RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17

Size: px
Start display at page:

Download "RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17"

Transcription

1 RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm,

2 RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi loop f. exterior loop g. dangling nucleotide h. energy penalty after stem i. coaxial stacking n_web.png

3 Most nucleotides are bound to helical structures 4 types of loops: H: hairpins I: interior loops B: bulges M: multi-loops Example of secondary structure of RNA helical hairpin-loop bulge Interior loop RNAse P from Bacillus subtilis (M. Zuker)

4 Timeline of secondary structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98

5 FIRST STEP: THERMODYNAMIC PREDICTION

6 Thermodynamic prediction algorithms R. Lorenz et al. / Methods 103 (2016) 86 98

7 secondary structure prediction programs for RNA Mfold RNAfold (Vienna RNA server) RNA structure html

8 Structure prediction methods 1.8 N possibilites (N = length of sequence) Normally free energy minimization Combinatorial puzzling pieces of sec. Structure Recursive one nucleotide addition Comparative sequence analysis Context free grammar for training (without energy calculations)

9 BP MAXIMIZATION: NUSSINOV (1978) { } ) (4 (3) (2) (1) (0) ) ( ) ( min ) ( ) ( ) ( ), ( 4 0 ) ( min ) (, 1, 1, 1, 1 1,,, + + < = = < < + + j k k i j k i j i j i j i j i j i j i S E S E S E S E S E r r i j für S E S E α (0): rule prevent to strong bends in the structure (1): basepairing of r i and r j sum of energy for basepairing and part of secondary structure before E(S i+1,j-1 ) (2): base r i no basepairing to R i,j (3): base r j no basepairing to R i,j (4): bifurcation; bases r i and r j are bound in two different parts of the secondary structure

10 Dot Plot for trnaphe

11 Old energy rules (2.3) best structure kcal/mol worst structure kcal/mol

12 New energy rules (3.0) -For changing the temperature use RNA 2.3 -Decide if the RNA is circular or linear -The maximum between paired bases is not so important -To check the possible structures use a greater window size to increase the energy difference

13 Output RNAFold First you get the best predicted structure in dot-bracket notation and the minimum free energy.

14 Predicted secondary structure base pairing probability and entropy can be checked with the partition function - forbid the wobble pair GU - forbid to build 1 bp Helices - prediction for 37 C

15 RNAfold Example using snorna: snr44 Prediction:

16 RNA structure

17 Structure comparison using MFE R. Lorenz et al. / Methods 103 (2016) 86 98

18 NEXT STEP: TERTIARY STRUCTURE PREDICTION

19 RNA structures are complex Not only two different structural elements Single and double stranded regions Pseudoknots between single stranded regions

20 Tertiary structure elements increasing complexity for prediction pseudoknot kissing hairpins hairpin loop-bulge contact

21 Structure prediction including pseudknots R. Lorenz et al. 2016

22 P. Zhao et al RNA kinetic folding

23 Main classes of structure prediction Iterated Loop Matching algorithm An iterated loop matching approach to the prediction of RNA secondary structures with pseudoknots (Ruan, Stormo, Zhang; 2004) Stochastic modelling using parallel grammars Stochastic modeling of RNA pseudoknotted structures: a grammatical approach (Cai, Russell, Wu; 2003) Graph-theoretical / Multisequence approaches A graph theoretical approach to predict common RNA secondary sructure motifs including pseudoknots in unaligned sequences (Yongmei, Stormo, Xing; 2004)

24 Contrafold Do et al. 2006

25 Dynalign or PPfold Using multiple sequence alignment (Ppfold) Or having template sequence for corrections (Dynalign) Calculation of the free energy having inforamtion about conserved regions

26 BENCHMARKING AND DRAWBACKS FOR SECONDARY STRUCTURE PREDICTION

27 Comparison single vs. multiple sequence algorithms Multiple sequences Single sequence (Medium similarity) Multiple sequences (High similarity) P. Gardner et al. 2004

