell has all the genes necessary to make all parts of the organism. Cells become specialized by only expressing (turning on) certain genes, a small fraction of all the genes in the genome. These muscle cells and brain cells (neurons) have the same DNA but they are expressing different genes, that is why their structure and function are so different.
29 Slide 29 / 143 Transcription and Translation Transcription Transcription and translation occur in Eukaryotes the same as in Prokaryotes, but there are extra steps that help regulate expression.
30 Slide 30 / 143 Gene Expression in Prokaryotes Gene expression is regulated using operons that turn genes on and off depending on the chemical environment of the cell.
31 Slide 31 / 143 Gene Expression in Eukaryotes Overview Eukaryotes have much more complex chromosomes that require multiple levels of regulation including: "unpacking" of genes transcription factors RNA processing
32 Slide 32 / 143 8A particular triplet of bases in the template strand of DNA is AGT. The corresponding codon for the mrna transcribed is A B C D E AGT. UGA. TCA. ACU. UCA
33 Slide 33 / A codon A B C D E consists of two nucleotides. may code for the same amino acid as another codon. consists of discrete amino acid regions. catalyzes RNA synthesis. is found in all eukaryotes, but not in prokaryotes.
34 Slide 34 / If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for A B C D E leucine. valine. cystine. phenylalanine. proline.
35 Slide 35 / 143 Chromosomes DNA is configured into structures called chromosomes. Recall that prokaryotes have one chromosome that is double-stranded and circular. The number of chromosomes a eukaryote has depends on the species. These chromosomes are made up of a complex of tightly coiled DNA and associated proteins called chromatin. Species Chromosome # Adders-tongue (a fern) 1440 Dog 78 Human 46 Rat 42 Pig 38 Cat 38 Rice 24 Slime Mold 12 Jack Jumper Ant 2* *2 for females, 1 for males Source: Wikipedia.com
36 Slide 36 / 143 The DNA is tightly wound around proteins called histones, like thread wrapped on a spool. The combination of eight histones and DNA is called a nucleosome. Chromatin Video on how DNA is packaged
37 Slide 37 / 143 Chromatin's Role in Gene Expression When DNA is packed in chromatin it is not accessible to RNA polymerase so transcription can not happen. The main factor in the specialization of cells in multi-cellular organisms is what genes are "unpacked" from the chromatin to be exposed to RNA polymerase. All gene sequences are exposed to RNA polymerase Some genes exposed No genes exposed
38 Slide 38 / 143 Chromatin Modifying Enzymes The genes that need to be expressed are unwound from histones by chromatin modifying enzymes in order to expose their nucleotide sequences. Genes that are unnecessary to a particular cell will remain packed while the neccessary ones are unpacked.
39 Slide 39 / No two cells in the human body have exactly the same DNA. True False
40 Slide 40 / How many spools of DNA and proteins make a nucleosome?
41 Slide 41 / 143 Transcription Transcription of DNA into RNA occurs in the nucleus of the eukaryotic cell Eukaryotic RNA polymerase needs the assistance of proteins called transcription factors to help regulate when a gene is expressed. If all the necessary transcription factors are present for a specific gene, then the gene can be expressed. If any are missing, transcription will not start. There can be thousands of transcription factors in an organism's cells (3,000 in humans). The kind and number of them present in the nucleus at any given time dictate what genes are expressed.
42 Slide 42 / 143 Transcription Factors Transcription factors are proteins that are capable of binding with DNA. When they bind to areas near the promoter region of the gene they work with RNA polymerase to begin the transcription of that gene. They are produced in response to cues from the external environment of the cell. These proteins make the cell capable of turning on genes in response to external stimulus. This is essential to multicellular eukaryotes because it allows the different cells of the organism to communicate and respond to situations in unison. Video on regulated transcription
43 Slide 43 / 143 External Signals External signal activates membrane bound protein (receptor) Signal Receptor Metabolic pathway that produces a specific transcription factor in response to signal. The product enters the nucleus. Nucleus Transcription Factor Cell
44 Slide 44 / The first step in eukaryotic gene expression is... A transcription B translation C RNA processing D unraveling the gene
45 Slide 45 / Where does transcription occur in eukaryotic cells? A nucleus B nucleiod C cytoplasm D cell membrane
46 Slide 46 / Once the DNA is unwound from the chromatin, which of the following is necessary to begin transcription? A RNA polymerase B ribosome C transcription factors D both A & C
47 Slide 47 / Transcribe the following eukaryotic gene sequence: AACTGATTATGGGCT A AACTGATTATGGGCT B TTCACTAATACCCGA C UUGACUAAUACCCGA D UUCUGAUUAUGGGCU
48 Slide 48 / 143 mrna Processing After Transcription, the transcript is known as pre-mrna. Enzymes in the nucleus modify pre-mrna before the genetic messages are sent to the cytoplasm. This is know mrna processing. During mrna processing, both ends of the pre-mrna are altered. Some interior sequences of pre-mrna may be cut out, and other parts spliced together.
49 Slide 49 / 143 Alteration of mrna Ends The 5`end of the pre-mrna receives a molecule known as a nucleotide (or 5') cap. This cap is a modified guanine molecule (the G in A, T, C, G) pre-mrna 5' cap added AUGCCCUUAGCC GAUGCCCUUAGCC
50 Slide 50 / 143 Alteration of mrna Ends The 3` end of the pre-mrna gets a poly-a tail. This tail is series of adenosine (A) nucleotides. A A A A A A A A A A A A original pre-mrna AUGCCCUUAGCC 3' tail added GAUGCCCUUAGCCAAAAAAAA
51 Slide 51 / 143 Alteration of mrna Ends The modifications to the ends of the pre-mrna have several functions: They facilitate the export of mrna from the nucleus to the cytoplasm. They protect mrna from hydrolytic enzymes once it is in the cytoplasm. They help ribosomes attach to the mrna so they can be translated into a protein.
52 Slide 52 / 143 RNA Splicing Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions. These noncoding regions are called intervening sequences, or introns. The other regions called exons (because they are eventually expressed), are usually translated into amino acid sequences. RNA splicing removes introns and joins exons, creating an mrna molecule with a continuous coding sequence.
53 Slide 53 / What are the coding segments of a stretch of eukaryotic DNA called? A B C D introns exons codons replicons
54 Slide 54 / 143 mrna Processing This is an example of a pre-mrna becoming a final transcript.
55 Slide 55 / 143 Alternative RNA Splicing Some genes can code more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing. Alternative splicing allows the number of different proteins an organism can produce to be much greater than its number of genes.
56 Slide 56 / 143 Alternative RNA Splicing DNA sequence AAATTTCCCGGGAAATTTCCCGGG Pre-mRNA (Cap)-UUUAAAGGGCCCUUUAAAGGGCCC-(Tail) Alternate splices (Cap)-UUU AAA UUU AAA-(Tail) OR (Cap)-GGC CCG GGC-(Tail) Resulting polypeptide (protein) Phe - Lys - Phe - Lys OR Gly - Pro - Gly Alternate splicing can dramatically change the length and/or the sequence of the polypeptide chain that will be made
57 Slide 57 / Which of the following helps to stabilize mrna by inhibiting its degradation? A B C D E RNA polymerase ribosomes 5' cap poly-a tail both C and D
58 Slide 58 / A transcription unit that is 8,000 nucleotides long may use 1,200 nucleotides to make a protein consisting of 400 amino acids. This is best explained by the fact that A many noncoding nucleotides are present in mrna. B there is redundancy and ambiguity in the genetic code. C many nucleotides are needed to code for each amino acid. D nucleotides break off and are lost during the transcription process.
