Genetic polymorphism analysis of t wo kinds of genetic markers in Hu sheep and Tong sheep
|
|
|
- Kelly Mills
- 5 years ago
- Views:
Transcription
1 2003, 26 (4) : Joural of N ajig A gricultural U iversity,,,, (, ) : , ( H) ( PIC) ( N e ) :, :, ; DNA ; : ; ; ; ; : S82612 : A : ( 2003) Geetic polymorphism aalysis of t wo kids of geetic markers i sheep ad Tog sheep YANG Zhag2pig, CHANG Hog, SUN Wei, GENG Rog2qig, MAO Yog2jiag ( College of Aimal Sciece ad Veteriary Medicie, Yagzhou Uiv, Yagzhou , Chia) Abstract : The geetic examiatio o 14 structural loci ad 7 microsatellite markers was carried out amog the radom samples i sheep ( ) ad Tog sheep ( Tog). Mea heterozygosity ( H), mea polymorphism iformatio cotets ( PIC) ad mea effective umber of alleles ( N e ) calculated by above two type of geetic marker data were compared. The results showed that mea H, PIC ad N e based o 7 microsatellite markers were greater tha that o structural loci. There were same tede2 cy betwee 2 populatios. It is idicate that structural loci ad microsatellite are reliable geetic markers for the research o ge2 etic polymorphism amog populatios ad much more abudat variatio ca be obtaied from microsatellite loci. There are approximate levels of polymorphism based o the two kids of geetic markers i two sheep populatios. These results support the usefuless of microsatellites i the study of geetic relatioships amog closely related populatios ad breeds. Key words : structural loci; microsatellite marker; mea heterozygosity; polymorphism iformatio cotets; effective um2 ber of alleles,, 1],,, ( geetic likage map) 2] 3], 4] Arraz J J 19 5,, 5] ; Yag L 5 1, 5 6] ; 5, 7],,, : : ( ) ; ( ) : ( 1965 ),,, E2mail : Tel :
2 4 : , 8], ml, 8 ml 9], 8 ml, SDS2EDTA, D NA 10] D NA 11], 112 ( Hb2 ) ( Al) ( Po) ( Tf) ( Alp) ( Lap) ( Ary2Es) X2 ( X2p) ( CA) ( MD H) ( Cat) D ( Es2D) ; ( Ly) ; MEDICA Na/ K/ Cl ( Ke) ; ( HICN), NICN Hb 14, Tsuoda K 12] 113 D NA 13 16] ( ) 1 1 MgCl 2 Table 1 The primer sequece, chromosome assigmet, aealig temperature ad MgCl 2 volume Chromosome assigmet Primer sequece / Aealig temperature MgCl 2 / L ( 25mmol L - 1 ) OarFCB 11 2 OarFCB OarFCB OarFCB MAF 70 4 MAF 33 9 OarAE ( CA strad) : GGCCTGAACTCACAAGTTGATATATCTATCAC ( GT strad) : GCAAGCAGGTTCTTTACCACTAGCACC ( CA strad) : CAGCTGAGCAACTAAGACATACATGGCG ( GT strad) : ATTAAAGCATCTTCTCTTTATTTCCTCGC ( CA strad) : CCCTAGGAGCTTTCAATAAAGAATCGG ( GT strad) : CGCTGCTGTCAACTGGGTCAGGG ( CA strad) : GAGTTATGTACAAGGATGACAAGAGGCAC ( GT strad) : GACTCTAGAGGATCGCAAAGAACCAG ( CA strad) : GCAGGACTCTACGGGGCCTTTGC ( GT strad) : CACGGAGTCACAAAGAGTCAGACC ( CA strad) : GATCATCTGAGTGTGAGTATATACAG ( GT strad) : GACTTTGTTTCAATCTATTCCAATTTC ( CA strad) : TAAGAAATATATTTGAAAAAACTGTATCTCCC ( GT strad) : TCCTTATAGATGCACTCAAGCTAGG PCR 20 L : 10 buffer 2 L, 25 mmol L - 1 MgCl L, 10 mmol L - 1 dntp 014 L, 8 pmol L - 1 GT CA 1 2 L, 5 U L - Taq 1 D NA L, 100 g D NA 20 L PCR : 94 5 mi ; s, s ( ), s, 30 ; mi, 4 PCR Hybird, HBPX220 PCR, 8 L 3 % 8 ( PAGE), EB, Kodak PBR322/ Msp I Marker, Kodak Digital Sciece ID Image Aalysis Software Ary2Es Alp Lap Ly X2p Ke 6, Al Tf Hb2 MD H Cat Es2D Po CA
3 ,, ( H) ( PIC) ( N e ) 17] : PIC = 1 - P 2 - H = 1 - N e P 2 i ; = 1/ P 2 i 2 P 2 i P 2 j = 2-1 l = i +1-1 l = i +1 P i P j (1 - P i P j ), P i P j i j ; , 14, 12 ( Al Es2D ) ; 7, 7 7, 212 H PIC N e H PIC N e, H PIC N e ( 3),, t, ; Table 2 Alleles frequecies of 7 microsatellite ad 14 structural loci at 2 sheep populatios Tog Tog Tog Tog OarFCB11 OarFCB48 MAF OarFCB OarAE
4 4 : 67 2 Table 2 cotiued Tog Tog Tog B Hb A B X2p Al X OarFCB304 C x Po CA F F S S Tf Cat MAF A B B C C MD H D F E S F Es2D Alp F B S B Ly Ary2Es A Ary2Es A Ary2Es Ke Lap L A H Tog 3 Table 3 The compariso of heterozgosity ( H), polymorphism iformatio cotet ( PIC), effective umber of alleles ( N e ) i 2 populatios based o structural gee ad microsatellite loci data H PIC N e Type Tog Tog Tog Structural loci Microsatellite loci , H PIC N e,,, D NA,,,, Nei Takezaki,, 18],,, 2], 14, Tf, 1 2, Tf PIC 015, 14 24,, OarFCB