28 Comparative RNA structure prediction strategies P. Gardner et al. 2004

29 Comparison of comparative structure prediction strategies Sensitivity: True predicted positives vs. all true positives P. Gardner et al Selectivity: All true predicted vs. all predicted

30 Prediction of single RNA secondary Accuracy: structure About 500 nt long RNAs 70% of correct basepairs >500 nt long RNAs fall down to 40% accuracy Reasons: simplifications in the energy model inaccuracies of parameters ignoring the effect of binding to ions proteins and other ligands non-equilibrium states of the RNA R. Lorenz et al. / Methods 103 (2016) 86 98

31 Prediction of multiple RNA secondary structures Multiple sequence advances: Additional information like phylogenetic tree, substitution model unpaired/paired Energy-based and evolutionary based Drawbacks: Dependent on the alignment quality Pairwise identity >80% for consensus structure

32 HOW PROBING CAN IMPROVE STRUCTURE PREDICTION?

33 High throughput probing and guided structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98

34 Usage of experimental data Structure probing: Biochemical method to find structure of nucleic acids on molecular level Physical methods: Crystalstructures, NMR Chemical methods: Modification of nucleic acids DMS or SHAPE

35 SHAPE for guided structure prediction Selective 2 -hydroxyl acylation analyzed by primer extension = SHAPE 2 -Hydroxyl group of ribose is bound by 1-methyl-7-nitroisatoic anhydrid (1M7) Reacts on all unbound riboses in the RNA molecule Reverse transcriptase is stopping and falls of comparison to control shows unbound regions of the RNA

36 Guided structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98

37 DMS for high throughput Sequencing DMS methylates nitrogen in Adenin and Tyrosin Unbound bases, end of helices and GU basepairs are detectable

38 Genome-wide Structurome

39 Mod-seq for footprinting

40 Limitations by experimental setup effectiveness of the probing agent can be influenced by solvent accessibility tertiary and even quaternary interactions bulky enzymes may not be able to reach all parts of the RNA de- and re-naturing steps devoid of any RNA-binding proteins or other factors

41 Future perspectives slightest error in hard constraints might yield an entirely wrong prediction secondary structures does not account for tertiary effects such as non-canonical base pairs extremely short hairpin loops and long interior loops are excluded

42

98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006

98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary

More information

RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable

RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger

More information

Combinatorial approaches to RNA folding Part I: Basics

Combinatorial approaches to RNA folding Part I: Basics Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)

More information

RNA secondary structure prediction. Farhat Habib

RNA secondary structure prediction. Farhat Habib RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures

More information

proteins are the basic building blocks and active players in the cell, and

proteins are the basic building blocks and active players in the cell, and 12 RN Secondary Structure Sources for this lecture: R. Durbin, S. Eddy,. Krogh und. Mitchison, Biological sequence analysis, ambridge, 1998 J. Setubal & J. Meidanis, Introduction to computational molecular

More information

DNA/RNA Structure Prediction

DNA/RNA Structure Prediction C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:

More information

Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters

Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters 1 Binod Kumar, Assistant Professor, Computer Sc. Dept, ISTAR, Vallabh Vidyanagar,

More information

BCB 444/544 Fall 07 Dobbs 1

BCB 444/544 Fall 07 Dobbs 1 BCB 444/544 Required Reading (before lecture) Lecture 25 Mon Oct 15 - Lecture 23 Protein Tertiary Structure Prediction Chp 15 - pp 214-230 More RNA Structure Wed Oct 17 & Thurs Oct 18 - Lecture 24 & Lab

More information

In Genomes, Two Types of Genes

In Genomes, Two Types of Genes In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns

More information

Using SetPSO to determine RNA secondary structure

Using SetPSO to determine RNA secondary structure Using SetPSO to determine RNA secondary structure by Charles Marais Neethling Submitted in partial fulfilment of the requirements for the degree of Master of Science (Computer Science) in the Faculty of

