08/09/2015. Positives out of N=41 Results. Phadebas 54.3 % 19. RSID TM -Saliva 40 % % Given results

Transcription

1 1

2 Positives out of N=41 Results % % 6 5 5% 58,5% 8% BLOOD % SEMEN % SALIVA % ,5% 21,9% POSITIVE RESULTS NA Phadebas 54.3 % 19 Positive Negative RSID TM -Saliva 4 % 14 Positive Negative % Given results HPLC Teichmann crystals Hem-Check Hem-Direct Hemoglobin RapidSignal Occult Blood-Hemoglobin HemaTrace Hemoglobin OBTI Hemoglobin RSIDTM-Blood (Glycophorin A) Immuno Peroxidase % % % 3% 4% 5% 6% 7% 8% 9% Pruebas orientativas Induciendo el desprendimiento de oxígeno (capacidad del grupo Hemo para la actividad peroxidasa). El O 2 actúa en sustrato de bencidina (Adler), Luminol (derivado ácido ftálico), Thevenon Roland-Piramidón Pruebas de certeza 1.Cristalográficas (Teichmann, cristales de hematina; Tackayama: hemocromógeno) 2.Espectroscópicas (espectro absorción Hb y derivados) 3. Cromatográficas (TLC, HPLC) Pruebas específicas Inmunológicas 2

3 Positive Negative Inconclusive 3 Alternate Lights 2 % 2 2 Positive Negative Inconclusive 3

4 25 23 Boward ES. 15. Forensic Magazine. 5/21/15. On the scene and In the lab. Positive Negative ; 9% ; 4% Cytochrome b sequencing CO I,II sequencing 11; 44% SPInDEL STRs 2; 9% 4

5 Recomendaciones Linacre et al. 11. ISFGRecommendations regarding the use of non-human (animal) DNA in forensic genetic investigation. Forensic Science International: Genetics. doi:.16/j.fsigen

6 1% % 92% % 8% 6% 5% 4% % % Sequencing SPInDEL STRs Positive identification N=24 6

7 SPInDel multiplex 7

8 Graphical representation of the six ribosomal RNA (rrna) target regions in the mitochondrial DNA(mtDNA) amplified bymultiplex PCR inthe SPInDelprofilingkit Schematic illustration of the strategy used in the species identification by the insertions/deletions(spindel) method Four conserved regions (green boxes) define three hypervariable domains (dotted brown lines). A section of the alignmentis magnified to show the presence of multiple gaps in hypervariable regions. Each species is identified by a numeric profile resulting from the combination of lengths in hypervariableregions. Pereira F, Carneiro J, Matthiesen R, van Asch B, Pinto N, Gusmão L, Amorim A. Identification of species by multiplex analysis of variablelength sequences. Nucleic Acids Res. Dec;38(22):e3. The reference SPInDel profiles for the target species are: Species Markers SPID2716 SPID135 SPID639 SPID51 SPID2975 SPID2173 Capra hircus (Goat) Canis lupus familiaris (Dog) Equus caballus (Horse) Oryctolagus cuniculus (Rabbit) Felis catus (Cat) Homo sapiens (Human) Ovis aries (Sheep) Sus scrofa (Pig) Mus musculus (Mouse) Bos taurus (Cattle) Carneiro J, Pereira F, Amorim A. Mol Ecol Resour (6): Pereira F, Carneiro J, Matthiesen R, van Asch B, Pinto N, Gusmão L, Amorim A. Nucleic Acids Res. Dec;38(22):e3. Spanish and Portuguese-Speaking Working Group of the International Society for Forensic Genetics (GHEP-ISFG) isfg.org/pt/comisses-trabalho/exercicio-colaborativo-ghep-isfg- 82spindel.html 8

9 The reference SPInDel profiles for the species: Species Markers SPID2716 SPID135 SPID639 SPID51 SPID2975 SPID2173 Sus scrofa (Pig) Carneiro J, Pereira F, Amorim A. Mol Ecol Resour (6): Pereira F, Carneiro J, Matthiesen R, van Asch B, Pinto N, Gusmão L, Amorim A. Nucleic Acids Res. Dec;38(22):e3. Spanish and Portuguese-Speaking Working Group of the International Society for Forensic Genetics (GHEP-ISFG) isfg.org/pt/comisses-trabalho/exercicio-colaborativo-ghep-isfg- 82spindel.html STRs identification: Descripción del número de alelos identificados en distintas poblaciones para cada marcador microsatélite Marker Populations SW SW SW SW SW SW SW SWR SW SWR Estudio intraespecífico. STRs tetraméricos. Individualización. Linacreet al. 11. ForensicScience International: Genetics. doi:.16/j.fsigen

10 Locus Fluorescent label Size (bp) Sequence of primers (5-3 )* SW24 FAM 19 F:CTTTGGGTGGAG TGTGTGC R:ATC CAAATG CTGCAAGCG SW936 HEX 21 F:TCTGGAGCTAGC ATAAGTGCC R:GTGCAAGTACACATG CAG GG S355 HEX 26 F:TCTGGCTCCTAC ACTCCTTCTTGATG R:GTTTGGGTGGGTGCTGAAAAA TAG GA SW72 NED 18 F:ATC AGAACAGTGCGCCGT R:TTTGAAAAT GGGGTGTTTCC *Putnova et al. 3. Czech Janim Sci., 48 (8): Linet al. 14. ForensicSci. Int.: Genetics9: Naueet al.14.int JLegalMed.128:11-18 Rohreret al. 7. AnimalGenetics38: Escena del crimen (especies domésticas) Tráfico de especies exóticas Dípteros (análisis PMI) Fraude alimentario Microbiología forense