5 , 7, PIC ,, PCR,,,,,, 14, Al Es2D, 1 4, ;, Fec B 5 OarAE ] ; Yag L 5 1 5, 8 6] 7, 7, ,, : 1] Su W, Chag H, Yag Z P, et al. Studies o the geetic relatioships at sheep populatios from east ad south of Cetral Asia J]. Asia2Aust J Aim Sci, 2002, 15( 10) : ] Baredse W, Vaima D, Kemp S L, et al. A medium desity geetic likage map of the bovie geome J]. Mammalia Geome, 1997, 8( 1) : ] Buchaa F C, Adams L J, Little Joh R P, et al. Determiatio of evolutioary relatioships amog sheep breeds usig microsatellites J]. Geomics, 1994, 15( 2) : ] Mary J, Mattpallil, Sheral, et al. Aalysis of coserved microsatellite sequece suggests closer relatioship bet wee water Buff alo Bubalus ad sheep Ovis aries J]. DNA ad Cell Biology, 1999, 18( 6) : ] Arraz J J, Bayo Y, Sa Primitivo F. Geetic relatioships amog Spaish sheep usig microsatellites J]. Aimal Geetics, 1998, 29( 6) : ] Yag L, Zhao S H, Li K, et al. Determiatio of geetic relatioships amog f ive idigeous Chiese goat breeds with six microsatel2 lite markers J]. Aimal Geetics, 1999, 30( 6) : ],,,. J]., 2002, 29( 6) : ]. M]. :, , ],,. M]. :, ]. M]. :, ]. M]. :, ] Tsuoda K, Noza wa K, Madeda Y, et al. Exteral morphological characters ad blood protei ad o protei polymorphisms of a2 tive sheep i cetral Mogolia J]. Rep Soc Res Native Livestock, 1999, 17 : ] Buchaa F C, Cra wford A M. Ovie diucleotide repeat polymorphism at the MAF 70 locus J]. Aimal Geetics, 1992, 23( 2) : ] Buchaa F C, Cra wford A M. Ovie diucleotide repet polymorphism at the MAF 33 locus J]. Aimal Geetics, 1992, 22( 2) : ] Buchaa F C, Cra wford A M. Ovie microsatellites at the Oar FCB11, Oar FCB128, Oar FCB193, OarFCB266 ad OarFCB304 loci J]. Aimal Geetics, 1993, 24( 2) : ] Motgomery G W, Gra wford A M, Pety J M, et al. The ovie Booroola fecudity gee ( FECB) is liked J]. Nature Geet, 1993, 4( 4) : ]. M].. :, ] Nei M, Takezaki N. Estimatio of geetic distace ad phylogeetic trees from DNA aalysis A]. Proc 5th World Cogr Geet Appl Lives Prod C]. Caada, 1994, 21 : :
Sample Size Determination (Two or More Samples)
Sample Sie Determiatio (Two or More Samples) STATGRAPHICS Rev. 963 Summary... Data Iput... Aalysis Summary... 5 Power Curve... 5 Calculatios... 6 Summary This procedure determies a suitable sample sie
F 1 F n kx. Keywords: entropy; independent assortment; random match; Hardy-Weinberg equilibrium; ternary tree algorithm
HEREDITAS (Beijig) 007 8, 9(8): 07 0 ISSN 05-977 www.chiagee.c w DOI: 0.60/yc-007-07 F F kx,,,, 545006 : e k w  r, p @ Âg k m k, gw k @, e m k  e k  m ; k m, Âd F p F r m, k F o, F r, q k  @ k hq @
QTL Mapping, MAS, and Genomic Selection
QTL Mappig, MAS, ad Geomic Selectio Dr. Be Hayes Departmet of Primary Idustries Victoria, Australia A short-course orgaized by Aimal Breedig & Geetics Departmet of Aimal Sciece Iowa State Uiversity Jue
Regression, Inference, and Model Building
Regressio, Iferece, ad Model Buildig Scatter Plots ad Correlatio Correlatio coefficiet, r -1 r 1 If r is positive, the the scatter plot has a positive slope ad variables are said to have a positive relatioship
Application of the Zhe Yin s Gene Inherits Law
Ope Joural of Geetics, 2014, 4, 434-438 Published Olie December 2014 i SciRes. http://www.scirp.org/joural/ojge http://dx.doi.org/10.4236/ojge.2014.46041 Applicatio of the Zhe Yi s Gee Iherits Law Zhe
New Ratio Estimators Using Correlation Coefficient
New atio Estimators Usig Correlatio Coefficiet Cem Kadilar ad Hula Cigi Hacettepe Uiversit, Departmet of tatistics, Betepe, 06800, Akara, Turke. e-mails : kadilar@hacettepe.edu.tr ; hcigi@hacettepe.edu.tr
Bayesian and E- Bayesian Method of Estimation of Parameter of Rayleigh Distribution- A Bayesian Approach under Linex Loss Function
Iteratioal Joural of Statistics ad Systems ISSN 973-2675 Volume 12, Number 4 (217), pp. 791-796 Research Idia Publicatios http://www.ripublicatio.com Bayesia ad E- Bayesia Method of Estimatio of Parameter
STP 226 EXAMPLE EXAM #1
STP 226 EXAMPLE EXAM #1 Istructor: Hoor Statemet: I have either give or received iformatio regardig this exam, ad I will ot do so util all exams have bee graded ad retured. PRINTED NAME: Siged Date: DIRECTIONS:
Properties and Hypothesis Testing
Chapter 3 Properties ad Hypothesis Testig 3.1 Types of data The regressio techiques developed i previous chapters ca be applied to three differet kids of data. 1. Cross-sectioal data. 2. Time series data.