59 Slide 59 / Once transcribed, eukaryotic pre-mrna typically undergoes substantial alteration that includes A B C D E removal of introns. fusion into circular forms known as plasmids. linkage to histone molecules. union with ribosomes. fusion with other newly transcribed mrna.
60 Slide 60 / A mutation in which of the following parts of a gene is likely to be most damaging to a cell? A B C intron exon would be equally damaging.
61 Slide 61 / Alternative RNA splicing A B C can allow the production of proteins of dramatically different sizes from a single mrna. can allow the production of proteins of dramatically different amino acid sequences from a single mrna. Both can happen
62 Slide 62 / 143 Entrance into the Cytoplasm After the finalized mrna transcript is complete and correct, the pores in the nuclear envelope allow it to pass to the cytoplasm where it can be translated into proteins by ribosomes. The nuclear pore is a protein structure that controls the traffic flow of the nucleus. Each nuclear pore is made up of hundreds of individual proteins that insure only mrnas with proper caps and tails can make it to the cytoplasm.
63 Slide 63 / 143 Degradation of mrna Hydrolytic enzymes in the cytoplasm breakdown mrna molecules. The length of time an mrna suvives in the cytoplasm relates to how much protein is made from it. Longer time in the cytoplasm means more translation by ribosomes. The length of the poly-a tail is one of many factors that determines the time of survival in the cytoplasm. The longer the tail, the longer it's survival.
64 Slide 64 / What is the importance of nuclear pores? A B C D They allow the nucleus to communicate with other parts of the cell. They allow DNA to leave the nucleus in order to direct protein synthesis. They allow RNA to leave the nucleus in order to be translated in the cytoplasm. They allow single stranded DNA molecules to enter the nucleus and assemble into the double helix.
65 Slide 65 / 143 Summary of Gene Expression Regulation in Eukaryotes The gene must be unpacked from chromatin The right transcription factors must be present Transcription occurs Cap and tail must be added to the mrna Pre-mRNA must be edited (spliced) Nuclear pores allow passage to the cytoplasm mrna comes into contact with a ribosome Translation occurs Protein is used within the cell or exported to the environment
66 Slide 66 / 143 Endomembrane System Return to Table of Contents
67 Slide 67 / 143 The Endomembrane System Several organelles, some made up mainly of membranes, form a type of assembly line in the cell. They make a protein, then process and ship it to its final destination whether that be inside or outside the cell. Organelles included in this system include the nucleus, rough and smooth endoplasmic reticulum, golgi appartus, and lysosomes. Collectively, we refer to them as the endomembrane system. Note: The plasma membrane is also considered part of this system
68 Slide 68 / 143 The Endomembrane System
69 Slide 69 / 143 Endoplasmic Reticulum When RNA leaves the nucleus, it enters the endoplasmic reticulum (ER). This organelle is a series of membrane-bound sacs and tubules. It is continuous with the outer membrane of the nuclear envelope (reticulum comes from the latin word for little net). There are two types of endoplasmic reticulum: rough and smooth.
70 Slide 70 / 143 Rough Endoplasmic Reticulum Rough ER has ribosomes attached to its membrane (thus a rough appearance). These ribosomes synthesize proteins that will be used in the plasma membrane, secreted outside the cell or shipped to another organelle called a lysosome. As proteins are made by the ribosomes, they enter the lumen (opening) of the ER where they are folded and processed.
71 Slide 71 / 143 Ribosomes Recall that the ribosome is made of rrna and proteins. This is where translation occurs. Large subunit Ribosomes consist of two subunits, a small and a large. Each subunit consists of proteins and rrna. The two subunits come together when proteins need to be made. Small subunit
72 Slide 72 / 143 Ribosomes Recall ribosomes make peptide bonds between amino acids in translation. The instructions for making ribosomes are in the DNA. From DNA, rrna is made. Some of the rrna is structural and other rrna holds the code from the DNA to make the ribosomal proteins from mrna. transcription translation DNA mrna Protein
73 Slide 73 / Where are ribosomal subunits made in the cell? A B C D Cytoplasm Nucleus Nucleolus On the Plasma membrane
74 Slide 74 / What do ribosomes consist of? A B C D proteins and DNA proteins and rrna proteins only DNA only
75 Slide 75 / List all the parts of the endomembrane system. A B C D rough and smooth endoplasmic reticulum, golgi appartus, lysosomes nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes nucleus, rough and smooth endoplasmic reticulum, golgi appartus nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes, plasma membrane
76 Slide 76 / Which of the following is involved in making proteins? A Smooth E.R. B C D Ribosomes DNA Nuclear membrane
77 Slide 77 / 143 Smooth Endoplasmic Reticulum This type of ER is called Smooth because it lacks ribosomes on its surface. (it looks smooth compared to rough ER) There are a variety of functions of this organelle, which include: making lipids. processing certain drugs and poisons absorbed by the cell. storing calcium ions (for example, in muscle cells). Note: The liver is an organ that detoxifies substances that are brought into the body. Therefore, liver cells have huge amounts of Smooth ER.
78 Slide 78 / 143 Protein Transport Once the proteins are processed, short chains of sugars are sometimes linked to these proteins, which are then known as glycoproteins. These glycoproteins serve as "zip codes" that will tell the protein where it will go. When the molecule is ready to be exported out of the ER, it gets packaged into a transport vesicle. This vesicle is made of membranes from the ER itself. The transport vesicle travels to another organelle known as the Golgi apparatus.
79 Slide 79 / The endomembrane system serves to A B C D ship cell products to places in and out of the cell assemble DNA give directions to other organelles create pathways for organelles to travel
80 Slide 80 / What determines if we classify endoplasmic reticulum as smooth or rough? A B C D presence or absence of nuclear pores presence or absence of genetic material presence or absence of ribosomes presence of absence of DNA
81 Slide 81 / Where in the cell are lipids made? A B C D Nucleus Ribosomes Rough endoplasmic reticulum Smooth endoplasmic reticulum
82 Slide 82 / 143 Golgi Apparatus The main function of this organelle is to finish, sort, and ship cell products. It works like the postal department of the cell. Structurally, the golgi consists of stacked flattened sacs (sort of looks like a stack of pita bread).
83 Slide 83 / 143 Golgi Apparatus The Golgi is located near the cell membrane. The Golgi works closely with the ER of a cell. It receives and modifies substances manufactured by the ER. Once the substances are modified, they are shipped out to other areas of the cell. One key difference between the Golgi apparatus and endoplasmic reticulum is that the sacs comprising the Golgi are not interconnected.
