Identification and molecular properties of a 306 nucleotide viroid associated with apple dimple fruit disease

Transcription

1 '/epf"al.ot'o 'ZtTff~./~ olq~'y (! 99%.77L283 C Y.r!nted!9..G.re~!..B[!!a!~... SHORT COMMUNICATION Identification and molecular properties of a 306 nucleotide viroid associated with apple dimple fruit disease F. Di Serio, 1 F. Aparicio, 1 D. Alioto, a A. Ragozzino 2 and R. Flores 1 1 Instituto de Biologia Molecular y Celular de Plantas (UPV-CSIC), Universidad Polit6cnica de Valencia, Camino de Vera 14, Valencia 46022, Spain z Istituto di Patologia Vegetale, Universit& di Napoli, Via Universit& 100, Portici (Na), Italy A new viroid associated with an apple fruit disorder similar to, but more severe than, the dapple apple disease induced in some varieties by apple scar skin viroid (ASSVd) has been found. The new viroid, tentatively termed apple dimple fruit viroid (ADFVd), is a circular RNA of 306 nucleotides which adopts a quasi-rod-like conformation of minimum free energy. It contains the core nucleotides of the central conserved region (CCR) of the ASSVd group as well as the terminal conserved region (TCR) present in all members of the ASSVd and potato spindle tuber viroid (PSTVd) monophyletic groups. ADFVd has the highest sequence similarity with ASSVd and the 294 nucleotide citrus viroid CVd- IIIb, sharing with the latter an almost identical left terminal domain. The right- and left-hand termini of ADFVd are formed by almost perfect duplications of sequences found in the CCR upper and lower strands, respectively, of PSTVd and closely related viroids. (Koganezawa, 1989), although the disorder found in Italy is more severe, with the lesions not being simply restricted to colour alterations of the fruit skin. We have called it apple dimple fruit disease on the basis of its most conspicuous symptom. To check whether a viroid could be involved in this disease, total RNAs from affected fruits were extracted with buffersaturated phenol and fractionated by chromatography on nonionic cellulose as reported previously (Pall~is el al., 1987). The nucleic acid preparations enriched in RNAs with a high degree of secondary structure were separated by two consecutive rounds of PAGE, the first under non-denaturing and the second under denaturing conditions (Flores et al, 1985). For analytical purposes, the RNAs in the second denaturing gel were stained and/or transferred to a nylon membrane that was hybridized with viroid-specific RNA probes as indicated previously (Flores, I986), with the exception that hybridization was at Viroids, subviral pathogens composed of a small circular RNA endowed with autonomous replication (Diener, 199I), are the causal agents of a number of diseases afflicting higher plants (Flores, 1995). Recently, a syndrome in apple characterized by green depressed spots on the red surface of the fruits and deep and extensive areas of necrotic tissue in the flesh underlying the crater-shaped skin depressions has been observed in a commercial orchard of the cv. Starking Delicious in the Naples area of Italy. Some of the symptoms are similar to those characterizing the dapple apple disease induced by apple scar skin viroid (ASSVd) in some apple varieties Author for correspondence: R. Flores. Fax rfiores@ibmcp.upv.es The sequence data reported in this paper have been submitted to the EMBL, GenBank and DDBJ databases and assigned the accession number X CEVd-- ASBVd-- Fig. 1. Mobilities of the circular forms of different viroids in a denaturing gel after analysis by two consecutive PAGE. Nucleic acid preparations from viroid-infected tissues were electrophoresed in a non-denaturing gel, and after ethidium bromide staining the segment between CEVd and ASBVd was cut and applied to the top of a denaturing gel (presented here) which was stained with silver. Lanes 1 and 7, CEVd (371 nt) and ASBVd (247 nt). Lanes 2 to 5, PBCVd (315 nt), ASSVd (330 nt), hop stunt viroid (297 nt) and ADFVd (indicated by an arrow), respectively. Lane 6, control nucleic acid preparation from healthy apple fruits SGM!831