The coalescent coalescence theory
The coalescet coalescece theory Peter Beerli September 1, 009 Historical ote Up to 198 most developmet i populatio geetics was prospective ad developed expectatios based o situatios of today. Most work
Provläsningsexemplar / Preview TECHNICAL REPORT INTERNATIONAL SPECIAL COMMITTEE ON RADIO INTERFERENCE
TECHNICAL REPORT CISPR 16-4-3 2004 AMENDMENT 1 2006-10 INTERNATIONAL SPECIAL COMMITTEE ON RADIO INTERFERENCE Amedmet 1 Specificatio for radio disturbace ad immuity measurig apparatus ad methods Part 4-3:
A Family of Unbiased Estimators of Population Mean Using an Auxiliary Variable
Advaces i Computatioal Scieces ad Techolog ISSN 0973-6107 Volume 10, Number 1 (017 pp. 19-137 Research Idia Publicatios http://www.ripublicatio.com A Famil of Ubiased Estimators of Populatio Mea Usig a
Expectation and Variance of a random variable
Chapter 11 Expectatio ad Variace of a radom variable The aim of this lecture is to defie ad itroduce mathematical Expectatio ad variace of a fuctio of discrete & cotiuous radom variables ad the distributio
Confidence interval for the two-parameter exponentiated Gumbel distribution based on record values
Iteratioal Joural of Applied Operatioal Research Vol. 4 No. 1 pp. 61-68 Witer 2014 Joural homepage: www.ijorlu.ir Cofidece iterval for the two-parameter expoetiated Gumbel distributio based o record values
Study on Coal Consumption Curve Fitting of the Thermal Power Based on Genetic Algorithm
Joural of ad Eergy Egieerig, 05, 3, 43-437 Published Olie April 05 i SciRes. http://www.scirp.org/joural/jpee http://dx.doi.org/0.436/jpee.05.34058 Study o Coal Cosumptio Curve Fittig of the Thermal Based
Extreme Value Charts and Analysis of Means (ANOM) Based on the Log Logistic Distribution
Joural of Moder Applied Statistical Methods Volume 11 Issue Article 0 11-1-01 Extreme Value Charts ad Aalysis of Meas (ANOM) Based o the Log Logistic istributio B. Sriivasa Rao R.V.R & J.C. College of
Linear Regression Models
Liear Regressio Models Dr. Joh Mellor-Crummey Departmet of Computer Sciece Rice Uiversity johmc@cs.rice.edu COMP 528 Lecture 9 15 February 2005 Goals for Today Uderstad how to Use scatter diagrams to ispect
Chapter 2 Descriptive Statistics
Chapter 2 Descriptive Statistics Statistics Most commoly, statistics refers to umerical data. Statistics may also refer to the process of collectig, orgaizig, presetig, aalyzig ad iterpretig umerical data
Reliability model of organization management chain of South-to-North Water Diversion Project during construction period
Water Sciece ad Egieerig, Dec. 2008, Vol. 1, No. 4, 107-113 ISSN 1674-2370, http://kkb.hhu.edu.c, e-mail: wse@hhu.edu.c Reliability model of orgaizatio maagemet chai of South-to-North Water Diversio Project
Pharmacogenomics. Yossi Levy Yossi Levy. Central Dogma of Molecular Biology
harmacogeomics Yossi Levy Cetral ogma of Molecular Biology Yossi Levy 0 Geome ad NA Geome cotais all biological iformatio Biological iformatio is ecoded i NA NA is divided to discrete uits called Gees
Benchmark Fitness Landscape Analysis
Bechmark Fitess Ladscape Aalysis Galia Merkuryeva, Vitalijs Bolshakovs Departmet of Modellig ad Simulatio Riga Techical Uiversity Riga, Latvia e-mail: galia.merkurjeva@rtu.lv; vitalijs.bolsakovs@rtu.lv
TIME SERIES AND REGRESSION APPLIED TO HOUSING PRICE
TIME SERIES AND REGRESSION APPLIED TO HOUSING PRICE CONTENT DESCRIPTIVE ANALYSIS OF THE HOUSING PRICE EVOLUTION AND THE MIBOR BY MEANS OF TIME SERIES CONCLUSIONS ON RELATIONSHIP AMONG AVERAGE PRICE OF
Mathematical Modeling of Optimum 3 Step Stress Accelerated Life Testing for Generalized Pareto Distribution
America Joural of Theoretical ad Applied Statistics 05; 4(: 6-69 Published olie May 8, 05 (http://www.sciecepublishiggroup.com/j/ajtas doi: 0.648/j.ajtas.05040. ISSN: 6-8999 (Prit; ISSN: 6-9006 (Olie Mathematical
Precise Rates in Complete Moment Convergence for Negatively Associated Sequences
Commuicatios of the Korea Statistical Society 29, Vol. 16, No. 5, 841 849 Precise Rates i Complete Momet Covergece for Negatively Associated Sequeces Dae-Hee Ryu 1,a a Departmet of Computer Sciece, ChugWoo