84 Slide 84 / 143 The Golgi Apparatus & the ER The Golgi receives transport vesicles that bud off from the ER and contain proteins. It takes the substances contained in these vesicles and modifies them chemically in order to mark them and sort them into different batches depending on their destination. The finished products are then packaged into new transport vesicles which will then move to lysosomes, or will be inserted into the plasma membrane or dumped out of the cell if the protein is a secretory protein. Video on Protein Trafficking through the Golgi
85 Slide 85 / A difference between the Golgi Apparatus and the ER is that A B C D The ER takes the vesicles from the Golgi to transport The sacs making the Golgi are not interconnected The Golgi has ribosomes, the ER does not There is no difference, they are part of the same organelle
86 Slide 86 / Which organelle receives and modifies substances from the endoplasmic reticulum? A B C D Nucleus Ribosomes Lysosomes Golgi Bodies
87 Slide 87 / 143 Lysosomes Some proteins from the Golgi Apparatus are transported to the lysosomes. As the name suggests, a lysosome is an organelle that breaks down other substances. (lyse: to cause destruction) They consist of hydrolytic enzymes enclosed within a membrane. Hydrolytic enzymes break polymers into monomers through hydrolysis.
88 Slide 88 / 143 Lysosomes Lysosomes may fuse with food-containing organelles called vacuoles and then the enzymes digest the food, releasing nutrients into the cell. Protists do this. Damaged or unneeded proteins may become enclosed within a membranous vesicle which then fuses with a lysosome. The organic molecules from the breakdown process are recycled and reused by the cell.
89 Slide 89 / 143 Peroxisomes A peroxisome is a specific type of lysosome that forms and breaks down hydrogen peroxide (H 2 O 2 ) which is toxic to cells. In all cells, hydrogen peroxide forms constantly (from the combining of hydrogen and oxygen as bi-products of metabolism) and needs to be broken down quickly. Important note: Peroxisomes are not part of the endomembrane system.
90 Slide 90 / Which organelle contains hydrolytic enzymes that break down other substances? A B C D Endoplasmic Reticulum Golgi Bodies Lysosomes Vacuoles
91 Slide 91 / Which is not a function of lysosomes? A B C D aiding the cell in creating ribosomes fusing with vacuoles to digest food breaking polymers into monomers recycling worn out cell parts
92 Slide 92 / 143 Plasma Membrane Remember the plasma membrane is a phospholipid bilayer with proteins and other molecules interspersed throughout. Some proteins from the Golgi Apparatus become embedded in the membrane. Others are transported through the membrane to the external environment.
93 Slide 93 / 143 Plasma Membrane The 3 main functions of the plasma membrane: Selective Permeability Protection Structural support
94 Passive transport is the movement of substances from an area of high concentration to an area of low concentration without the requirement an energy input. Types include diffusion, osmosis, and facilitated diffusion. Slide 94 / 143 Membrane Transport - Review Passive Transport Active Transport (REQUIRES ENERGY) Active transport is the movement of substances from an area of low concentration to an area of high concentration and requires an input of energy.
95 Slide 95 / Which of the following statements about the role of phospholipids in forming membranes is correct? A B C D they are completely insoluble in water they form a single sheet in water they form a structure in which the hydrophobic portion faces outward they form a selectively permeable structure
96 Slide 96 / Active transport moves molecules A B C D with their concentration gradients without the use of energy with their concentration gradients using energy against their concentration gradients without the use of energy against their concentration gradients using energy
97 Slide 97 / Which of the following processes includes all others? A B C D passive transport facilitated diffusion diffusion of a solute across a membrane osmosis
98 Many proteins created by the cell are too large to pass through the membrane, even using protein carrier or integral proteins. How do these macromolecules exit the cell? Slide 98 / 143 Large Molecules and the Plasma Membrane When the substance needs other ways of getting into or out of a cell, they will enter and exit by fusing with the cell membrane. There are several special functions of the membrane as larger substances enter and exit the cell.
99 Slide 99 / 143 To excrete a macromolecule from the cell, the vesicles that enclose the proteins fuse with the plasma membrane and the vesicles then open up and spill their contents outside of the cell. Exocytosis Exocytosis This process is known as exocytosis. The vesicle will become part of the cell membrane. This is how secretory proteins from the Golgi exit the cell. This is true for insulin in the pancreas.
100 Slide 100 / 143 Insulin - A Secretory Protein Insulin is a protein hormone made by certain cells of the pancreas that enable cells to take glucose (sugar) in from the blood. Insulin is a secretory protein made in the rough ER. Specifically, it is secreted out of the pancreas cells into the blood stream.
101 Slide 101 / 143 Endocytosis The opposite of exocytosis is endocytosis. In this process, the cell takes in macromolecules or other particles by forming vesicles or vacuoles from its plasma membrane. This is how many protists ingest food particles
102 Slide 102 / Types of Endocytosis
103 Slide 103 / Types of Endocytosis Phagocytosis Is for taking in solid particles. ("phago" mean to eat) Pinocytosis Is for taking in liquids. However what the cell wants is not the liquid itself, but the substances that are dissolved in the liquid. ("pino" means to drink) Receptor-mediated endocytosis requires the help of a protein coat and receptor on the membrane to get through.
104 Slide 104 / The process by which a cell ingests large solid particles, therefore it is known as "cell eating". A B C D Pinocytosis Phagocytosis Exocytosis Osmoregulation
105 Slide 105 / Protein coated vesicles move through the plasma membrane via this process: A B C D Phagocytosis Active Transport Receptor-Mediated Endocytosis Pinocytosis
106 Slide 106 / After a vesicle empties its contents outside a cell, the vesicle becomes part of: A B C D the Golgi the plasma membrane another vesicle the extracellular fluid
107 Slide 107 / 143 Energy-Converting Organelles Return to Table of Contents
108 Slide 108 / 143 Energy-Converting Organelles Chloroplasts reside in plant cells and some protists and convert solar radiation into energy stored in the cell for later use. Mitochondria reside in all eukaryotic cells and convert chemical energy from glucose into ATP. Interestingly, both chloroplasts and mitochondria have their own DNA, separate from that found in the nucleus of the cell. They also have a double cell membrane.
109 Slide 109 / 143 Chloroplasts These organelles convert solar energy to chemical energy through photosynthesis. Chloroplasts are partitioned into three major compartments by internal membranes: Thylakoids Stroma Intermembrane space eukaryotic chloroplast
110 Slide 110 / 143 Thylakoids Remember that during photosynthesis it is on the thylakoid that the Light Dependent Reactions take place. eukaryotic chloroplast In prokaryotes, thylakoids are areas of highly folded membranes. In eukaryotes, they are stacked in the chloroplasts. The fluid outside these stacks of thylakoids is called the stroma; this is where the Calvin cycle takes place.
111 Slide 111 / 143 Mitochondria Mitochondria are sometimes referred to as the "powerhouses" of the cell. They convert chemical energy (glucose) into a more usable and regenerative form of chemical energy (ATP). The mitochondria is also partitioned like the chloroplast. They only have two compartments as opposed to three in the chloroplast. Matrix Intermembrane space
112 Slide 112 / 143 Mitochondria and Respiration Remember cell respiration must take place near a membrane so that a proton gradient can be built in a "membrane space" that is separate from the rest of the cell. Thus, the membrane would separate the inner volume, with a deficit of protons, from the outside, with an excess. In prokaryotes, the "inter-membrane space" is between the cell membrane and the cell wall. In eukaryotes, that membrane is the inter-membrane space of the mitochondria in between the inner membrane and outer membrane.
