Virology. Trafficking of the Potato spindle tuber viroid between tomato and Orobanche ramosa

Transcription

1 Virology 399 (2010) Contents lists available at ScienceDirect Virology journal homepage: Trafficking of the Potato spindle tuber viroid between tomato and Orobanche ramosa T. Vachev a, D. Ivanova a, I. Minkov a, M. Tsagris b,c, M. Gozmanova a, a Department of Plant Physiology and Molecular biology, University of Plovdiv, 24 Tsar Assen St., 4000 Plovdiv, Bulgaria b Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology-Hellas, P.O. Box 1527, GR Heraklion/Crete, Greece c Department of Biology, University of Crete, P.O. Box 2208 Heraklion, Greece article info abstract Article history: Received 22 July 2009 Returned to author for revision 11 August 2009 Accepted 12 December 2009 Available online 27 January 2010 Keywords: PSTVd Orobanche ramosa Parasitic plant-host interactions Viroid-host interactions Viroids, small RNA pathogens capable of infecting flowering plants, coexist in the field with parasitic plants that infest many crops. The ability of viroids to be exchanged between host and parasitic plants and spread in the latter has not yet been investigated. We studied the interaction between the Potato spindle tuber viroid (PSTVd) and Branched bromrape (Orobanche ramosa) using the tomato, Solanum lycopersicon, as a common host. We report the long distance trafficking of PSTVd RNA via the phloem from tomato to O. ramosa, but not vice versa. Furthermore, we identify O. ramosa as a novel host with the ability to facilitate the replication and processing of PSTVd. Finally, molecular variants of PSTVd with single nucleotide substitutions that replicate with different efficiencies in tomato were isolated from O. ramosa Elsevier Inc. All rights reserved. Introduction Viroids are subviral pathogens that cause widespread infection in several crop plants, resulting in considerable yield losses (Diener, 1999). The intriguing feature of these RNA pathogens is their small, circular, non-protein coding genome ( nt) that uses host proteins in a sequence-specific, structure-dependent manner to achieve autonomous replication, systemic movement and pathogenicity (Tabler and Tsagris, 2004; Flores et al., 2005; Tsagris et al., 2008). The Potato spindle tuber viroid (PSTVd) is the causal agent of the spindle tuber disease in potato crops (Owens, 2007). In addition to potatoes, PSTVd can infect several other types of crops, ornamental plants and weeds (Singh, 1973; Singh et al., 2003; Matousek et al., 2007; Verhoeven et al., 2004). Identification of asymptomatic carriers among hosts is of special importance because of their potential to serve as reservoirs for infection of other susceptible hosts, or to adopt a symptomatic phenotype following a genetic or environmental change. Inside the plant, PSTVd exists as a population of similar, but not identical, variants called a quasispecies (Holland et al., 1992; Codoner et al., 2006; Sardanyes et al., 2008). PSTVd variants that vary in RNA length from 341 nt ( Acc.No. Z ) (Wassenegger et al., 1994) to 364nt (Acc.No. DQ308555, AY ) have been isolated and described in different hosts. Numerous studies on the accumulation profile of nucleotide substitutions and their effect on PSTVd structure, replication, movement and pathogenesis have been Corresponding author. address: mariank@uni-plovdiv.bg (M. Gozmanova). reported (Zhong et al., 2008; Matousek et al., 2004; Qi and Ding, 2002; Owens et al., 1996; Hammond, 1994), rev in (Ding, 2009). The molecular nature and life cycle of PSTVd makes it ideal for intracellular and intercellular RNA trafficking studies due to its simple structure and relatively short length, as well as the differences in replication and pathogenicity between strains. The PSTVd molecule is divided into five domains: a central conserved domain (C), a pathogenicity domain (P), a left terminal domain (T L ), a variable domain (V) and a right terminal domain (T R )(Keese and Symons, 1985). Bulges, loops or metastable structures integrated within a domain are recognized as motifs that may attract host proteins for specific functions. Besides the structural features of the circular PSTVd rod, additional metastable structures have been described, such as the specific evolutionarily-conserved hairpins, HPI and HPII, and the central conserved (HI-CCR) sequence as well as the alternative stemloop HPI structure it forms (Schmitz and Steger, 2007). The HI-CCR structure was recently determined to be important in directing the import of PSTVd into the nucleus (Abraitiene et al., 2008). Nuclear targeting is a crucial step in PSTVd infection because it ensures access to the site of replication. Virp1 is a tomato protein localized in the nucleus that is necessary for PSTVd infection at the cellular level, and is a candidate for facilitating the nuclear import of PSTVd (Martinez de Alba et al., 2003; Kalantidis et al., 2007). However, PSTVd motifs and host proteins that play a role in nuclear export remain unidentified. In addition, a selective strand specific intracellular localization has been determined for PSTVd. Newly synthesized circular genomic strands of PSTVd appear to be sequestered primarily in the nucleolus, and antigenomic RNA is mainly localized to the nucleoplasma (Harders et al., 1989; Qi and Ding, 2003). This suggests that PSTVd is subject to selective intranuclear distribution, which may differ from viroid to /$ see front matter 2010 Elsevier Inc. All rights reserved. doi: /j.virol