Lecture 7: Properties of Random Samples
Lecture 7: Properties of Radom Samples 1 Cotiued From Last Class Theorem 1.1. Let X 1, X,...X be a radom sample from a populatio with mea µ ad variace σ
CH 10: Meiosis / Sex Overview. Concept 10.1: Offspring acquire genes from parents by inheriting chromosomes
CH 10: Meiosis / Sex Overview Livig orgaisms are distiguished by their ability to reproduce their ow kid Heredity is the trasmissio of traits from oe geeratio to the ext Variatio is demostrated by the
Continuous Data that can take on any real number (time/length) based on sample data. Categorical data can only be named or categorised
Questio 1. (Topics 1-3) A populatio cosists of all the members of a group about which you wat to draw a coclusio (Greek letters (μ, σ, Ν) are used) A sample is the portio of the populatio selected for
Meiosis and Sexual Life Cycles
Overview: Variatios o a Theme Chapter 13 Meiosis ad Sexual Life Cycles Livig orgaisms are distiguished by their ability to reproduce their ow kid Geetics is the scietific study of heredity ad variatio
A STUDY OF VIBRATION MEASURING AND FATIGUE ANALYSIS FOR CANTILEVER BEAMS
Joural of Techology, Vol. 3, No., pp. 47-56 (07) 47, * LabView ANSYS A STUDY OF VIBRATION MEASURING AND FATIGUE ANALYSIS FOR CANTILEVER BEAMS Yuo-Ter Tsai, * Hsie-Yag Li Departmet of Mechaical Egieerig
Chapter 13, Part A Analysis of Variance and Experimental Design
Slides Prepared by JOHN S. LOUCKS St. Edward s Uiversity Slide 1 Chapter 13, Part A Aalysis of Variace ad Eperimetal Desig Itroductio to Aalysis of Variace Aalysis of Variace: Testig for the Equality of
Estimating the size of the transcriptome
Itroductio Poisso Dirichlet process Results Summary Estimatig the size of the trascriptome Statistical Modelig ad Machie Learig i Computatioal Systems Biology Jue -6, 9, Tampere, Filad Ole Wither Techical
Additional Notes and Computational Formulas CHAPTER 3
Additioal Notes ad Computatioal Formulas APPENDIX CHAPTER 3 1 The Greek capital sigma is the mathematical sig for summatio If we have a sample of observatios say y 1 y 2 y 3 y their sum is y 1 + y 2 +
f(x i ; ) L(x; p) = i=1 To estimate the value of that maximizes L or equivalently ln L we will set =0, for i =1, 2,...,m p x i (1 p) 1 x i i=1
Parameter Estimatio Samples from a probability distributio F () are: [,,..., ] T.Theprobabilitydistributio has a parameter vector [,,..., m ] T. Estimator: Statistic used to estimate ukow. Estimate: Observed
A Note on the Kolmogorov-Feller Weak Law of Large Numbers
Joural of Mathematical Research with Applicatios Mar., 015, Vol. 35, No., pp. 3 8 DOI:10.3770/j.iss:095-651.015.0.013 Http://jmre.dlut.edu.c A Note o the Kolmogorov-Feller Weak Law of Large Numbers Yachu
THE DATA-BASED CHOICE OF BANDWIDTH FOR KERNEL QUANTILE ESTIMATOR OF VAR
Iteratioal Joural of Iovative Maagemet, Iformatio & Productio ISME Iteratioal c2013 ISSN 2185-5439 Volume 4, Number 1, Jue 2013 PP. 17-24 THE DATA-BASED CHOICE OF BANDWIDTH FOR KERNEL QUANTILE ESTIMATOR
1 Inferential Methods for Correlation and Regression Analysis
1 Iferetial Methods for Correlatio ad Regressio Aalysis I the chapter o Correlatio ad Regressio Aalysis tools for describig bivariate cotiuous data were itroduced. The sample Pearso Correlatio Coefficiet
: Q343 : A : (2005)
2005, 28 (2) : 75 79 Journal of N anjing A gricultural U niversity BM PR2IB 1, 2, 1, 2, 1, 2, 1 1, 33, (11, 210095; 21, 832000; 31, 430070) : BMPR2IB, PCR2RFLP 553, BMPR2IB, BMPR2IB ( ) 3 (BB B + + + ),
Comparison of Minimum Initial Capital with Investment and Non-investment Discrete Time Surplus Processes
The 22 d Aual Meetig i Mathematics (AMM 207) Departmet of Mathematics, Faculty of Sciece Chiag Mai Uiversity, Chiag Mai, Thailad Compariso of Miimum Iitial Capital with Ivestmet ad -ivestmet Discrete Time
Confidence Interval for one population mean or one population proportion, continued. 1. Sample size estimation based on the large sample C.I.