113 Slide 113 / 143 The Evolution of Eukaryotes The mitochondria and chloroplast are different from other eukaryotic organelles because they have their own DNA, their own ribosomes, and have a double cell membrane. In 1970, Lynn Margulis published the "Theory of Endosymbiosis" to explain these facts. The theory states that the mitochondria and chloroplast were once free-living prokaryotes that got taken up (or "eaten") by another prokaryote. The mitochondria was a bacteria that could make its own ATP. The chloroplast was a bacteria that could perform photosynthesis. endo: within sym: together bio: life sis: condition endosymbiosis = living together, within
114 Slide 114 / 143 Endosymbiotic Theory When they got taken up by another prokaryote, they dragged the one prokaryote's cell membrane around theirs, thus the double cell membrane. This now allowed the "new" eukaryote to make its own ATP or be able to do photosynthesis and make its own food. Thus the evolution of eukaryotes. Note: The nucleus and flagella could also have the same possible roots although they are not as heavily supported with evidence as the mitochondria and chloroplast.
115 Slide 115 / 143 Evidence for Symbiosis Both mitochondria and chloroplasts can arise only from preexisting mitochondria and chloroplasts. They cannot be form in a cell that lacks them. Both mitochondria and chloroplasts have their own DNA and it resembles the DNA of bacteria not the DNA found in the nucleus Both mitochondrial and chloroplast genomes consist of a single circular molecule of DNA, just like in prokaryotes. Both mitochondria and chloroplasts have their own proteinsynthesizing machinery, and it more closely resembles that of bacteria than that found in the cytoplasm of eukaryotes.
116 Slide 116 / 143 The Mitochondrial Eve Since mitochondrial DNA is not in the cell nucleus, it is only passed along from mother to child; animals, including you, inherit your mitochondria from your mother only. This is because the egg from our mothers contained her organelles. (Dad's sperm only contains the chromosomes, none of his organelles usually). All of our organelles we inherited from our mothers. Mitochondrial DNA is a way to trace maternal heritage through a family or through a species. The "Mitochondrial Eve" is the first human female that gave rise to all humans. In theory, we can trace all humans back to her through our mitochondrial DNA.
117 Slide 117 / Which organelle converts food energy into chemical energy that the cell can use? A B C D Nucleus Chloroplast Mitochondrion Golgi
118 Slide 118 / Which organelle converts solar energy into chemical energy in plants and other photosynthetic organisms? A B C D Nucleus Chloroplast Mitochondrion Golgi
119 Slide 119 / Which of the following is not true of mitochondria and chloroplasts? A They are present in all eukaryotic cells B They have their own DNA C They have their own ribosomes D They are surrounded by a double membrane
120 Slide 120 / Which of the following does NOT provide evidence for the endosymbiotic theory? A B C D Mitochondria and chloroplasts both have their own DNA. Mitochondria and chloroplasts both come from pre-existing mitochondria and chloroplasts. The DNA of mitochondria and chloroplasts resembles the DNA found in nuclei. The DNA of mitochondria and chloroplasts resembles that of bacteria.
121 Slide 121 / 143 Other Organelles and Cellular Structures Return to Table of Contents
122 Slide 122 / 143 Vacuoles Vacuoles are membranous sacs and they come in different shapes and sizes and have a variety of functions. Central Vacuole PLANT CELL PROTIST
123 Slide 123 / 143 Central Vacuoles Central Vacuoles in plants store water. Absorbing water makes a plant cell more turgid, or having more pressure inside - leading to strength and rigidity. Central vacuoles that are full will take over most of the cytoplasm and literally push the organelles to the sides of the cell. It can also store vital chemicals, pigments and waste products.
124 Slide 124 / 143 Turgor Pressure Increased turgor pressure results from the central vacuole being full with water. It presses out on the cell membrane which then presses out on the cell wall. The plant cell will not explode or lose its shape like an animal cell would in a hypotonic environment. When the turgor pressure decreases the cell is limp and droopy. This is associated with wilted, limp lettuce, as well as droopy flowers.
125 Slide 125 / 143 Contractile Vacuoles Contractile vacuoles can be found in certain single-celled protists. These act as a pump to expel excess water from the cell. This is especially helpful to those organisms living in a freshwater environment to keep the cell from exploding.
126 Slide 126 / 143 Food Vacuoles Food Vacuoles are mainly found in protists. The protist ingests food particles. The particles then fuse with a lysosome. The lysosome contains hydrolytic enzymes that break the food down. Paramecium fed dyed food showing vacuoles.
127 Slide 127 / An organelle found in plant cells that stores water as well as other important substances is called the. A B C D Lysosome Contractile Vacuole Central Vacuole Golgi bodies
128 Slide 128 / Food vacuoles are primarily found in which organisms? A B C D Plants Animals Protists Bacteria
129 Cytoskeleton is a network of fibers within the cytoplasm. Three types of fibers collectively make up the cytoskeleton: Microfilaments Intermediate filaments Microtubules These fibers provide structural support and are also involved in various types of cell movement and motility. Slide 129 / 143 Cytoskeleton
130 Slide 130 / Cells can be described as having a cytoskeleton of internal structures that contribute to the shape, organization, and movement of the cell. All of the following are part of the cytoskeleton except A B C D the nuclear envelope. microtubules. microfilaments. intermediate filaments.
131 Slide 131 / Which of the following is not a known function of the cytoskeleton? A B C D to maintain a critical limit on cell size to provide mechanical support to the cell to maintain the characteristic shape of the cell to hold mitochondria and other organelles in place within the cytosol
132 Slide 132 / 143 Cell wall The cell wall is an outer layer in addition to the plasma membrane, found in fungi, algae, and plant cells. The composition of the cell wall varies among species and even between cells in the same individual. All cell walls have carbohydrate fibers embedded in a stiff matrix of proteins and other carbohydrates. Plant cell walls are made of the polysaccharide cellulose. Fungal cell walls are made of the polysaccharide chitin.
133 Slide 133 / 143 Extracellular Matrix The cells of many multi-cellular animals are surround by a extracellular matrix (ECM). The ECM provides structural support to the cells in addition to providing various other functions such as anchorage, cellular healing, separating tissues from one another and regulating cellular communication. The ECM is primarily composed of an interlocking mesh of proteins and carbohydrates.
134 Slide 134 / 143 Cell Surfaces and Junctions Cell surfaces protect, support, and join cells. Cells interact with their environments and each other via their surfaces. Cells need to pass water, nutrients, hormones, and many, many more substances to one another. Adjacent cells communicate and pass substances to one another through cell junctions. Animal and plant cells have different types of cell junctions. This is mainly because plants have cell walls and animal cells do not.
135 Slide 135 / 143 Plant Cell Junctions Plant cells are supported by rigid cell walls made largely of cellulose. They connect by plasmodesmata which are channels that allow them to share water, food, and chemical messages.
136 Slide 136 / 143 Animal Cell Junctions Tight junctions Adhering junctions Communicating (Gap) junctions
137 Slide 137 / 143 Tight Junctions Tight junctions can bind cells together into leakproof sheets tight junction Example: the cells of the lining of the stomach or any epithelial lining where leaking of substances is not good.