More information

CS681: Advanced Topics in Computational Biology

CS681: Advanced Topics in Computational Biology CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 10 Lecture 1 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ RNA folding Prediction of secondary structure

More information

Predicting RNA Secondary Structure

Predicting RNA Secondary Structure 7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential

More information

RNA Folding and Interaction Prediction: A Survey

RNA Folding and Interaction Prediction: A Survey RNA Folding and Interaction Prediction: A Survey Syed Ali Ahmed Graduate Center, City University of New York New York, NY November 19, 2015 Abstract The problem of computationally predicting the structure

More information

Lecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression

Lecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression C N F O N G A V B O N F O M A C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/NA Structure Prediction pigenectics pigenomics: Gene xpression ranscription factors

More information

RNA Structure Prediction and Comparison. RNA folding

RNA Structure Prediction and Comparison. RNA folding RNA Structure Prediction and Comparison Session 3 RNA folding Faculty of Technology robert@techfak.uni-bielefeld.de Bielefeld, WS 2013/2014 Base Pair Maximization This was the first structure prediction

More information

BIOINFORMATICS. Prediction of RNA secondary structure based on helical regions distribution

BIOINFORMATICS. Prediction of RNA secondary structure based on helical regions distribution BIOINFORMATICS Prediction of RNA secondary structure based on helical regions distribution Abstract Motivation: RNAs play an important role in many biological processes and knowing their structure is important

More information

Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model

Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model J. Waldispühl 1,3 P. Clote 1,2, 1 Department of Biology, Higgins 355, Boston

More information

Grand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world

Grand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic

More information

RNA and Protein Structure Prediction

RNA and Protein Structure Prediction RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure

More information

RecitaLon CB Lecture #10 RNA Secondary Structure

RecitaLon CB Lecture #10 RNA Secondary Structure RecitaLon 3-19 CB Lecture #10 RNA Secondary Structure 1 Announcements 2 Exam 1 grades and answer key will be posted Friday a=ernoon We will try to make exams available for pickup Friday a=ernoon (probably

More information

CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models

CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Supplementary Material for CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Chuong B Do, Daniel A Woods, and Serafim Batzoglou Stanford University, Stanford, CA 94305, USA, {chuongdo,danwoods,serafim}@csstanfordedu,

More information

BIOINF 4120 Bioinforma2cs 2 - Structures and Systems -

BIOINF 4120 Bioinforma2cs 2 - Structures and Systems - BIOINF 4120 Bioinforma2cs 2 - Structures and Systems - Oliver Kohlbacher Summer 2014 3. RNA Structure Part II Overview RNA Folding Free energy as a criterion Folding free energy of RNA Zuker- SCegler algorithm

More information

RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology"

RNA Search and! Motif Discovery Genome 541! Intro to Computational! Molecular Biology RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology" Day 1" Many biologically interesting roles for RNA" RNA secondary structure prediction" 3 4 Approaches to Structure

More information

Combinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming

Combinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming ombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming Matthew Macauley Department of Mathematical Sciences lemson niversity http://www.math.clemson.edu/~macaule/ Math

More information

Algorithmic Aspects of RNA Secondary Structures

Algorithmic Aspects of RNA Secondary Structures Algorithmic Aspects of RNA Secondary Structures Stéphane Vialette CNRS & LIGM, Université Paris-Est Marne-la-Vallée, France 214-115 S. Vialette (CNRS & LIGM) RNA Secondary Structures 214-215 1 / 124 Introduction

More information

Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach

Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2011 Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach Jianping

More information

Bachelor Thesis. RNA Secondary Structure Prediction

Bachelor Thesis. RNA Secondary Structure Prediction Bachelor Thesis RNA Secondary Structure Prediction Sophie Schneiderbauer soschnei@uos.de Cognitive Science, University Of Osnabrück First supervisor: Prof. Dr. Volker Sperschneider Second supervisor: Prof.