Cofidece Iterval for oe populatio mea or oe populatio proportio, cotiued 1. ample size estimatio based o the large sample C.I. for p ˆ(1 ˆ) ˆ(1 ˆ) From the iterval ˆ p p Z p ˆ, p Z p p L legh of your 100(1
Big Picture. 5. Data, Estimates, and Models: quantifying the accuracy of estimates.
5. Data, Estimates, ad Models: quatifyig the accuracy of estimates. 5. Estimatig a Normal Mea 5.2 The Distributio of the Normal Sample Mea 5.3 Normal data, cofidece iterval for, kow 5.4 Normal data, cofidece
A Further Refinement of Van Der Corput s Inequality
IOSR Joural of Mathematics (IOSR-JM) e-issn: 78-578, p-issn:9-75x Volume 0, Issue Ver V (Mar-Apr 04), PP 7- wwwiosrjouralsorg A Further Refiemet of Va Der Corput s Iequality Amusa I S Mogbademu A A Baiyeri
Discrete Orthogonal Moment Features Using Chebyshev Polynomials
Discrete Orthogoal Momet Features Usig Chebyshev Polyomials R. Mukuda, 1 S.H.Og ad P.A. Lee 3 1 Faculty of Iformatio Sciece ad Techology, Multimedia Uiversity 75450 Malacca, Malaysia. Istitute of Mathematical
CHAPTER 4 BIVARIATE DISTRIBUTION EXTENSION
CHAPTER 4 BIVARIATE DISTRIBUTION EXTENSION 4. Itroductio Numerous bivariate discrete distributios have bee defied ad studied (see Mardia, 97 ad Kocherlakota ad Kocherlakota, 99) based o various methods
S160 #12. Review of Large Sample Result for Sample Proportion
S160 #12 Samplig Distributio of the Proportio, Part 2 JC Wag February 25, 2016 Review of Large Sample Result for Sample Proportio Recall that for large sample (ie, sample size is large, say p > 5 ad (1
, Waxy : A : (2003)
2003, 26 (3) : 1 6 Journal of Nanjing Agricultural University ( T1 ae stivum L1) Waxy 3, (, 210095) : SDS2PAGE 293 ( ) Waxy, Wx2A1 2 ; Wx2B1 15, 14 ; Wx2D1 2 ; Wx2A1 Wx2B1 2 ; 3 Waxy, Wx2A1 STS : ; Waxy
TABLES AND FORMULAS FOR MOORE Basic Practice of Statistics
TABLES AND FORMULAS FOR MOORE Basic Practice of Statistics Explorig Data: Distributios Look for overall patter (shape, ceter, spread) ad deviatios (outliers). Mea (use a calculator): x = x 1 + x 2 + +
AClassofRegressionEstimatorwithCumDualProductEstimatorAsIntercept
Global Joural of Sciece Frotier Research: F Mathematics ad Decisio Scieces Volume 15 Issue 3 Versio 1.0 Year 2015 Type : Double Blid Peer Reviewed Iteratioal Research Joural Publisher: Global Jourals Ic.
Minimum Dominating Set Approach to Analysis and Control of Biological Networks
Miimum Domiatig Set Approach to Aalysis ad Cotrol of Biological Networks Tatsuya Akutsu Bioiformatics Ceter Istitute for Chemical Research, Kyoto Uiversity Joit work with Jose Nacher i Toho Uiversity Motivatio:
ANOTHER WEIGHTED WEIBULL DISTRIBUTION FROM AZZALINI S FAMILY
ANOTHER WEIGHTED WEIBULL DISTRIBUTION FROM AZZALINI S FAMILY Sulema Nasiru, MSc. Departmet of Statistics, Faculty of Mathematical Scieces, Uiversity for Developmet Studies, Navrogo, Upper East Regio, Ghaa,
On a Smarandache problem concerning the prime gaps
O a Smaradache problem cocerig the prime gaps Felice Russo Via A. Ifate 7 6705 Avezzao (Aq) Italy felice.russo@katamail.com Abstract I this paper, a problem posed i [] by Smaradache cocerig the prime gaps
TABLES AND FORMULAS FOR MOORE Basic Practice of Statistics
TABLES AND FORMULAS FOR MOORE Basic Practice of Statistics Explorig Data: Distributios Look for overall patter (shape, ceter, spread) ad deviatios (outliers). Mea (use a calculator): x = x 1 + x 2 + +
G. R. Pasha Department of Statistics Bahauddin Zakariya University Multan, Pakistan
Deviatio of the Variaces of Classical Estimators ad Negative Iteger Momet Estimator from Miimum Variace Boud with Referece to Maxwell Distributio G. R. Pasha Departmet of Statistics Bahauddi Zakariya Uiversity
METHOD OF FUNDAMENTAL SOLUTIONS FOR HELMHOLTZ EIGENVALUE PROBLEMS IN ELLIPTICAL DOMAINS
Please cite this article as: Staisław Kula, Method of fudametal solutios for Helmholtz eigevalue problems i elliptical domais, Scietific Research of the Istitute of Mathematics ad Computer Sciece, 009,
A collocation method for singular integral equations with cosecant kernel via Semi-trigonometric interpolation
Iteratioal Joural of Mathematics Research. ISSN 0976-5840 Volume 9 Number 1 (017) pp. 45-51 Iteratioal Research Publicatio House http://www.irphouse.com A collocatio method for sigular itegral equatios
Lecture 5. Materials Covered: Chapter 6 Suggested Exercises: 6.7, 6.9, 6.17, 6.20, 6.21, 6.41, 6.49, 6.52, 6.53, 6.62, 6.63.