2 188 T. Vachev et al. / Virology 399 (2010) viroid of the same group. For example, strains of the related viroid, CEVd (Citrus exocortis viroid), have not been found in the nucleolus (Bonfiglioli et al., 1996). PSTVd is also a good model system for the study of long-distance RNA trafficking; (Di Serio and Flores, 2008; Ding et al., 2005). PSTVd systematically infects the plant by moving from cell to cell through plasmodesmata and the vascular tissue phloem (Zhu et al., 2001, 2002). Selectivity in systemic trafficking was observed at the intercellular and inter-organ level (Qi and Ding, 2002). A bipartite RNA motif was found to be responsible for trafficking of the viroid from the bundle sheath to the mesophyll, while a tertiary structural motif is required for trafficking from non-vascular into vascular tissues (Qi et al., 2004; Zhong et al., 2007). Recently, several loops, clustered in the variable and right terminal domains and at the junction between the pathogenicity domain and central region, were reported to be important for systemic trafficking (Zhong et al., 2008). Overall, efficient long-distance movement by PSTVd likely results from the formation of specific RNA-protein complexes (Ding, 2009; Qi and Ding, 2002; Maniataki et al., 2003). Complexes have been detected both in vivo and in vitro between phloem lectin PP2 and Hop stunt viroid (HSVd) (Gomez and Pallas, 2001; Gomez and Pallas, 2004; Owens et al., 2001) as well as between a tomato protein Virp1 and PSTVd (Martinez de Alba et al., 2003; Maniataki et al., 2003). Grafting experiments in the former case suggested a role of PP2 in viroid systemic trafficking (Gomez and Pallas, 2004), while inability of Virp1 suppressed N. bentamiana protoplasts to sustain viroid infection suggests a role of Virp1 in initial nuclear trafficking (Kalantidis et al., 2007). In addition to viroids, studies on phloem-based RNA trafficking network have been performed with viruses (Gal-On et al., 2009) using bromrape-tomato and bromrape-tobacco system as well as a naturally formed graft union of a dodder grown on tomato and dodder parasitizing pumpkin (Roney et al., 2007). Comprehensive reviews on long-distance trafficking and its role in the control of cellular processes and on the growth and development of the plant have been published (Lee and Cui, 2009; Ding et al., 2005; Di Serio and Flores, 2008). Our primary interest was to investigate cross-species trafficking of PSTVd. Therefore, we chose to study the interaction between a host plant, tomato (Solanum lycopersicum, former Lycopersicum esculentum), and the holoparasitic plant, Orobanche ramosa. In this model, a phloem linkage is established between O. ramosa and the host, which facilitates the study of the potential inter-species exchange of PSTVd and other RNA molecules (Dorr and Kollmann, 1995; Roney et al., 2007). In this work, a detailed analysis of PSTVd movement from tomato to O. ramosa and vice versa has been performed. The potential of O. ramosa to replicate and transmit PSTVd is also discussed. vitro synthesized 32 P-labeled PSTVd ( ) RNA probe. This experiment was repeated at least two times, and the results are presented in Fig. 1A. Autoradiography detected a signal corresponding to the monomeric linear and circular forms of (+) PSTVd in all tested RNA samples. This result demonstrated that PSTVd RNA is able to move from the infected tomato plant to the attached non-photosynthetic O. ramosa parasitic plant. In order to test whether the PSTVd ( ) RNA is also able to move from infected tomato to O. ramosa we subjected all tested RNA Results Transfer of PSTVd (+) RNA from tomato to O. ramosa We first examined whether PSTVd is able to move from infected tomato host plants to the O. ramosa parasitic plants that infest them during growth. The tomato plants were grown under standard greenhouse conditions in the presence of Orobanche seeds (see Materials and methods). At the true leaves stage, the tomatoes were infected with in vitro synthesized PSTVd (+) RNA transcript (approximately 250 ng). Four weeks after infection, tomato plants exhibited PSTVd specific symptoms. The stems of the parasitic O. ramosa plants emerged from the soil four to five weeks later. The infestation of tomato seedlings with O. ramosa did not influence the severity of the observed PSTVd symptoms (data not shown). RNA samples were collected from tomato leaves, the O. ramosa tubercle (the attachment organ to tomato roots) and the O. ramosa stem after O. ramosa developed above the ground. Northern blot analysis was performed with an in Fig. 1. (A) Northern blot analysis to detect the transfer of PSTVd (+) RNA from infected tomato plants to O. ramosa. RNA was extracted from PSTVd-infected tomato plants and from O. ramosa attached to the infected plants: Hybridization was performed with in vitro synthesized 32 P-labeled PSTVd ( ) transcript. Samples were analyzed by 6% urea/ PAGE. Lane 1, DNA length marker (pbr322 cut with HinfI). Lane 2, RNA from PSTVd infected tomato leaves (IT); Lane 3, RNA from attached O. ramosa tubercles (OT); Lane 4, RNA from O. ramosa stems (OS). mc and ml denote monomeric circular and monomeric linear PSTVd, respectively. (B) Northern blot analysis to detect the transfer of PSTVd ( ) RNA from infected tomato plants to O. ramosa. Hybridization was performed with in vitro synthesized non-radioactive DIG-labeled PSTVd (+) transcript. Monomeric PSTVd RNA, dimers and oligomers of PSTVd were labeled with m, d and t. PSTVd in vitro transcript marked with capital T was loaded as a control. (C) PSTVd ( ) specific RT-PCR analysis as described in Materials and Methods. The amplified products were analyzed on a 1% agarose gel stained with EtBr. Lane 1, Gel Pilot 100 bp Plus Ladder; Lane 2, RNA from PSTVd infected tomato leaves (IT); Lane 3, RNA from attached O. ramosa tubercles (OT); Lane 4, RNA from O. ramosa stems (OS). Lane 5, negative control (dh 2 O) (NC); Lane 6, positive control (PC).