2 i i iii i i iiiii i iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiii i iii iiii i i iiiiiiii iiiiiii iiiii CEVd~ ASBVd Fig. 2. Northern blot hybridization analysis of ASSVd and ADFVd. RNA samples containing these two viroids were separated by two consecutive PAGE as indicated in Fig. 1. The nucleic acid profile in the second denaturing gel was revealed by staining with ethidium bromide (lanes 1 and 2) or by Northern blot hybridization with full-length RNA probes specific for ASSVd (lanes 3 and 4) or ADFVd (lanes 5 and 6), obtained by in vitro transcription with T7 RNA polymerase from recombinant plasmids linearized with appropriate enzymes. Lanes 1, 3 and 5, circular ADFVd. Lanes 2, 4 and 6, circular ASSVd. RNA samples from healthy controls did not hybridize with either of the two probes (data not shown). 70 C in the presence of 50% formamide. For preparative purposes, the presumptive circular RNA migrating in the second denaturing gel within the zone delimited by the standards citrus exocortis and avocado sunblotch viroids (CEVd and ASBVd, respectively) was eluted and recovered by ethanol precipitation (Pall~is eta]., 1987). Specific clones of the new viroid-like RNA from apple were obtained with an approach developed recently for cloning small circular RNAs without any previous sequence information (Navarro et a]., 1996). Both first and second cdna strands were synthesized using the same 26-mer oligonucleotide (5' GACGTCCAGATCGCGATTTCNNNNNN 3'), with six randomized positions at its 3' end, and avian myeloblastosis virus reverse transcriptase (RT) and KIenow DNA polymerase, respectively. The resulting double-stranded cdnas were PCRamplified with Taq DNA polymerase and a primer with the same sequence as the 26-mer oligonucleotide but lacking the six degenerated positions, and then cloned in the plasmid pt7blue(r) (Novagen). Sequencing of an apple dimple fruit viroid (ADFVd)-specific clone provided the sequence of a 180 nucleotide fragment corresponding to positions (see Fig. 3). With this information a pair of adjacent primers PI and PII, complementary and identical to positions and , respectively (see Fig. 3), were synthesized and used, together with a purified preparation of the circular RNA, to obtain by RT-PCR a fult-length double-stranded cdna that was cloned in pt7blue(r). Three full-length inserts were sequenced in both directions with chain-terminating inhibitors and T7 DNA polymerase. Fig. I shows that a small RNA, presumably circular, was isolated from apple fruits displaying symptoms but not from healthy controls. The accumulation of this RNA was higher in fruits than in leaves on a flesh weight basis (data not shown). Analysis of electrophoretic mobilities in denaturing gels indicated that the apple viroid-like RNA identified was about nt (Fig. I), a size significantly smaller than the nt typical of the ASSVd isolates already sequenced (Hashimoto & Koganezawa, 1987; Puchta et a]., 1990). Sequencing confrmed a circular structure and a size of 306 nt for this RNA, and revealed that it was a new member of the ASSVd group, since it had the core nucleotides of the central conserved region (CCR) characteristic of this group (see below) and showed sequence similarities with ASSVd by Northern blot hybridization (Fig. 2). The new viroid, ADFVd, has a G + C content of 58"5 % and its conformation of minimal free energy, obtained with the MFold program (circular version) of the GCG package (Zuker, 1989), is a quasi-rod-like structure in which 73"8 % of the nucleotides are paired and the proportions of GC, AU and GU pairs are 61"9%, 29"2% and 8"8%, respectively (Fig. 3). ADFVd has the 16 and 17 core nucleotides in the upper and lower strands, respectively, which conform to the CCR of the ASSVd group (Koltunow & Rezaian, 1989; Hern~ndez et a]., 1992) (Fig. 3). The ADFVd I6 core nucleotides of the CCR upper strand, together with the eight flanking nucleotides on either side, can form the palindromic or stem-loop structures proposed to be involved in processing of oligomeric viroid intermediates (Diener, 1986; Visvader et a[., 1985). Similar structures have been found in all viroids with the exception of avocado sunblotch and peach latent mosaic viroids which lack a CCR. ADFVd has the terminal conserved region (TCR) CNNGNGGUUCCUGUGG (Fig. 3, positions I3-28) (Hashimoto & Koganezawa, 1987; Koltunow & Rezaian, 1988), which is present in a similar location in all members of the potato spindle tuber viroid (PSTVd) and ASSVd monophyletic groups (Flores, 1993). To the right of the TCR the polypurine tract AAAAGAAAAA (Fig. 3, positions 52--6I), also present in most typical viroids, can be seen. Within the ASSVd group, and using the Gap program of the GCG package (gap weight 5, length weight 0"3; Devereux et al., 1984), ADFVd has the highest sequence similarity (63"5 % and 62"9%) with ASSVd (Hashimoto & Koganezawa,!83z