STT 315, Summer 006 Lecture 5 Materials Covered: Chapter 6 Suggested Exercises: 67, 69, 617, 60, 61, 641, 649, 65, 653, 66, 663 1 Defiitios Cofidece Iterval: A cofidece iterval is a iterval believed to
Parameter, Statistic and Random Samples
Parameter, Statistic ad Radom Samples A parameter is a umber that describes the populatio. It is a fixed umber, but i practice we do ot kow its value. A statistic is a fuctio of the sample data, i.e.,
STATS 200: Introduction to Statistical Inference. Lecture 1: Course introduction and polling
STATS 200: Itroductio to Statistical Iferece Lecture 1: Course itroductio ad pollig U.S. presidetial electio projectios by state (Source: fivethirtyeight.com, 25 September 2016) Pollig Let s try to uderstad
1 of 7 7/16/2009 6:06 AM Virtual Laboratories > 6. Radom Samples > 1 2 3 4 5 6 7 6. Order Statistics Defiitios Suppose agai that we have a basic radom experimet, ad that X is a real-valued radom variable
BIOSTATISTICS. Lecture 5 Interval Estimations for Mean and Proportion. dr. Petr Nazarov
Microarray Ceter BIOSTATISTICS Lecture 5 Iterval Estimatios for Mea ad Proportio dr. Petr Nazarov 15-03-013 petr.azarov@crp-sate.lu Lecture 5. Iterval estimatio for mea ad proportio OUTLINE Iterval estimatios
Some Exponential Ratio-Product Type Estimators using information on Auxiliary Attributes under Second Order Approximation
; [Formerly kow as the Bulleti of Statistics & Ecoomics (ISSN 097-70)]; ISSN 0975-556X; Year: 0, Volume:, Issue Number: ; It. j. stat. eco.; opyright 0 by ESER Publicatios Some Expoetial Ratio-Product
Molecular Mechanisms of Gas Diffusion in CO 2 Hydrates
Supportig Iformatio Molecular Mechaisms of Gas Diffusio i CO Hydrates Shuai Liag, * Deqig Liag, Negyou Wu,,3 Lizhi Yi, ad Gaowei Hu,3 Key Laboratory of Gas Hydrate, Guagzhou Istitute of Eergy Coversio,
Observation of Landau levels on nitrogen-doped flat graphite. surfaces without external magnetic fields
Supplemetary Iformatio Observatio of Ladau levels o itroge-doped flat graphite surfaces without exteral magetic fields Takahiro Kodo,, oghui Guo, Taishi Shikao, Tetsuya Suzuki, Masataka Sakurai, Susumu
Chapter 23: Inferences About Means
Chapter 23: Ifereces About Meas Eough Proportios! We ve spet the last two uits workig with proportios (or qualitative variables, at least) ow it s time to tur our attetios to quatitative variables. For
Elementary Statistics
Elemetary Statistics M. Ghamsary, Ph.D. Sprig 004 Chap 0 Descriptive Statistics Raw Data: Whe data are collected i origial form, they are called raw data. The followig are the scores o the first test of
Central limit theorem and almost sure central limit theorem for the product of some partial sums
Proc. Idia Acad. Sci. Math. Sci. Vol. 8, No. 2, May 2008, pp. 289 294. Prited i Idia Cetral it theorem ad almost sure cetral it theorem for the product of some partial sums YU MIAO College of Mathematics
Lesson 11: Simple Linear Regression
Lesso 11: Simple Liear Regressio Ka-fu WONG December 2, 2004 I previous lessos, we have covered maily about the estimatio of populatio mea (or expected value) ad its iferece. Sometimes we are iterested
1036: Probability & Statistics
036: Probability & Statistics Lecture 0 Oe- ad Two-Sample Tests of Hypotheses 0- Statistical Hypotheses Decisio based o experimetal evidece whether Coffee drikig icreases the risk of cacer i humas. A perso
Mathematical Notation Math Introduction to Applied Statistics
Mathematical Notatio Math 113 - Itroductio to Applied Statistics Name : Use Word or WordPerfect to recreate the followig documets. Each article is worth 10 poits ad ca be prited ad give to the istructor
Interval Intuitionistic Trapezoidal Fuzzy Prioritized Aggregating Operators and their Application to Multiple Attribute Decision Making
Iterval Ituitioistic Trapezoidal Fuzzy Prioritized Aggregatig Operators ad their Applicatio to Multiple Attribute Decisio Makig Xia-Pig Jiag Chogqig Uiversity of Arts ad Scieces Chia cqmaagemet@163.com
Regional flood frequency analysis based on L-moment approach (case study Halil-River basin)