138 Slide 138 / 143 Adhering Junctions Adhering junctions fasten cells together into strong sheets. They are somewhat leakproof. Example: actin is held together in muscle.
139 Slide 139 / 143 Communicating (Gap) Junctions Gap junctions allow substances to flow from cell to cell. They are totally leaky. They are the equivalent of plasmadesmata in plants. Example: important in embryonic development. Nutrients like sugars, amino acids, ions, and other molecules pass through.
140 Slide 140 / Which type of junction is found in plant cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction
141 Slide 141 / Which type of junction allows for the exchange of materials between animal cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction
142 Slide 142 / 143 Plant vs. Animal Cell Organelles Click here to review the similarities and difference between plant and animal cells
143 Slide 143 / 143 Organelles in Animal and Plant Cells Only Plant Both Only Animal mitochondria golgi apparatus smooth ER central vacuole cell wall rough ER ribosomes lysosomes plasma nucleus membrane chloroplasts
Class Work 31. Describe the function of the Golgi apparatus? 32. How do proteins travel from the E.R. to the Golgi apparatus? 33. After proteins are m
Eukaryotes Class Work 1. What does the word eukaryote mean? 2. What is the one major difference between eukaryotes and prokaryotes? 3. List the different kingdoms of the eukaryote domain in the order in
More informationSlide 1 / 113. Eukaryotes
Slide 1 / 113 Eukaryotes Slide 2 / 113 Prokaryotes and Eukaryotes prokaryotes: pro: before karyon: kernel/seed (nucleus) eukaryote: eu: true karyon: kernel/seed (nucleus) So prokaryote = "before a nucleus"
More informationOverview of Cells. Prokaryotes vs Eukaryotes The Cell Organelles The Endosymbiotic Theory
Overview of Cells Prokaryotes vs Eukaryotes The Cell Organelles The Endosymbiotic Theory Prokaryotic Cells Archaea Bacteria Come in many different shapes and sizes.5 µm 2 µm, up to 60 µm long Have large
More informationBasic Structure of a Cell
Basic Structure of a Cell Prokaryotic Cells No nucleus Archaea & Eubacteria One circular chromosome Extremely small Eukaryotic Cells Has a nucleus!!! Membrane-bound organelles Plants, Animals, Fungi, &
More informationComponents of a functional cell. Boundary-membrane Cytoplasm: Cytosol (soluble components) & particulates DNA-information Ribosomes-protein synthesis
Cell (Outline) - Components of a functional cell - Major Events in the History of Earth: abiotic and biotic phases; anaerobic and aerobic atmosphere - Prokaryotic cells impact on the biosphere - Origin
More informationCell (Learning Objectives)
Cell (Learning Objectives) 1. Understand & describe the basic components necessary for a functional cell. 2. Review the order of appearance of cells on earth and explain the endosymbiotic theory. 3. Compare
More informationBiology: Life on Earth
Teresa Audesirk Gerald Audesirk Bruce E. Byers Biology: Life on Earth Eighth Edition Lecture for Chapter 4 Cell Structure and Function Copyright 2008 Pearson Prentice Hall, Inc. Chapter 4 Outline 4.1 What
More informationCHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline
CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division
More informationProkaryotes and Eukaryotes prokaryotes Eukaryotes eukaryote Eukaryotes The Biological Nucleus Organelles Biological Nucleus biological nucleus
Slide 1 / 113 Slide 2 / 113 Prokaryotes and Eukaryotes Eukaryotes prokaryotes: pro: before karyon: kernel/seed (nucleus) eukaryote: eu: true karyon: kernel/seed (nucleus) So prokaryote = "before a nucleus"
More informationChapter 3: Cells. Lectures by Mark Manteuffel, St. Louis Community College
Chapter 3: Cells Lectures by Mark Manteuffel, St. Louis Community College Learning Objectives Be able to describe: what a cell is & two main classes of cells. structure & functions of cell membranes. how
More information8/25/ Opening Questions: Are all living things made of cells? What are at least five things you know about cells?
Chapter 3 The Cell: Module Hyperlinks 3.1 Cells are the fundamental units of life 3.2 Plant vs. animal cells 3.3 Membranes: structure 3.4 Membranes: function 3.5 The nucleus 3.6 Organelles in protein production
More informationThe Discovery of Cells
The Discovery of Cells Microscope observations! General Cell & Organelle Discovery 1600s Observations made by scientists using more powerful microscopes in the 1800s led to the formation of the cell theory.
More informationCell Types. Prokaryotes
Cell Types Prokaryotes before nucleus no membrane-bound nucleus only organelle present is the ribosome all other reactions occur in the cytoplasm not very efficient Ex.: bacteria 1 Cell Types Eukaryotes
More informationCell Structure. Chapter 4
Cell Structure Chapter 4 Cell Theory Cells were discovered in 1665 by Robert Hooke. Early studies of cells were conducted by - Mathias Schleiden (1838) - Theodor Schwann (1839) Schleiden and Schwann proposed
More informationGuided Reading Activities
Name Period Chapter 4: A Tour of the Cell Guided Reading Activities Big Idea: Introduction to the Cell Answer the following questions as you read Modules 4.1 4.4: 1. A(n) uses a beam of light to illuminate
More information7.L.1.2 Plant and Animal Cells. Plant and Animal Cells
7.L.1.2 Plant and Animal Cells Plant and Animal Cells Clarifying Objective: 7.L.1.2 Compare the structures and functions of plant and animal cells; include major organelles (cell membrane, cell wall, nucleus,
More informationO.k., Now Starts the Good Stuff (Part II) Eukaryotic Cell Structure and Function
O.k., Now Starts the Good Stuff (Part II) Eukaryotic Cell Structure and Function Eukaryotic Cells These cells have membrane-bound structures called organelles. Cell processes occur in these organelles.
More information4.1 Cells are the Fundamental Units of Life. Cell Structure. Cells. Fundamental units of life Cell theory. Except possibly viruses.
Cells 4.1 Cells are the Fundamental Units of Life Fundamental units of life Cell theory All living things are composed of one or more cells. The cell is the most basic unit of life. All cells come from
More informationCell Structure. Chapter 4. Cell Theory. Cells were discovered in 1665 by Robert Hooke.
Cell Structure Chapter 4 Cell Theory Cells were discovered in 1665 by Robert Hooke. Early studies of cells were conducted by - Mathias Schleiden (1838) - Theodor Schwann (1839) Schleiden and Schwann proposed
More informationEukaryotes. The Eukaryotic Cell. Slide 1 / 143 Slide 2 / 143. Slide 4 / 143. Slide 3 / 143. Slide 5 / 143. Slide 6 / 143.