3 G'U'UCCUGUGGGGC CC.C,CCCUGCGCA A UGAcuAAAAGA.AAAAUCAGGAGGU AGAGACuuACcuGUCGuc'G'ucGAC G AGGCUGGUAAGC.CGUGAcGCGuGGAGGAG,AGCCCGGGI. :GCG.CUCUUG~ Fig. 3. Sequence and proposed secondary structure of minimum free energy of ADF-Vd. The TCR is delimited by flags and the core nucleotides of the CCR upper and lower strands by filled and open circles, respectively. The arrows depict an almost perfect inverted repeat. The termini containing almost perfect duplications of portions of the PSI-Vd CCR are shaded. The numerical order has been chosen to facilitate comparisons with CVd-IIIb with which ADFVd shares an almost identical left terminal domain. The inset shows segments ~f ADF--Vd displaying sequence similarities with CVd-IIIb, HSVd and CEVd. Vertical bars and dots denote residue identity and gaps, respectively. The sequences of HSVd (nt ) and CEVd (nt ) are found in the corresponding rod-like structures in positions similar to those occupied by nucleotides and , respectively, in the quasi-rod-like structure of ADF--Vd. The sequence of HSVd (nt ) contains a portion of the CCR lower strand of this viroid. No variability was observed in Lhe sequence of the ADFVd cdna clones. i~i!i~ilili iiii~iiiill :.:.:.:+:+:+:.: :,::::::::::::::::: J ADFVd 277- CCAGGGUAAAACACGAUUGGUGUUUUCCCCGGAGGAAAACUCCGUGUGGUUCCUGUGGGGCACCCCCC- 38 I ] [ l l l l l l l l l l IIII III I I I I I I I I I I l l l l l l [ l l I l l l l l l l l I I I I I 3Vd-IIIb 266- CCAGGGUAAAACACGAUUGGUGUUU. CCCCGGAGG. AAACUCCGUGUGGUUCCUGUGGGGCACACCCC- 37 ADFVd CGUGACGCGUGGAG. GAGAGCCCGGGU-136 I I I I ] I I I I I I I II I I]1 I II HSVd 105- CGAGAGGCGUGGAGAGAGGGCCGCGGU-131 ADFVd 156- CC U U U GA GA C UU GA CCGGU-174 I I I I I I I I I I I I I ] I HSVd 203- CCGAU GA GA CGCGACCGGU-221 ADFVd 176- CCUCUCCCACCCUGCC. GAGCU UC-198 I I I I I II I I I I II I II II CEVd 232-CCUCGCCCCC UC GCCCGGAGCU UC-255 CO LO LFI

4 1987) and with a 294 nt citrus viroid (Rakowski et ai., 1994; Stasys et al., 1995), respectively. Hereafter we will refer to this latter viroid as CVd-IIIb (Rakowski et al., i994), although it must be noted that a viroid with the same sequence, termed CVdlIIA, has also been reported (Stasys et al., 1995). A more detailed comparison between ADFVd and CVd-IIIb showed three separate fragments with essentially identical sequences in both viroids. As was anticipated, two of them were centred around the upper and lower strands of the CCR. The third and longest fragment (Fig. 3, positions ), forms the left terminal domain in ADFVd and CVd-IIIb. This domain includes the TCR, which in these two viroids lacks the 3'-terminal U residue conserved in all other viroids containing this motif. It also includes the CCCGGAGGAAAAC sequence (except for an extra A) which in CVd-IIIb is an almost perfect duplication of part of the CCR lower strand of PSTVd and closely related viroids (Stasys et al., 1995). Conversely, the sequence CCGC- UAGUCG, a duplication of a portion of the CCR lower strand of the ASSVd viroid group found in the right-hand terminus of CVd-IIIb (Stasys et al., 1995), was not observed in ADFVd. However, the right-hand terminus of ADFVd contained the sequence GGGGUAACC (Fig. 3, positions ), which is a duplication, with one change A ~ U, of part of the CCR upper strand of PSTVd and closely related viroids. The possible role, if any, of the duplications located at both ADFVd termini remains unknown. On the other hand, a parallel comparison revealed that the similarity between ADFVd and ASSVd was also concentrated along three fragments similar to those observed between ADFVd and CVd-IIIb, although the fragment encompassing the left terminal domains of ADFVd and ASSVd was shorter and contained more mismatches, whereas the corresponding fragments around both CCR strands were larger. Portions of the right-hand region of ADFVd also displayed limited sequence similarities with HSVd and CEVd (Fig. 3, inset). From this analysis we conclude that ADFVd is a new member of the ASSVd group whose central and left terminal domains are also present in other members of this group, whereas the sequences forming its right terminal domain are more similar to those of some viroids outside the ASSVd group. This observation suggests that ADFVd could have evolved from recombination events between viroids of different groups, a situation which appears to be frequent in members of the ASSVd group. We have considered the possibility that ADFVd and a viroid found in Japan associated with apple fruit crinkle (AFCVd; Ito et ai., I993) could be the same RNA, since the symptomatologies observed in Japan and Italy have some resemblance. However, there are significant differences between the viroids suggesting that this is not the case. Firstly, although AFCVd has not been sequenced, it is larger than chrysanthemum stunt viroid ( nt) on the basis of mobility comparisons in denaturing polyacrylamide gels (Ito et a]., 1993). Under the same electrophoretic