3 T. Vachev et al. / Virology 399 (2010) Fig. 2. (A) RT-PCR analysis to detect the PSTVd RNA in PSTVd inoculated O. ramosa (4 weeks p.i.), and the tomato to which O. ramosa had parasitized. Strand specific RT- PCR amplified products were analyzed on a 1% agarose gel stained with EtBr. Lane 1, 100 kb ladder (Invitrogen); Lane 2, positive control PSTVd infected tomato leaves, RT- PCR specific for detection of PSTVd (+) strand; Lane 3, PSTVd infected O. ramosa stem, detection of PSTVd (+) strand; Lane 4, PSTVd infected O. ramosa stem, detection of PSTVd ( ) strand; Lane 5, PSTVd infected O. ramosa tubercle, detection of PSTVd (+) strand; Lane 6, PSTVd infected O. ramosa tubercle, detection of PSTVd ( ) strand; Lane 7, tomato leaves from an infected O. ramosa parasitized plant, detection of PSTVd (+) strand; Lane 8, tomato leaves from an infected O. ramosa parasitized plant, detection of PSTVd ( ) strand; Lane 9, healthy tomato leaves; Lane 10, negative control (dh 2 O). (B) RT-PCR experiment, the reverse transcription was performed with PSTVd ( ) strandspecific primer (PSTVd forward primer) in order to detect replication products; Lane M, Gel Pilot 100 bp. Plus Ladder; Lane 1, PSTVd infected O. ramosa stem, detection of PSTVd ( ) strand; and with PSTVd (+) strand-specific primer (PSTVd reverse primer); Lane 2, PSTVd infected O. ramosa stem, detection of PSTVd (+) strand; Lane 3, negative control (dh 2 O) (NC); Lane 4, pha106 plasmid as positive control (PC). samples to two independent analyses Northern blot and RT-PCR analyses (Figs. 1B, C). The screening of the membrane was done with nonradioactive DIG-labeled PSTVd (+) RNA probe. The PSTVd specific ( ) signal was observed in the infected tomato as monomeric RNA, dimers and oligomers, while in the O. ramosa tubercle and stem samples only longer oligomers were detected (Fig. 1B), most probably due to limited concentration. In RT-PCR experiment, the reverse transcription was performed with a PSTVd ( ) strand-specific primer (PSTVd forward primer) in order to detect replication products. A PCR analysis using PSTVd forward and reverse primers revealed one specific band of the expected size and several less abundant high molecular weight forms that could be different oligomers. (Fig. 1C). Both experiments prove the presence of replicative intermediates in O.ramosa. Whether these minus-strand PSTVd RNAs are true replication intermediates in O. ramosa vascular tissue, or simply trafficking molecules moving from tomato to O. ramosa, cannot be determined from these experiments. In order to analyze the viroid population that has moved from PSTVd infected tomato to non-infected O. ramosa we have performed RT-PCR with RNA samples isolated from tomato leaves and O. ramosa stem. The amplified products were cloned in pcrii TOPO vector system (Invitrogen). Several clones were analyzed by sequencing and the results showed that only PSTVd WT was translocated to O. ramosa stem. Transfer of PSTVd RNA from O. ramosa to tomato In vitro synthesized PSTVd (+) RNA was mechanically applied using carborundum as an abrasive and pinpoint puncture of the stem of O. ramosa after the seedlings rose above ground. Four weeks after inoculation, samples were collected from the stem and tubercle of the infected O. ramosa, and from leaves of the tomato to which O. ramosa was attached. The extracted total RNA was analyzed by RT-PCR method. (Fig. 2). It showed the presence of both plus-strand and minus-strand PSTVd RNAs in the stem of O. ramosa that implies a replication of PSTVd in the O. ramosa stem. No trafficking of PSTVd of either polarity from infected O. ramosa to tomato was detected by RT- PCR analysis. (Fig. 2A). Fig. 3. Comparison of nucleotide sequence and secondary structure of the three PSTVd variants of O. ramosa with those of PSTVd isolate KF at 28 C as predicted by the MFold RNA program (