Slide 1 / 143 Slide 2 / 143 Eukaryotes January 2014 www.njctl.org Slide 3 / 143 Vocabulary lick on each word below to go to the definition. 5' cap exocytosis adhering junction exon alternative splicing
More informationEukaryotes. Slide 1 / 143. Slide 2 / 143. Slide 3 / 143. January 2014
Slide 1 / 143 Slide 2 / 143 Eukaryotes January 2014 www.njctl.org Vocabulary lick on each word below to go to the definition. 5' cap exocytosis adhering junction exon alternative splicing extracellular
More informationChapter Life Is Cellular
Chapter 7 7-1 Life Is Cellular The Discovery of the Cell Anton van Leeuwenhoek used a single-lens microscope to observe tiny little organisms in pond water. The Discovery of the Cell In 1665, Robert Hooke
More informationCHARACTERISTICS OF LIFE ORGANIZATION OF LIFE CELL THEORY TIMELINE
CHARACTERISTICS OF LIFE 1. composed of cells either uni/multi 2. reproduce sexual and/or asexual 3. contain DNA in cells 4. grow and develop 5. use material/energy in metabolic reactions 6. respond to
More informationCELL TYPE. Unit #4: Cell Structure & Func2on. Classifica(on, Endosymbiosis, Cell Type, Cell Organelles
Unit #4: Cell Structure & Func2on Classifica(on, Endosymbiosis, Cell Type, Cell Organelles How are prokaryo(c cells and eukaryo(c cells similar? different? CELL TYPE Cell Theory Many scientists were involved
More information122-Biology Guide-5thPass 12/06/14. Topic 1 An overview of the topic
Topic 1 http://bioichiban.blogspot.com Cellular Functions 1.1 The eukaryotic cell* An overview of the topic Key idea 1: Cell Organelles Key idea 2: Plasma Membrane Key idea 3: Transport Across Membrane
More informationA. The Cell: The Basic Unit of Life. B. Prokaryotic Cells. D. Organelles that Process Information. E. Organelles that Process Energy
The Organization of Cells A. The Cell: The Basic Unit of Life Lecture Series 4 The Organization of Cells B. Prokaryotic Cells C. Eukaryotic Cells D. Organelles that Process Information E. Organelles that
More informationDivision Ave. High School AP Biology
Tour of the Cell 1 Types of cells Prokaryote bacteria cells - no organelles - organelles Eukaryote animal cells Eukaryote plant cells Why organelles? Specialized structures u specialized functions cilia
More informationCell Structure and Function
Cell Structure and Function Cell size comparison Animal cell Bacterial cell What jobs do cells have to do for an organism to live Gas exchange CO 2 & O 2 Eat (take in & digest food) Make energy ATP Build
More informationCELL PART Expanded Definition Cell Structure Illustration Function Summary Location ALL CELLS DNA Common in Animals Uncommon in Plants Lysosome
CELL PART Expanded Definition Cell Structure Illustration Function Summary Location is the material that contains the Carry genetic ALL CELLS information that determines material inherited characteristics.
More informationA. The Cell: The Basic Unit of Life. B. Prokaryotic Cells. C. Eukaryotic Cells. D. Organelles that Process Information
The Organization of Cells A. The Cell: The Basic Unit of Life Lecture Series 4 The Organization of Cells B. Prokaryotic Cells C. Eukaryotic Cells D. Organelles that Process Information E. Organelles that
More informationA cell is chemical system that is able to maintain its structure and reproduce. Cells are the fundamental unit of life. All living things are cells
Cell Biology A cell is chemical system that is able to maintain its structure and reproduce. Cells are the fundamental unit of life. All living things are cells or composed of cells. 1 The interior contents
More informationCell Theory. Cell Structure. Chapter 4. Cell is basic unit of life. Cells discovered in 1665 by Robert Hooke
Cell Structure Chapter 4 Cell is basic unit of life Cell Theory Cells discovered in 1665 by Robert Hooke Early cell studies conducted by - Mathias Schleiden (1838) - Theodor Schwann (1839) Schleiden &
More information7-2 Eukaryotic Cell Structure
1 of 49 Comparing the Cell to a Factory Eukaryotic Cell Structures Structures within a eukaryotic cell that perform important cellular functions are known as organelles. Cell biologists divide the eukaryotic
More informationGolgi Apparatus. BIOLOGY 1408 Chapter 4 : Tour of the cell part II 9/28/15
BIOLOGY 1408 Chapter 4 : Tour of the cell part II Golgi Apparatus n The Golgi apparatus functions in conjunction with the ER by modifying products of the ER Products travel in transport vesicles from the
More informationTopic 3: Cells Ch. 6. Microscopes pp Microscopes. Microscopes. Microscopes. Microscopes
Topic 3: Cells Ch. 6 -All life is composed of cells and all cells have a plasma membrane, cytoplasm, and DNA. pp.105-107 - The development of the microscope was the key to understanding that all living
More informationBig Idea 2: Biological systems utilize free energy and molecular building blocks to grow, to reproduce and to maintain dynamic homeostasis.
Big Idea 2: Biological systems utilize free energy and molecular building blocks to grow, to reproduce and to maintain dynamic homeostasis. Enduring understanding 2.B: Growth, reproduction and dynamic
More informationThe Cell Notes 1 of 11
The Cell The basic unit of structure and function in living things The smallest units in living things The smallest units in living things that show the characteristics of life Organisms can be made of
More informationprokaryotic eukaryotic
Cell Basics Two Basic Cell Types All cells are either prokaryotic or eukaryotic Prokaryotic Cells a.k.a. Bacteria Prokaryotes, which includes all bacteria. They are the simplest cellular organisms. They
More informationChapter 4 A Tour of the Cell*
Chapter 4 A Tour of the Cell* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Fundamental Units of Life Cells
More informationTurns sunlight, water & carbon dioxide (CO 2 ) into sugar & oxygen through photosynthesis
CELL PART/ ORGANELLE FUNCTION (what it does) PICTURE Plant, Animal, or Both Cell Membrane controls what goes in & out of the cell protects the cell Nucleus directs all the cell s activities contains cell
More informationHonors Biology-CW/HW Cell Biology 2018
Class: Date: Honors Biology-CW/HW Cell Biology 2018 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Hooke s discovery of cells was made observing a. living
More informationCell Organelles. a review of structure and function
Cell Organelles a review of structure and function TEKS and Student Expectations (SE s) B.4 Science concepts. The student knows that cells are the basic structures of all living things with specialized
More information10/1/2014. Chapter Explain why the cell is considered to be the basic unit of life.
Chapter 4 PSAT $ by October by October 11 Test 3- Tuesday October 14 over Chapter 4 and 5 DFA- Monday October 20 over everything covered so far (Chapters 1-5) Review on Thursday and Friday before 1. Explain
More informationThe cell. The cell theory. So what is a cell? 9/20/2010. Chapter 3
The cell Chapter 3 The cell theory all living organisms are made up of one or more cells, and all cells arise from other, pre-existing cells So what is a cell? The most basic unit of any organism The smallest
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationcells - relatively simple cells - lack nuclear membrane and many organelles - bacteria and their relatives are all prokaryotic
Cell Biology A cell is chemical system that is able to maintain its structure and reproduce. Cells are the fundamental unit of life. All living things are cells or composed of cells. 1 The interior contents
More informationBiology. 7-2 Eukaryotic Cell Structure 10/29/2013. Eukaryotic Cell Structures
Biology Biology 1of 49 2of 49 Eukaryotic Cell Structures Eukaryotic Cell Structures Structures within a eukaryotic cell that perform important cellular functions are known as organelles. Cell biologists
More informationCell Structure and Function
Cell Structure and Function Prokaryote vs. Eukaryote Prokaryotic cells: Pro- Before, Karyot- Center or Nucleus Very Basic Cells with no membrane bound organelles. DNA is not separate from the rest of the
More informationGoals: Viruses: not considered alive. Living cells. Plants. Bacteria. Animals. Archae Bacteria. Protists. Fungi. The prokaryotic cell structure
Goals: Identify the structures of eukaryotic and prokaryotic cells Identify the differences between viruses, prokaryotes and eukaryotes Use knowledge about differences between types of cells to solve a
More informationCell Is the basic structural, functional, and biological unit of all known living organisms. Cells are the smallest unit of life and are often called
The Cell Cell Is the basic structural, functional, and biological unit of all known living organisms. Cells are the smallest unit of life and are often called the "building blocks of life". The study of
More informationand their organelles
and their organelles Discovery Video: Cells REVIEW!!!! The Cell Theory 1. Every living organism is made of one or more cells. 2. The cell is the basic unit of structure and function. It is the smallest
More informationBiology 1 Notebook. Review Answers Pages 17 -?