conditions (S/inger et al., 1977), ADFVd showed a mobility consistent with its 306 nt size obtained by sequencing. Secondly, AFCVd and ASSVd do not have any detectable sequence similarity according to a Northern biot hybridization analysis performed with an ASSVd-specific probe (Ito eta]., 1993). In contrast, ADFVd and ASSVd sequences show significant similarity and RNA probes complementary to ASSVd and ADFVd gave hybridization signals with ADFVd and ASSVd, respectively (Fig. 2). Thirdly, whereas AFCVd does not incite symptoms on apple cv. Starking Delicious (Ito et ai., 1993), ADFVd was detected and isolated from symptomatic fruits of this cultivar. To establish a causal relationship between ADFVd and its associated disease, apple plants inoculated with purified circular forms of this RNA will remain under observation over the next 2 years for the appearance of diagnostic symptoms. We thank Prof. B. Aloy for apple samples, A. Ahuir for excellent technical assistance, Dr. V. Pall~is and J. C. Desvignes for critical reading of the manuscript and D. Donnellan for English revision. This work was partially supported by grants PB and PB from the Direcci6n General de Investigaci6n Cient/fica y T6cnica of Spain and by contract AIR3CT from the European Commission (to R.F.), as well as by fellowships from the Ministerio de Educaci6n y Ciencia and from the Consejo Superior de Investigaciones Cientificas of Spain (to F.D.S. and F.A., respectively). References Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, Diener, T. O. (1986). Viroid processing: a model involving the central conserved region of hairpin I. Proceedings of the National Academy of Sciences, USA 83, Diener, T. O. (1991 ). Subviral pathogens of plants : viroids and viroidlike satellite RNAs. FASEB Journal 5, Flores, R. (1986). Detection of citrus exocortis viroid in crude extracts by dot-blot hybridization: conditions for reducing spurious hybridization results and for enhancing the sensitivity of the technique. Journal of Virological Methods 13, Flores, R. (1995). Viroids. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G.P. Martelli, M.A. Mayo & M.D. Summers. Wien& New York: Springer VerIag. Flores, R., Dur~n-Vila, N., Pallzts, V. & Semancik, J. S. (1985). Detection of viroid and viroid-iike RNAs from grapevine. Journal of General Virology 66, Hashimoto, J. & Koganezawa, H. (1987). Nucleotide sequence and secondary structure of apple scar skin viroid. Nucleic Acids Research 15, Hern;,ndez, C., Elena, S. F., Moya, A. & Flores, R. (1992). Pear blister canker viroid is a member of the apple scar skin subgroup (apscaviroids) and also has sequence homology with viroids from other subgroups. Journal of General Virology 73, Ito, T., Kanematsu, S., Koganezawa, H., Tsuchizaki, T. & Yoshida, K. (1993). Detection of a viroid associated with apple fruit crinkle disease. Annals of the Phytopathological Society of Japan 59, '-83(

5 Koganezawa, H. (1989). Apple scar skin viroid. AAB Descriptions of Plant Viruses, number 349. Koltunow, A. M. & Rezaian, M.A. (1988). Grapevine yellow speckle viroid. Structural features of a new viroid group. Nucleic Acids Research 16, Koltunow, A.M. & Rezaian, M.A. (1989). A scheme for viroid classification, lntervirology 30, I94-20I. Navarro, B., Dar6s, J. A. & Flores, R. (1996). A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence. Journal of Virological Methods 56, PallAs, V., Navarro, A. & Flores, R. (1987). Isolation of a viroid-like RNA from hop different from hop stunt viroid. Journal of General Virology 68, Puchta, H., Luckinger, R., Yang, X., Hadidi, A. & S~nger, H. I_ (1990). Nucleotide sequence and secondary structure of apple scar skin viroid (ASSVd) from China. Plant Molecular Biology 14, I Rakowski, A.G., Szychowski, J.A., Avena, Z.S. & Semancik, J.S. (1994). Nucleotide sequence and structural features of the Group III citrus viroids. Journal of General Virology 75, S~nger, H.L., Ramm, K., Domdey, H., Gross, H.J., Henco, K. & Riesner, D. (1977). Conversion of circular viroid molecules to linear strands. FEB5 Letters 99, 117-I22. Stasys, R. A., Dry, I. A. & Rezaian, M. A. (1995). The termini of a new citrus viroid contain duplications of the central conserved region of two viroid groups. FEBS Letters 358, Visvader, J. E., Forster, A. C. & Syrnons, R. H. (1985). Infectivity and in vitro mutagenesis of monomeric cdna clones of citrus exocortis viroid indicate the site of processing of viroid precursors. Nucleic Acids Research 13, Zuker, bl. (1989). On finding all suboptimal foldings of an RNA molecule. Science 244, Received 16 May 1996; Accepted 26 July 1996.>83]