Proceedigs of The Fourth Iteratioal Ira & Russia Coferece 273 Regioal flood frequecy aalysis based o L-momet approach (case study Halil-River basi) Rahama M. B., Rostami R., 2 -Assistat Prof. Irrigatio
On the distributional expansions of powered extremes from Maxwell distribution
O the distributioal expasios of powered extremes from Maxwell distributio Jiawe Huag a, Xilig Liu b, Jiaju Wag a, Zhogqua Ta c, Jigyao Hou a, Hao Pu d a School of Mathematics ad Statistics, Southwest Uiversity,
Free Space Optical Wireless Communications under Turbulence Channel Effect
IOSR Joural of Electroics ad Commuicatio Egieerig (IOSR-JECE) e-issn: 78-834,p- ISSN: 78-8735.Volume 9, Issue 3, Ver. III (May - Ju. 014), PP 01-08 Free Space Optical Wireless Commuicatios uder Turbulece
Correlation. Two variables: Which test? Relationship Between Two Numerical Variables. Two variables: Which test? Contingency table Grouped bar graph
Correlatio Y Two variables: Which test? X Explaatory variable Respose variable Categorical Numerical Categorical Cotigecy table Cotigecy Logistic Grouped bar graph aalysis regressio Mosaic plot Numerical
Population Structure
Ch 4: Population Subdivision Population Structure v most natural populations exist across a landscape (or seascape) that is more or less divided into areas of suitable habitat v to the extent that populations
Estimation for Complete Data
Estimatio for Complete Data complete data: there is o loss of iformatio durig study. complete idividual complete data= grouped data A complete idividual data is the oe i which the complete iformatio of
Correspondence should be addressed to Wing-Sum Cheung,
Hidawi Publishig Corporatio Joural of Iequalities ad Applicatios Volume 2009, Article ID 137301, 7 pages doi:10.1155/2009/137301 Research Article O Pečarić-Raić-Dragomir-Type Iequalities i Normed Liear
Introduction to regression
Itroductio to regressio Regressio Bria Caffo, Jeff Leek ad Roger Peg Johs Hopkis Bloomberg School of Public Health A famous motivatig example (Perhaps surprisigly, this example is still relevat) http://www.ature.com/ejhg/joural/v17/8/full/ejhg20095a.html
A note on the p-adic gamma function and q-changhee polynomials
Available olie at wwwisr-publicatioscom/jmcs J Math Computer Sci, 18 (2018, 11 17 Research Article Joural Homepage: wwwtjmcscom - wwwisr-publicatioscom/jmcs A ote o the p-adic gamma fuctio ad q-chaghee
Mapping of the Genes for Pea Comb, Blue Egg, Barring, Silver, and Blood Groups A, E, H, and P in the Domestic Fowl 1
Mappig of the Gees for Pea Comb, Blue Egg, Barrig, Silver, ad Blood Groups A, E, H, ad P i the Domestic Fowl 1 J.J. BITGOOD, R. N. SHOFFNER, ad J. S. OTIS Departmet of Aimal Sciece, Uiversity of Miesota,
NCSS Statistical Software. Tolerance Intervals
Chapter 585 Itroductio This procedure calculates oe-, ad two-, sided tolerace itervals based o either a distributio-free (oparametric) method or a method based o a ormality assumptio (parametric). A two-sided
New Exponential Strengthening Buffer Operators and Numerical Simulation
Sesors & Trasducers, Vol. 59, Issue, November 0, pp. 7-76 Sesors & Trasducers 0 by IFSA http://www.sesorsportal.com New Expoetial Stregtheig Buffer Operators ad Numerical Simulatio Cuifeg Li, Huajie Ye,
A Statistical hypothesis is a conjecture about a population parameter. This conjecture may or may not be true. The null hypothesis, symbolized by H
Hypothesis Testig A Statistical hypothesis is a cojecture about a populatio parameter. This cojecture may or may ot be true. The ull hypothesis, symbolized by H 0, is a statistical hypothesis that states
Open Access Nonlinear Correction of Sensor Based on Immunization Programs
Sed Orders or Reprits to reprits@bethamsciece.ae The Ope Automatio ad Cotrol Systems Joural, 2014, 6, 1705-1709 1705 Ope Access Noliear Correctio o Sesor Based o Immuizatio Programs Lirog Lu 1, Xiaodog
Chapter 7 Student Lecture Notes 7-1
Chapter 7 Studet Lecture otes 7-1 Basic Busiess Statistics (9 th Editio) Chapter 7 Samplig Distributios 24 Pretice-Hall, Ic. Chap 7-1 Chapter Topics Samplig Distributio of the Mea The Cetral Limit Theorem
Econ 325/327 Notes on Sample Mean, Sample Proportion, Central Limit Theorem, Chi-square Distribution, Student s t distribution 1.