Biology 1 Notebook Review Answers Pages 17 -? The History of Cell Studies 1. Robert Hook (1665) used a microscope to examine a thin slice of cork. The little boxes he observed reminded him of the small
More informationChapter 6 A Tour of the Cell
Chapter 6 A Tour of the Cell The cell is the basic unit of life Although cells differ substantially from one another, they all share certain characteristics that reflect a common ancestry and remind us
More information7-1 Life Is Cellular. Copyright Pearson Prentice Hall
7-1 Life Is Cellular The Discovery of the Cell What is the cell theory? The Discovery of the Cell The cell theory states: All living things are composed of cells. Cells are the basic units of structure
More informationCell Theory and Structure. Discoveries What are Cells? Cell Theory Cell Structures Organelles
Cell Theory and Structure Discoveries What are Cells? Cell Theory Cell Structures Organelles Discoveries In 1665 Robert Hooke observed a thin slice of cork from an oak tree What he saw reminded him of
More informationCell Theory Essential Questions
Cells Vocab words 1. Cell 2. Cell theory 3. Nucleus 4. Eukaryote 5. Prokaryote 6. Organelle 7. Cytoplasm 8. Nuclear envelope 9. Chromatin 10. Chromosome 11. Nucleolus 12. Ribosome 13. Endoplasmic reticulum
More informationBasic Structure of a Cell
Basic Structure of a Cell 1 Nonliving Levels ATOMS MOLECULES ORGANELLES 2 Living Levels CELLS life starts here TISSUES Similar cells working together 3 More Living Levels ORGANS ORGAN SYSTEMS ORGANISM
More informationCell Biology Review. The key components of cells that concern us are as follows: 1. Nucleus
Cell Biology Review Development involves the collective behavior and activities of cells, working together in a coordinated manner to construct an organism. As such, the regulation of development is intimately
More informationNow starts the fun stuff Cell structure and function
Now starts the fun stuff Cell structure and function Cell Theory The three statements of the cell theory are: All organisms are composed of one or more cells and the processes of life occur in these cells.
More informationChapter 3: Cells. The smallest part of you
Chapter 3: Cells The smallest part of you Learning Objectives Describe what a cell is and the two general types of cells. Describe the structure and functions of cell membranes. Describe several ways in
More information2011 The Simple Homeschool Simple Days Unit Studies Cells
1 We have a full line of high school biology units and courses at CurrClick and as online courses! Subscribe to our interactive unit study classroom and make science fun and exciting! 2 A cell is a small
More informationPrinciples of Cellular Biology
Principles of Cellular Biology آشنایی با مبانی اولیه سلول Biologists are interested in objects ranging in size from small molecules to the tallest trees: Cell Basic building blocks of life Understanding
More informationChemistry of Life Cells & Bioprocesses CRT Review
Chemistry of Life Cells & Bioprocesses CRT Review Chapter 2: The Chemistry of Life macromolecules - The four types of macromolecules are carbohydrates, lipids, nucleic acids, and proteins Types of Macromolecules
More informationLecture Series 3 The Organization of Cells
Lecture Series 3 The Organization of Cells Reading Assignments Read Chapter 15 Endomembrane System Read Chapter 17 Cytoskeleton A. The Cell: The Basic Unit of Life Cell Theory: All cells come from preexisting
More informationReading Assignments. A. The Cell: The Basic Unit of Life. Lecture Series 3 The Organization of Cells
Lecture Series 3 The Organization of Cells Reading Assignments Read Chapter 15 Endomembrane System Read Chapter 17 Cytoskeleton A. The Cell: The Basic Unit of Life Cell Theory: All cells come from preexisting
More informationCells: The Working Units of Life
4 Cells: The Working Units of Life Chapter 4 Cells: The Working Units of Life Key Concepts 4.1 Cells Provide Compartments for Biochemical Reactions 4.2 Prokaryotic Cells Do Not Have a Nucleus 4.3 Eukaryotic
More informationThe Cell. C h a p t e r. PowerPoint Lecture Slides prepared by Jason LaPres North Harris College Houston, Texas
C h a p t e r 2 The Cell PowerPoint Lecture Slides prepared by Jason LaPres North Harris College Houston, Texas Copyright 2009 Pearson Education, Inc., publishing as Pearson Benjamin Cummings Introduction
More informationBiology I. Chapter 7
Biology I Chapter 7 Interest Grabber NOTEBOOK #1 Are All Cells Alike? All living things are made up of cells. Some organisms are composed of only one cell. Other organisms are made up of many cells. 1.
More informationUNIT 3 CP BIOLOGY: Cell Structure
UNIT 3 CP BIOLOGY: Cell Structure Page CP: CHAPTER 3, Sections 1-3; HN: CHAPTER 7, Sections 1-2 Standard B-2: The student will demonstrate an understanding of the structure and function of cells and their
More informationBiology, 7e (Campbell) Chapter 6: A Tour of the Cell
Biology, 7e (Campbell) Chapter 6: A Tour of the Cell Chapter Questions 1) What limits the resolving power of a light microscope? A) the type of lens used to magnify the object under study B) the shortest
More informationChapter 1. DNA is made from the building blocks adenine, guanine, cytosine, and. Answer: d
Chapter 1 1. Matching Questions DNA is made from the building blocks adenine, guanine, cytosine, and. Answer: d 2. Matching Questions : Unbranched polymer that, when folded into its three-dimensional shape,
More informationToday s materials: Cell Structure and Function. 1. Prokaryote and Eukaryote 2. DNA as a blue print of life Prokaryote and Eukaryote. What is a cell?
Today s materials: 1. Prokaryote and Eukaryote 2. DNA as a blue print of life Prokaryote and Eukaryote Achadiah Rachmawati What is a cell? Cell Structure and Function All living things are made of cells
More informationUnit 3: Cells. Objective: To be able to compare and contrast the differences between Prokaryotic and Eukaryotic Cells.
Unit 3: Cells Objective: To be able to compare and contrast the differences between Prokaryotic and Eukaryotic Cells. The Cell Theory All living things are composed of cells (unicellular or multicellular).
More informationModule A Unit 4 Homeostasis and Transport. Mr. Mitcheltree
Module A Unit 4 Homeostasis and Transport Mr. Mitcheltree Surface area to Volume Ratio in Plants Surface area to Volume Ratio in us There are a number of necessary conditions that allow effective gaseous
More informationWhat Are the Main Characteristics of organisms?