4 190 T. Vachev et al. / Virology 399 (2010) Fig. 4. PSTVd variants arising from a PSTVd infected O. ramosa were back inoculated into a tomato in order to determine their infectivity. PSTVd variants isolated and cloned from directly infected O. ramosa were transcribed in vitro and the transcripts mechanically inoculated into the tomato cv. Rentita. Two different plants were infected in each case (A and B). RNA extracts from systemic leaves were analyzed by Northern blotting using in vitro synthesized DIG-labeled PSTVd ( ) RNA transcript (A, B) or RT-PCR (C). Lane IT, in vitro PSTVd (+) RNA transcript; Lane HC, healthy tomato control; Lane M, length marker (Gel Pilot 1 kb Plus ladder, Qiagen); Lane WT, 208, 227, 241, represent wild-type PSTVd and the G208U, C227U, and G241C variants, respectively. rrnas were used as loading controls. Replication of PSTVd in O. ramosa, cloning and sequencing analysis of PSTVd variants We next examined whether replication of PSTVd in the stem of O. ramosa has an influence on the quasispecies population, and whether specific PSTVd mutants arise during replication. Therefore, we cloned and sequenced cdna molecules amplified by RT-PCR of RNA extracted from three individual PSTVd directly infected O. ramosa plants. PSTVd cdna amplification products were cloned into the pcrii TOPO vector system (Invitrogen). Of thirty clones sequenced, three PSTVd variants of O. ramosa were identified which differ from the WT by a single nucleotide substitution (Fig. 3). PSTVd variant C 227 -U was mapped to the lower strand of the V domain, variant C 208 -U was located in the lower strand of the RY motif of the T R domain, and variant G 241 -C was found in the lower strand of the C domain of the viroid secondary structure (Fig. 3). No sequence variation was detected in the pathogenicity (P) domain or in the left terminal domain (T L ) of the PSTVd molecule. Secondary structure analyses of all detected PSTVd variants were performed using the M-Fold RNA program ( rpi.edu/cgi-bin/rna-form1-2.3.cgi; (Zuker, 2003)) (Fig. 3). RNA folding at 28 C revealed structural changes (a loss of the loop and generation of an elongated stem) in the PSTVd variant C 227 -U and disruption of the RY motif in the T R domain in PSTVd variant C 208 -U compared to the wild-type PSTVd sequence. No major conformational differences in secondary structure were detected in the PSTVd variant G 241 -C (Fig. 3). Bioassay of tomato and O. ramosa infected with the PSTVd variants In order to determine the infectivity of PSTVd mutants isolated from O. ramosa, we infected tomato cv. Rentita with the three mutants, and cloned and sequenced the PSTVd-infected progeny of the plants. All PSTVd variants were cloned into a pha106 plasmid to generate longer-than-unit length PSTVd RNA transcripts under the control of the SP6 promoter (Tsagris et al., 1991). The in vitro transcribed PSTVd variants were applied to tomato leaves and, four weeks after infection, the tomato plants were examined for PSTVd symptoms. Interestingly, the G241-C variant elicited symptoms similar to wild-type PSTVd (stunting, leaf deformation), while the C208-U variant was asymptomatic until late stage of infection (28 d.p. i). C227U variant was not able to infect tomato plants. RNA samples collected from systemic leaves were subjected to Northern blot analysis (Fig. 4A and B) and RT-PCR (Fig. 4C). The RNA samples were resolved on 1.4 % formaldehyde gel. The screening was done with a non-radioactive DIG labeled PSTVd ( ) RNA probe. PSTVd specific signals were detected for the G241-C and C208-U PSTVd variants, while the C227-U variant was not detected in any of the inoculated tomatoes (Fig. 4). We analyzed two plants per variant: the G241-C variant showed maintenance of mutation in the tested plants, while in case of the C208-U variant, we observed either preservation of the mutation or reversion to the wild-type sequence. The C227U variant was not detected in the upper leaves of the inoculated tomato plants. All variants were analyzed for replication in the inoculated tomato leaves (Fig. 5). The RNA samples were subjected to Northern blot analysis using a nonradioactive DIG-labeled PSTVd ( ) RNA probe. Both PSTVd circular and linear forms were detected for G241-C and C208-U variants except for the non-infectious C227-U mutant (Fig. 5). Fig. 5. Northern blot analysis to detect replication of PSTVd mutants in inoculated tomato leaves. Lane T, in vitro PSTVd (+) RNA transcript; Lane M, length marker (RNA Ladder kb USB); Lane WT, 208, 227, 241, represent wild-type PSTVd and the G208U, C227U, and G241C variants, respectively. The 5.8S rrna was used as loading control. mc and ml denote monomeric circular and monomeric linear PSTVd, respectively. Fig. 6. RT-PCR analysis to detect the PSTVd ( ) strand in O. ramosa stem infected with PSTVd variants. Lane M, length marker (Gel Pilot 100 bp Plus ladder, Qiagen); Lane WT, 241, 227, 208, represent wild-type PSTVd and the G208U, C227U, and G241C variants, respectively.

