: Q343 : A : (2005)

Transcription

1 2005, 28 (2) : Journal of N anjing A gricultural U niversity BM PR2IB 1, 2, 1, 2, 1, 2, 1 1, 33, (11, ; 21, ; 31, ) : BMPR2IB, PCR2RFLP 553, BMPR2IB, BMPR2IB ( ) 3 (BB B ), ( ) ( P < 0101) BB; BB B % 30% 19% ; ( ) + + : BB B , (BB B +, P < 0105; BB + +, P < 0101) ; BB B , + + (112) ( P < 0101), BB B +( ) kg ( ) kg, + + ( ( ) kg, P < 0105) ; + + ( P < 0105) ;, BMPR2IB, : ; ; BMPR2IB ; ; ; : Q343 : A : (2005) Polymorphism of BM PR2IB gene and its relationship to litter size and growth and development in Chinese M erino meat2prolificacy stra in GUAN Feng 1, L IU Shou2ren 2, CHENG Rui2he 1, DA I Rong 2, SH I Guo2qing 1, 2, A I Jun2tao 1 1, 33, YANG L i2guo ( 11Research Institute of Animal B reeding & Rep roduction, Nanjing Agricultural University, Nanjing , China; 21 Institute of Animal Husbandry and Veterinary Medicine, Xinjiang Academy of Agricultural Reclamation, Shihezi , China; 31College of Animal Science and Technology, Huazhong Agricultural University, W uhan , China) Abstract: DNA samp les were collected and amp lified for bone morphogenetic p rotein recep tor type IB gene (BMPR2IB) by PCR2 RFLP method from 553 sheep from 7 breeds or strains i1e. Hu, Suffolk, Dorset, Charolais, Romney H ills Chinese M erino and Chinese M erino meat2prolificacy strain. and development were analyzed. Relationship between the polymorphism of BMPR2IB gene and p rolificacy as well as growth The results showed that the genotype frequency of BM PR2IB gene was significantly different in these breeds or strains. In Chinese M erino meat2p rolificacy strain, the genotype frequencies of BB, B + and + + were 51%, 30% and 19%, respectively. Excep t for Hu sheep with only BB genotype, other breeds had only + + genotype. The analysis re2 sults of litter size, body weight and body size within Chinese Merino meat2prolificacy strain showed that the mean litter sizes at 1 st lambing of BB, B + and + + genotype populations were 210, 115 and 111, respectively, and there were significantly differences between group s (BB vs B +, P < 0105; BB vs + +, P < 0101). Sheep with genotype BB and B + had a greater total litter size than those with genotype + + ( P < 0101), the number were 218, 213 and 112 respectively. A t age of days, the body weights of lambs with genotype BB and B + were ( ) kg and ( ) kg, significantly greater than that of pep2 ulation with + + ( ) kg genotype ( P < 0105). The lambs with genotype BB and B + were significantly greater than : : ( (2002) ) : (1977 ),, E2mail: guanfengheyh@ yahoo1com1cn 3 Corresponding author: ( 1962 ),,,, E2mail: ylg@mail1hzau1edu1cn

2 76 28 those with genotype + + in chest girth and chest width, group s. but at age of days there was no significant difference between these two These findings indicated that the BMPR2IB gene was a major gene that regulates litter size and affects growth and develop2 ment during a certain period. Key words: sheep; Chinese M erino meat2prolificacy strain; BM PR2IB gene; litter size; body weight; body size,, 3, Booroola( FecB ) IB ( bone morphogenetic p rotein recep tor IB, BMPR2IB ) 746 A G, Booroola (Q249R), PCR2RFLP [ 1 3 ] FecB [ 4 7 ] ; FecB [ 8 10 ], BMPR2IB, 7, BMPR2IB, (117 ) (87 ) (101 ) ; (21 ) (56 ) (22 ) ; (53 ) (50 ) (46 ) DNA, 75% 5 g, 2 [ 11 ] BM PR2IB Davis [ 12 ] BMPR2IB, 3, (A va ) ( G GTCC) : : : 5 2CCAGAGGACAATAGCAAAGCAAA23 ; 5 2CAAGATGTTTTCATGCCTCATCAACAGGTC23 PCR : 94 5 m in; s, s, s, 30 ; 72 5 m in PCR 4 LA va ( ), 8%, [ 11 ] PBR322 /MSP DNA Marker ( ), 113 DNA PCR, 1 bp, BMPR2IB PCR 160 bp + 30 bp, BB ; 1 bp 160 bp + 30 bp B + ; 1 bp + + ( 1) 114 PCR 1 BM PR2IB PCR2RFL P F ig11 D etection of BM PR2IB gene by PCR2RFL P (2 4 ) ;,