What Are the Main Characteristics of organisms? 1. Made of CELLS 2. Require ENERGY (food) 3. REPRODUCE (species) 4. Maintain HOMEOSTASIS 5. ORGANIZED 6. RESPOND to environment 7. GROW and DEVELOP 8. EXCHANGE
More informationCells and Their Organelles
Mr. Ulrich Regents Biology Name:.. Cells and Their Organelles The cell is the basic unit of life. The following is a glossary of animal cell terms. All cells are surrounded by a cell membrane. The cell
More informationChapter 3: Cells The smallest part of you
Chapter 3: Cells The smallest part of you Lectures by Mark Manteuffel, St. Louis Community College Learning Objectives Describe what a cell is and the two general types of cells. Describe the structure
More informationBASIC BIOLOGICAL PRINCIPLES
BASIC BIOLOGICAL PRINCIPLES A1 A1. Basic Biological Principles 1. Describe the characteristics of life shared by all prokaryotic and eukaryotic organisms 2. Compare cellular structures and their function
More informationCells and Their Organelles
Cells and Their Organelles The cell is the basic unit of life. The following is a glossary of animal cell terms. All cells are surrounded by a cell membrane. The cell membrane is semipermeable, allowing
More informationChapter 6: A Tour of the Cell
AP Biology Reading Guide Fred and Theresa Holtzclaw Chapter 6: A Tour of the Cell Name Period Chapter 6: A Tour of the Cell Concept 6.1 To study cells, biologists use microscopes and the tools of biochemistry
More informationCELLS STRUCTURE AND FUNCTION
CELLS STRUCTURE AND FUNCTION Jhia Anjela D. Rivera Department of Biological Sciences School of Science and Technology Centro Escolar University DISCOVERY OF CELLS Robert Hooke (1665): Observed a thin slice
More informationZimmerman AP Biology CBHS South Name Chapter 7&8 Guided Reading Assignment 1) What is resolving power and why is it important in biology?
Zimmerman AP Biology CBHS South Name Chapter 7&8 Guided Reading Assignment 1) What is resolving power and why is it important in biology? 2) How does an electron microscope work and what is the difference
More informationLife is Cellular Section 7.1
Life is Cellular Section 7.1 Objectives Understand Cell theory Distinguish between prokaryotes and eukaryotes Understand different types of microscopy, and how they work in more detail What is a Cell?
More informationCell Organelles. 2. Cells are the basic unit of organization in an organism Cells tissues organ organ system organism
Cell Organelles What are some of the differences you see between these two cells? A. Cell Theory 1. All organisms are made up of one or more cells 2. Cells are the basic unit of organization in an organism
More informationChapter 7 Learning Targets Cell Structure & Function
Name: Chapter 7 Learning Targets Cell Structure & Function a. Define the word cell: 1. I know the history of the cell: b. Who discovered the cell? What did he observe? 2. I can list the three parts of
More informationBiology. Mrs. Michaelsen. Types of cells. Cells & Cell Organelles. Cell size comparison. The Cell. Doing Life s Work. Hooke first viewed cork 1600 s
Types of cells bacteria cells Prokaryote - no organelles Cells & Cell Organelles Doing Life s Work Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell Bacterial cell most
More informationIntroduction to Cells
Life Science Introduction to Cells All life forms on our planet are made up of cells. In ALL organisms, cells have the same basic structure. The scientist Robert Hooke was the first to see cells under
More informationOutline. Cell Structure and Function. Cell Theory Cell Size Prokaryotic Cells Eukaryotic Cells Organelles. Chapter 4
Cell Structure and Function Chapter 4 Cell Theory Cell Size Prokaryotic Cells Eukaryotic Cells Organelles! Nucleus Outline! Endomembrane System! Cytoskeleton! Centrioles, Cilia, and Flagella 1 2 Cell Theory
More information9/8/2010. Chapter 4. Structures Internal to the Cell Wall. The Plasma Membrane. Functional Anatomy of Prokaryotic and Eukaryotic Cells
Chapter 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells Johana Meléndez Part II slides 39-87 Lectures prepared by Christine L. Case Structures Internal to the Cell Wall Learning Objectives 4-8
More informationHistory of Cell Theory. Organization of Life
History of Cell Theory Robert Hooke first observed cells while examining cork under the microscope (mid- 1600 s) Anton van Leeuwenhoek first observed microscopic organisms in pond water, as well as blood
More information5. The cells in the liver that detoxify poison substances contain lots of a. smooth ER b. rough ER c. Golgi apparatus d. lysosomes e.
Chapter 7 practice 1. What scientist originally came up with the term "cell"? a. von Leeuwenhoek d. Watson b. Hooke e. Virchow c. van der Waals 2. When you wish to look at the coat of a virus on the surface
More informationName: Date: Hour:
Name: Date: Hour: 1 2 3 4 5 6 Comprehension Questions 1. At what level of organization does life begin? 2. What surrounds all cells? 3. What is meant by semipermeable? 4. What 2 things make up the cell
More informationEukaryotic Cell Structure. 7.2 Biology Mr. Hines
Eukaryotic Cell Structure 7.2 Biology Mr. Hines Comparing the cell to a factory In order for a cell to maintain its internal environment (homeostasis), many things must go on. This is similar to a factory.
More informationIntroduction to Cells
Life Science Introduction to Cells All life forms on our planet are made up of cells. In ALL organisms, cells have the same basic structure. The scientist Robert Hooke was the first to see cells under
More information02/02/ Living things are organized. Analyze the functional inter-relationship of cell structures. Learning Outcome B1
Analyze the functional inter-relationship of cell structures Learning Outcome B1 Describe the following cell structures and their functions: Cell membrane Cell wall Chloroplast Cytoskeleton Cytoplasm Golgi
More informationHonors Biology summer assignment. Review the notes and study them. There will be a test on this information the 1 st week of class
Honors Biology summer assignment Review the notes and study them. There will be a test on this information the 1 st week of class Biomolecules Molecules that make up living things. There are 4 molecules
More information3.1 Cell Theory. KEY CONCEPT Cells are the Basic unit of life.
3.1 Cell Theory KEY CONCEPT Cells are the Basic unit of life. 3.1 Cell Theory The cell theory grew out of the work of many scientists and improvements in the microscope. Many scientists contributed to
More informationWorld of The Cell. How big is a cell?
World of The Cell Chapter 4 How big is a cell? The smallest cell is a Mycoplasmas (very small bacteria are barely bigger) Bacteria are just bigger than a single organelle of a animal cell Plant and animal
More informationClass IX: Biology Chapter 5: The fundamental unit of life. Chapter Notes. 1) In 1665, Robert Hooke first discovered and named the cells.
Class IX: Biology Chapter 5: The fundamental unit of life. Key learnings: Chapter Notes 1) In 1665, Robert Hooke first discovered and named the cells. 2) Cell is the structural and functional unit of all
More informationHow do cell structures enable a cell to carry out basic life processes? Eukaryotic cells can be divided into two parts:
Essential Question How do cell structures enable a cell to carry out basic life processes? Cell Organization Eukaryotic cells can be divided into two parts: 1. Nucleus 2. Cytoplasm-the portion of the cell
More information