5 T. Vachev et al. / Virology 399 (2010) The presence of circular form indicates that variants 241 and 208 replicated on tomato. PSTVd variants originating from O. ramosa were again mechanically inoculated on O. ramosa stems. After 20 days post infection, RNA was isolated and the presence of (+) and ( ) specific PSTVd RNA detected by RT-PCR. All mutants replicated well on the host where they originally arose (Fig. 6). This result indicates that PSTVd variant C227U is able to replicate in the non photosynthetic host, but is non infectious on tomato. Discussion The simplicity of the viroid genome, its pathogenic nature and its mobility make it a good experimental system for the exploration of the intra-and intercellular movement of RNAs between host and parasitic plants. Additionally, a role for the weeds that are commonly found in potato fields (Chamomilla reculita, Anthemis arvensis, Veronica argensis and Amaranthus retroflexus) as alternative viroid hosts and/or transmitters has been reported (Matousek et al., 2007). With regard to long-distance RNA trafficking, several different host systems (tomato, pumpkin, alfalfa and parasites Cuscuta, and Orobanchaceae) have been used to clarify interspecies translocation of endogenous RNAs and viruses (Roney et al., 2007). In our study we used tomato, one of the best hosts for potato spindle tuber viroid (no naturally occurring resistant tomatoes have been reported so far for PSTVd) and O. ramosa, which is an Orobanchaceae infecting tomato. Phloem continuity that forms the major long-distance symplastic transport pathway has been reported between O. ramosa and tomato (Dorr and Kollmann, 1995; Hibberd and Jeschke, 2001). Therefore, this parasite/ host plant pair is ideal for the study of PSTVd RNA transfer to and from the host. PSTVd exploits the plant phloem system for its systemic movement (Ding, 2009). Trafficking across specific cellular boundaries and in different directions is believed to be a process tightly regulated by molecular interactions (Zhong et al., 2008; Ding and Itaya, 2007; Qi and Ding, 2002). Therefore, we sought to determine whether parasitic plants are able to restrict viroid attack or act as a host for it. The present study provides evidence that PSTVd can be transmitted from infected tomato plants to attached O. ramosa. Both the linear and circular forms of the viroid were detected in tomato and O. ramosa. Furthermore, we provide evidence that O. ramosa can be mechanically infected with PSTVd RNA, and that replication of the viroid occurs in O. ramosa stems. However, replication was not detected in the tubercle. Further, we could not detect the transfer of PSTVd RNA from infected O. ramosa to tomato, suggesting that PSTVd movement is unidirectional. The reason for this is most probably that replication is not supported in O. ramosa tubercles. It appears that successful replication of the viroid RNA is facilitated by currently unknown factors necessary for long distance movement though the phloem. Orobanche tubercles probably do not possess the necessary host factors. These observations suggest possible restrictions in cell to cell and/or long distance trafficking from the O. ramosa stem to the tubercle and finally to the host. Mechanically infected O. ramosa stems were able to sustain replicability of the pathogen RNA. Analysis of PSTVd progeny isolated from O. ramosa revealed the presence of the wild-type PSTVd sequence and three sequences that contained a single point mutation. The PSTVd variants isolated from O. ramosa revealed differences in their pathogenicity and replicability when tested in tomato. The mutation in the G241-C PSTVd variant preserved the wild-type structure and developed severe symptoms of PSTVd. The C227-U variant did not replicate or translocate into the upper leaves. At this stage, we do not know whether this mutant is replication or trafficking deficient in tomato. Bioinformatic structural analysis of the C227-U mutation performed both by us and another research group revealed an elongated stem structure (Zhong et al., 2008) and our data). C227-U PSTVd RNA was assessed by Zhong et al. (2008) to be a trafficking defective mutant, at least in Nicotiana benthamiana. Detailed examination of all loops in the secondary structure of PSTVd showed that the A135-C227 loop was important for trafficking but able to replicate on protoplasts (Zhong et al., 2008). Possibly, the elongated stem structure of this mutant renders it an efficient substrate for a plant Dicer Like enzyme (DCL) thus inhibiting its systemic spread. Mutant C208-U showed symptoms at late stages of infection (28 d.p.i) in tomato. Structural analysis revealed significant distortions in the structure of the RY motif, which is an