3 2 : BMPR2IB 77 [ 13 ] ; SPSS 1110, x SD BM PR2IB BMPR2IB PCR2RFLP ( 1), BMPR2IB Booroola (A746G),, 3, 1 3, ( ), BB, + +( 1), 1 ( ) BM PR2IB Table 1 The frequency of BM PR2IB genotype in d ifferen t breeds or stra in s of sheep ( ) B reed or strain Animals Genotype frequency BB B Hu sheep Chinese Merino meat2prolificacy strain Suffolk Dorset Charolais Chinese Merino Romney H ills BM PR2IB 2, BB B , ( P < 0105) ;, BB + + ( P < 0101) ; B ( P > 0105) BB B , + + ( P < 0101) ; BB B +015, ( P > 0105) Genotype 2 Table 2 Com par ison of litter size am ong d ifferen t genotypes of sheep Number of animals Mean litter size at 1 st lambing Total mean litter size BB aa A B b A B B :, ( P < 0105) ( P < 0101) Note: Valules in same columns with small letters mean P < 0105, with cap ital letters mean P < The same as follows. 213 BM PR2IB 3,,, BB B + + +,, BB B ( P < 0105), 3 Table 3 Com par ison of body we ight am ong d ifferen t genotypes of sheep a t ages of and days Genotype Number of animals /kg B irth weight /kg d body weight /kg d body weight BB a B a b

4 BM PR2IB, BB B + + +, ( P < 0105), ( 4) 4 Table 4 Com par ison of body size in d ifferen t genotypes of sheep a t ages of and days /d Genotype Number of animals Age ( days) /cm Body length /cm Body height Heart girth Chest depth Chest width Cannon girth BB a a B a a b b ,,,,, [ 14, 15 ], 12 FecB [ 8 ],, [ 9, 10 ] 1981 ( A ),,,, [ 10, 16 ],,, BMPR2IB,,, FecB 1 [ 6 ] [ 17 ], 015, , BB B ; BB B ,, BMPR2IB BB,, BB /B + + +, [ 18 ] BB /B + + +,,,, BMPR2IB BB,,, BMPR2IB [ 14, 15 ],,,, : [ 1 ] Mulsant P, Lecerf F, Fabre S, et al. Mutation in bone morphogenetic p rotein recep tor2ib is associated with increased ovulation rate in Boo2 roola Merino ewes [ J ]. Proc Natl Acad Sci USA, 2001, 98 (9) : [ 2 ] Souza C J, MacDougal C, Campbell B K, et al. The Booroola ( FecB ) phenotype is associated with a mutation in the bone morphogenetic recep tor type 1B (BM PR 21B ) gene [ J ]. J Endocrinol, 2001, 169 (2) : R1 6. [ 3 ] W ilson T, W u X Y, Juengel J L, et al. H ighly p rolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphoge2

5 2 : BMPR2IB 79 netic p rotein IB recep tor (ALK26) that is exp ressed in both oocytes and granulosa cells [ J ]. B iology of Rep roduction, 2001, 64: [ 4 ] Shimasaki S, Zachow R J, L i D, et al. A functional bone morphogenetic p rotein system in the ovary [ J ]. Proc Natl Acad Sci USA, 1999, 96: [ 5 ]. Booroola FecB [ J ]., 2001, 3 (2) : [ 6 ],. Booroola Merino FecB [ J ]., 1999, 35 (4) : [ 7 ] Piper L R, B indon B M, Davis G H. The single gene inheritance of the high litter size of the Booroola Merino [ J ]. Genetics of Rep roduc2 tion in Sheep, 1985, 38 (2) : [ 8 ],, Davis G H,. DNABooroola ( FecB ) [ J ]., 2003, 26 (1) : [ 9 ],,. BMPR2IB BMP15 [ J ]., 2003, 30 ( 8 ) : [ 10 ],,,. BMPR2IB[ J ]., 2003 (2) : [ 11 ] J, E F, T. [M ]. 2.,,. :, [ 12 ] Davis G H, Galloway SM, Ross L K, et al. DNA tests in p rolific sheep from eight countries p rovide new evidence on origin of the Booroola ( FecB ) mutation [ J ]. B iol of Rep rod, 2002, 66: [ 13 ]. [M ]. 2. :, [ 14 ],,,. [ J ]., 1998, 19 (3) : [ 15 ],,,. [ J ]., 2000 (4) : [ 16 ],,,. ( ) [ J ]., 1995, 27 (6) : [ 17 ] Davis G H. Fecunity genes in sheep [ J ]. Animal Rep rod Sci, 2004, 82: [ 18 ] Sm ith P, O W S, Hudson N L, et al. Effects of the Booroola gene ( FecB ) on body weight, ovarian development and hormone concentra2 tions during fetal life [ J ]. J Rep rod Fertil, 1993, 98 (1) : :