Eco 325/327 Notes o Sample Mea, Sample Proportio, Cetral Limit Theorem, Chi-square Distributio, Studet s t distributio 1 Sample Mea By Hiro Kasahara We cosider a radom sample from a populatio. Defiitio
UNIVERSITY OF TORONTO Faculty of Arts and Science APRIL/MAY 2009 EXAMINATIONS ECO220Y1Y PART 1 OF 2 SOLUTIONS
PART of UNIVERSITY OF TORONTO Faculty of Arts ad Sciece APRIL/MAY 009 EAMINATIONS ECO0YY PART OF () The sample media is greater tha the sample mea whe there is. (B) () A radom variable is ormally distributed
Access to the published version may require journal subscription. Published with permission from: Elsevier.
This is a author produced versio of a paper published i Statistics ad Probability Letters. This paper has bee peer-reviewed, it does ot iclude the joural pagiatio. Citatio for the published paper: Forkma,
Introducing Sample Proportions
Itroducig Sample Proportios Probability ad statistics Studet Activity TI-Nspire Ivestigatio Studet 60 mi 7 8 9 10 11 12 Itroductio A 2010 survey of attitudes to climate chage, coducted i Australia by the
R. van Zyl 1, A.J. van der Merwe 2. Quintiles International, University of the Free State
Bayesia Cotrol Charts for the Two-parameter Expoetial Distributio if the Locatio Parameter Ca Take o Ay Value Betwee Mius Iity ad Plus Iity R. va Zyl, A.J. va der Merwe 2 Quitiles Iteratioal, ruaavz@gmail.com
Supplemental Materials
1 Supplemetal Materials Xiagmao Chag, Rui Ta, Guoliag Xig, Zhaohui Yua, Cheyag Lu, Yixi Che, Yixia Yag This documet icludes the supplemetal materials for the paper titled Sesor Placemet Algorithms for
Multiple Comparisons Examples STAT 314
Multiple Comparisos Examples STAT 31 Problem umbers match those from the ANOVA Examples hadout. 8. Four brads of flashlight batteries are to be compared by testig each brad i five flashlights. Twety flashlights
Chapter 6 Sampling Distributions
Chapter 6 Samplig Distributios 1 I most experimets, we have more tha oe measuremet for ay give variable, each measuremet beig associated with oe radomly selected a member of a populatio. Hece we eed to
The Perturbation Bound for the Perron Vector of a Transition Probability Tensor
NUMERICAL LINEAR ALGEBRA WITH APPLICATIONS Numer. Liear Algebra Appl. ; : 6 Published olie i Wiley IterSciece www.itersciece.wiley.com. DOI:./la The Perturbatio Boud for the Perro Vector of a Trasitio
Goodness-Of-Fit For The Generalized Exponential Distribution. Abstract
Goodess-Of-Fit For The Geeralized Expoetial Distributio By Amal S. Hassa stitute of Statistical Studies & Research Cairo Uiversity Abstract Recetly a ew distributio called geeralized expoetial or expoetiated
Lecture 1. Statistics: A science of information. Population: The population is the collection of all subjects we re interested in studying.
Lecture Mai Topics: Defiitios: Statistics, Populatio, Sample, Radom Sample, Statistical Iferece Type of Data Scales of Measuremet Describig Data with Numbers Describig Data Graphically. Defiitios. Example
RAINFALL PREDICTION BY WAVELET DECOMPOSITION
RAIFALL PREDICTIO BY WAVELET DECOMPOSITIO A. W. JAYAWARDEA Departmet of Civil Egieerig, The Uiversit of Hog Kog, Hog Kog, Chia P. C. XU Academ of Mathematics ad Sstem Scieces, Chiese Academ of Scieces,
Improved Class of Ratio -Cum- Product Estimators of Finite Population Mean in two Phase Sampling
Global Joural of Sciece Frotier Research: F Mathematics ad Decisio Scieces Volume 4 Issue 2 Versio.0 Year 204 Type : Double Blid Peer Reviewed Iteratioal Research Joural Publisher: Global Jourals Ic. (USA
Chain ratio-to-regression estimators in two-phase sampling in the presence of non-response
ProbStat Forum, Volume 08, July 015, Pages 95 10 ISS 0974-335 ProbStat Forum is a e-joural. For details please visit www.probstat.org.i Chai ratio-to-regressio estimators i two-phase samplig i the presece
ENGI 4421 Probability and Statistics Faculty of Engineering and Applied Science Problem Set 1 Solutions Descriptive Statistics. None at all!
ENGI 44 Probability ad Statistics Faculty of Egieerig ad Applied Sciece Problem Set Solutios Descriptive Statistics. If, i the set of values {,, 3, 4, 5, 6, 7 } a error causes the value 5 to be replaced
TRACES OF HADAMARD AND KRONECKER PRODUCTS OF MATRICES. 1. Introduction
Math Appl 6 2017, 143 150 DOI: 1013164/ma201709 TRACES OF HADAMARD AND KRONECKER PRODUCTS OF MATRICES PANKAJ KUMAR DAS ad LALIT K VASHISHT Abstract We preset some iequality/equality for traces of Hadamard