important determinant for binding to Virp1 (Gozmanova et al., 2003). PSTVd mutants with a disturbed RY motif were unable to interact with Virp1 and exhibited compromised trafficking in tomatoes (Hammond, 1994; Gozmanova et al., 2003). All detected mutations may represent the rapid adaptation of PSTVd in O. ramosa, which is a holoparasitic, non-photosynthesizing plant. Replication of PSTVd in this plant indicates that at least some of the physiological and biochemical reactions that occur during photosynthesis are not necessary for viroid replication. Moreover the ability of viroid to infect non photosynthetic plant O. ramosa could highlight the role of asymptomatic viroid hosts and the potential for PSTVd to spread from tomatoes to other crops via infection of O. ramosa, which is important issue in the control of viroids in agriculture. Materials and methods Plant material O. ramosa L., section Trionychon is a root parasite that lacks chlorophyll and is fully dependent on the host's nutrient supply (Musselman, 1994). Seeds of O. ramosa and tomato were planted together in soil. The Orobanche seeds were surface-sterilized using commercial bleach (5% sodium hypochlorite, containing 0.1% Tween) for 10 min and 70% ethanol for 2 min. The seeds were then rinsed three times with sterile distilled water (Batchvarova, R. personal communication). Tomato plants (S. lycopersicum or L. esculentum), cv. Rentita, were grown at 28 C with a photoperiod of 14 /10 h light/ dark cycle. In vitro transcription and inoculation of plants Experiments were performed with PSTVd isolate KF (Accession number X58388, Gene Bank). The longer-than-unit-length PSTVd (+) RNA was obtained by in vitro transcription with Sp6 RNA polymerase as described previously (Hammann et al., 1997) using EcoRI-linearized pha106 plasmid as template (Tsagris et al., 1991). To infect the plants, 250 ng of RNA was applied to each young tomato plant (cv. Rentita) and 500 ng was applied to O. ramosa. The transcript was rubbed into the tomato leaf and pin-point punctured into the O. ramosa stem. RNA extraction Four weeks after inoculation, total RNA was extracted from each plant as described previously (Papaefthimiou et al., 2001). The quality of the RNA preparations was checked with 1% agarose gels stained with ethidium bromide and visualized under UV light. The quantity was determined spectrophotometrically. Northern blot analysis RNA samples (10 μg) were separated on a 1.4% formaldehyde agarose gel. Samples were blotted on nylon membrane overnight by capillary transfer using 2 SSC. The membrane was stained with methylene blue and then prehybridized in hybridization buffer

6 192 T. Vachev et al. / Virology 399 (2010) (5 SSC, 50% Formamide, 1 Denhardt's-solution, 1% SDS, 100 μg/ml heat-denatured yeast trna) at 68 C for 1 2 h. Hybridization was performed in the buffer described above by adding the in vitro synthesized PSTVd ( ) RNA probe (pha106, linearized with HindIII and transcribed with T7 RNA polymerase (New England Biolab), in the presence of 32 P-UTP) using approximately cpm/ml of hybridization solution. The membrane was incubated overnight at 68 C, and then washed once with 2 SSC for 5 min and twice with 2 SSC containing 0.2 % SDS for up to 30 min until the background was sufficiently low. The same RNA samples (7 μg) were also separated on 10% urea- PAGE and electro blotted (7V, 40 ma) onto a Nylon membrane using 0.5 TBE buffer. Prehybridization and hybridization were performed at 68 C as described above. Hybridization with digoxigenin-labeled in vitro synthesized PSTVd ( ) transcript was also performed. The labeling reaction was performed according to the instructions in the DIG Northern Starter Kit (Roche). 1 μg pha106 plasmid, linearized with HindIII, was transcribed with T7 RNA polymerase using DIG-labeled UTP for 1 h at 42 C. Prehybridization was performed with high SDS buffer (7% SDS, 50% deionized formamide, 5 SSC, 2% blocking reagent, 0.1% (w/v) N- laurylsarcosine, 50 mm sodium phosphate, ph 7.0) at 68 C for 1 h. Hybridization was carried out overnight at 68 C in the same buffer with the addition of DIG-labeled PSTVd ( ) RNA transcript (100 ng/ ml hybridization buffer). After hybridization, the membrane was washed twice for 5 min in 2 SSC containing 0.1% SDS at room temperature, followed by another two washes for 15 min in 0.1 SSC containing 0.1% SDS at 68 C. The hybridized probes were detected with anti-digoxigenin-ap and Fab fragments, and visualized by color reaction with NBT/BCIP Ready-to-Use Tablets (Roche). RT-PCR analysis Total RNA (1 μg) from tomato leaves and the tubercle and stem of O. ramosa was reversed transcribed with 40 U of M-MuLV RT and 1 mm of NTPs in 1 RT buffer (New England Biolab). The primers used in cdna synthesis were either PSTVd forward (ATCCCCGGG- GAAACCTGGAGCGA) or PSTVd reverse (CCCTGAAGCGCTCCTCCGAG) (Weidemann and Buchta, 1998). The reverse transcribed PSTVd DNA was amplified by PCR with both primers listed above. The amplification reaction was performed according to the following program: 94 C for 5 min, followed by 25 cycles of 94 C for 30 s, 63 C for 30 s, 72 C for 40 s, and a final extension step at 72 C for 10 s. The amplified product was run on 1% agarose gel and stained with EtBr. Cloning of PSTVd variants isolated from O. ramosa After RT-PCR was performed with Vent DNA polymerase (New England Biolab), the amplification products were cloned into a pcrii TOPO vector system (Invitrogen), according to the manufacturer's instructions. Sequencing was performed with Sp6 and T7 primer (AGOWA, Germany; or Microchemistry lab, IMBB, Crete). Acknowledgments We thank Prof. Sauerborn's laboratory at University of Hohenheim, Stuttgart, Germany and Dr. Maurizio Vurro, Instituto di. Scienze delle Produzioni Alimentari, Bari, Italy for providing us with O. ramosa seeds. Our research was supported by the Greek-Bulgarian Bilateral Programme (BG4-GR2161 and KA2161) and the VU204 Bulgarian contract. References Abraitiene, A., Zhao, Y., Hammond, R., Nuclear targeting by fragmentation of the potato spindle tuber viroid genome. Biochem. Biophys. Res. Commun. 368 (3), Bonfiglioli, R.G., Webb, D.R., Symons, R.H., Tissue and intra-cellular distribution of coconut cadang cadang viroid and citrus exocortis viroid determined by in situ hybridization and confocal laser scanning and transmission electron microscopy. Plant J. 9, Codoner, F.M., Daros, J.A., Sole, R.V., Elena, S.F., The fittest versus the flattest: experimental confirmation of the quasispecies effect with subviral pathogens. PLoS Pathog. 2 (12), e136. Di Serio, F., Flores, R., Viroids: molecular implements for dissecting RNA trafficking in plants. RNA Biol. 5 (3), Diener, T.O., Viroids and the nature ofviroiddiseases. Arch. Virol. Suppl. 15, Ding, B., The biology of viroid host interactions. Annu. Rev. Phytopathol. 47, Ding, B., Itaya, A., Control of Directional Macromolecular Trafficking Across Specific Cellular Boundaries: A Key to Integrative Plant Biology. JIPB. 49 (8), Ding, B., Itaya, A., Zhong, X., Viroid trafficking: a small RNA makes a big move. Curr. Opin. Plant Biol. 8 (6), Dorr, I., Kollmann, R., Symplastic sieve element continuity between Orobanche and its host. Bot. Acta 108, Flores, R., Hernandez, C., Martinez de Alba, A.E., Daros, J.A., Di Serio, F., Viroids and viroid-host interactions. Annu. Rev. Phytopathol. 43, Gal-On, A., Naglis, A., Leibman, D., Ziadna, H., Kathiravan, K., Papayiannis, L., Holdengreber, V., Guenoune-Gelbert, D., Lapidot, M., Aly, R., Broomrape can acquire viruses from its hosts. Phytopathology 99 (11), Gomez, G., Pallas, V., Identification of an in vitro ribonucleoprotein complex between a viroid RNA and a phloem protein from cucumber plants. Mol. Plant- Microbe Interact. 14 (7), Gomez, G., Pallas, V., A long-distance translocatable phloem protein from cucumber forms a ribonucleoprotein complex in vivo with Hop stunt viroid RNA. J. Virol. 78 (18), Gozmanova, M., Denti, M.A., Minkov, I.N., Tsagris, M., Tabler, M., Characterization of the RNA motif responsible for the specific interaction of potato spindle tuber viroid RNA (PSTVd) and the tomato protein Virp1. Nucleic Acids Res. 31 (19), Hammann, C., Hormes, R., Sczakiel, G., Tabler, M., A spermidine-induced conformational change of long-armed hammerhead ribozymes: ionic requirements for fast cleavage kinetics. Nucleic Acids Res. 25 (23), Hammond, R.W., Agrobacterium-mediated inoculationofpstvdcdnasonto tomato reveals the biological effect of apparently lethal mutations. Virology 201 (1), Harders, J., Lukacs, N., Robert-Nicoud, M., Jovin, T.M., Riesner, D., Imaging of viroids in nuclei from tomato leaf tissue by in situ hybridization and confocal laser scanning microscopy. EMBO J. 8 (13), Hibberd, J.M., Jeschke, W.D., Solute flux into parasitic plants. J. Exp. Bot. 52 (363), Holland, J.J., De La Torre, J.C., Steinhauer, D.A., RNA virus populations as quasispecies. Curr. Top. Microbiol. Immunol. 176, Kalantidis, K., Denti, M.A., Tzortzakaki, S., Marinou, E., Tabler, M., Tsagris, M., Virp1 is a host protein with a major role in Potato spindle tuber viroid infection in Nicotiana plants. J. Virol. 81 (23), Keese, P., Symons, R.H., Domains in viroids: evidence of intermolecular RNA rearrangements and their contribution to viroid evolution. Proc. Natl. Acad. Sci. U.S.A. 82 (14), Lee, Y.Y., Cui, W., Non Cell autonomous RNA trafficking and long distance signalling. J. Plant Biol. 52, Maniataki, E., Martinez de Alba, A.E., Sagesser, R., Tabler, M., Tsagris, M., Viroid RNA systemic spread may depend on the interaction of a 71-nucleotide bulged hairpin with the host protein VirP1. RNA 9 (3), Martinez de Alba, A.E., Sagesser, R., Tabler, M., Tsagris, M., A bromodomaincontaining protein from tomato specifically binds potato spindle tuber viroid RNA in vitro and in vivo. J. Virol. 77 (17), Matousek, J., Orctova, L., Steger, G., Skopek, J., Moors, M., Dedic, P., Riesner, D., Analysis of thermal stress-mediated PSTVd variation and biolistic inoculation of progeny of viroid thermomutants to tomato and Brassica species. Virology 323 (1), Matousek, J., Orctova, L., Ptacek, J., Patzak, J., Dedic, P., Steger, G., Riesner, D., Experimental transmission of pospiviroid populations to weed species characteristic of potato and hop fields. J. Virol. 81 (21), Musselman, I.J., Taxonomy and spread of Orobanche. In: Pieterse, A.H., Verleij, J.A.C, ter Borg, S.J. (Eds.), Biology and management of Orobanche, Proceedings of Third International Workshop on Orobanche and Related Striga Research. Royal Tropical Institute. Amsterdam, Netherlands, pp Owens, R.A., Potato spindle tuber viroid: the simplicity paradox resolved. Mol. Plant Pathology 8 (5), Owens, R.A., Steger, G., Hu, Y., Fels, A., Hammond, R.W., Riesner, D., RNA structural features responsible for potato spindle tuber viroid pathogenicity. Virology 222 (1), Owens, R.A., Blackburn, M., Ding, B., Possible involvement of the phloem lectin in long-distance viroid movement. Mol. Plant-Microbe Interact. 14 (7), Papaefthimiou, I., Hamilton, A., Denti, M., Baulcombe, D., Tsagris, M., Tabler, M., Replicating potato spindle tuber viroid RNA is accompanied by short RNA fragments that are characteristic of post-transcriptional gene silencing. Nucleic Acids Res. 29 (11), Qi, Y., Ding, B., Replication of potato spindle tuber viroid in cultured cells of tobacco and Nicotiana benthamiana: the role of specific nucleotides in determining replication levels for host adaptation. Virology 302 (2), Qi, Y., Ding, B., Differential subnuclear localization of RNA strands of opposite polarity derived from an autonomously replicating viroid. Plant Cell 15 (11),

7 T. Vachev et al. / Virology 399 (2010) Qi, Y., Pelissier, T., Itaya, A., Hunt, E., Wassenegger, M., Ding, B., Direct role of a viroid RNA motif in mediating directional RNA trafficking across a specific cellular boundary. Plant Cell 16 (7), Roney, J.K., Khatibi, P.A., Westwood, J.H., Cross-species translocation of mrna from host plants into the parasitic plant dodder. Plant Physiol. 143 (2), Sardanyes, J., Elena, S.F., Sole, R.V., Simple quasispecies models for the survival-ofthe-flattest effect: the role of space. J. Theor. Biol. 250 (3), Schmitz, A., Steger, G., Potato spindle tuber viroid. Plant Viruses 1 (1), Singh, R.P., Experimental host range of the potato spindle tuber virus. Potato J. 50, Singh, R.P., Ready, K.F.M., Nie, X., Viroids: biology. In: Flores, R., Hadidi, A., Randles, J.W., Semancik, J.S (Eds.), Viroids, 1 vols. CSIRO Publishing, Collinwood Australia, pp Tabler, M., Tsagris, M., Viroids: petite RNA pathogens with distinguished talents. Trends Plant Sci. 9 (7), Tsagris, M., Tabler, M., Sanger, H.L., Ribonuclease T1 generates circular RNA molecules from viroid-specific RNA transcripts by cleavage and intramolecular ligation. Nucleic Acids Res. 19 (7), Tsagris, E.M., Martinez de Alba, A.E., Gozmanova, M., Kalantidis, K., Viroids. Cell Microbiol. 10 (11), Verhoeven, J.T., Jansen, C.C., Willemen, T.M., Kox, L.F., Owens, R.A., Roenhorst, J.W., Natural infections of tomato by Citrus exocortis viroid, Columnea latent viroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid. Eur. J. Plant Pathol. 110, Wassenegger, M., Heimes, S., Sanger, H.L., An infectious viroid RNA replicon evolved from an in vitro-generated non-infectious viroid deletion mutant via a complementary deletion in vivo. EMBO J. 13 (24), Weidemann, H., Buchta, U., A simple and rapid method for detection of Potato spindle tuber viroid by RT-PCR. Potato Res. 41, 1 8. Zhong, X., Tao, X., Stombaugh, J., Leontis, N., Ding, B., Tertiary structure and function of an RNA motif required for plant vascular entry to initiate systemic trafficking. EMBO J. 26 (16), Zhong, X., Archual, A.J., Amin, A.A., Ding, B., A genomic map of viroid RNA motifs critical for replication and systemic trafficking. Plant Cell 20 (1), Zhu, Y., Green, L., Woo, Y.M., Owens, R., Ding, B., Cellular basis of potato spindle tuber viroid systemic movement. Virology 279 (1), Zhu, Y., Qi, Y., Xun, Y., Owens, R., Ding, B., Movement of potato spindle tuber viroid reveals regulatory points of phloem-mediated RNA traffic. Plant Physiol. 130 (1), Zuker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13),