More information

Computational approaches for RNA energy parameter estimation

Computational approaches for RNA energy parameter estimation omputational approaches for RNA energy parameter estimation by Mirela Ştefania Andronescu M.Sc., The University of British olumbia, 2003 B.Sc., Bucharest Academy of Economic Studies, 1999 A THESIS SUBMITTED

More information

RNA folding with hard and soft constraints

RNA folding with hard and soft constraints DOI 10.1186/s13015-016-0070-z Algorithms for Molecular Biology RESEARCH RNA folding with hard and soft constraints Ronny Lorenz 1*, Ivo L. Hofacker 1,2,3 and Peter F. Stadler 1,3,4,5,6,7 Open Access Abstract

More information

RNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev

RNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC

More information

RNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev

RNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC

More information

Using distance geomtry to generate structures

Using distance geomtry to generate structures Using distance geomtry to generate structures David A. Case Genomic systems and structures, Spring, 2009 Converting distances to structures Metric Matrix Distance Geometry To describe a molecule in terms

More information

COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES

COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES ÉRIC FUSY AND PETER CLOTE Abstract. It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is 1.104366

More information

Lab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics

Lab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816

More information

RNA$2 nd $structure$predic0on

RNA$2 nd $structure$predic0on RNA$2 nd $structure$predic0on Recall Nucleic Acids - RNA and DNA The carrier of genetic information - The blueprints of proteins Nucleotides Bases Adenine (A) Guanine (G) Cytosine(C) Thymine(T) Uracil

More information

COMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University

COMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018

More information

RNA Abstract Shape Analysis

RNA Abstract Shape Analysis ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:

More information

Structure-Based Comparison of Biomolecules

Structure-Based Comparison of Biomolecules Structure-Based Comparison of Biomolecules Benedikt Christoph Wolters Seminar Bioinformatics Algorithms RWTH AACHEN 07/17/2015 Outline 1 Introduction and Motivation Protein Structure Hierarchy Protein

More information

Supplementary Material

Supplementary Material Supplementary Material Sm-I Formal Description of the Sampling Process In the sequel, given an RNA molecule r consisting of n nucleotides, we denote the corresponding sequence fragment from position i

More information

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its

More information

A Combinatorial Framework for Multiple RNA Interaction Prediction

A Combinatorial Framework for Multiple RNA Interaction Prediction City University of New York (CUNY) CUNY Academic Works Dissertations, Theses, and Capstone Projects Graduate Center 9-2017 A Combinatorial Framework for Multiple RNA Interaction Prediction Syed Ali Ahmed

More information

Junction-Explorer Help File

Junction-Explorer Help File Junction-Explorer Help File Dongrong Wen, Christian Laing, Jason T. L. Wang and Tamar Schlick Overview RNA junctions are important structural elements of three or more helices in the organization of the

More information

Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction

Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction Sebastian Will 1 and Hosna Jabbari 2 1 Bioinformatics/IZBI, University Leipzig, swill@csail.mit.edu 2 Ingenuity Lab, National

More information

Rapid Dynamic Programming Algorithms for RNA Secondary Structure

Rapid Dynamic Programming Algorithms for RNA Secondary Structure ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of

More information

Dot Bracket Notation for RNA and DNA nanostructures. Slides by Reem Mokhtar

Dot Bracket Notation for RNA and DNA nanostructures. Slides by Reem Mokhtar Dot Bracket Notation for RNA and DNA nanostructures Slides by Reem Mokhtar Graphical/Data Purpose: - Ease of interaction and design - Aid in validating designs Representations might include - GUI input

More information

Quantitative modeling of RNA single-molecule experiments. Ralf Bundschuh Department of Physics, Ohio State University

Quantitative modeling of RNA single-molecule experiments. Ralf Bundschuh Department of Physics, Ohio State University Quantitative modeling of RN single-molecule experiments Ralf Bundschuh Department of Physics, Ohio State niversity ollaborators: lrich erland, LM München Terence Hwa, San Diego Outline: Single-molecule

More information

A Novel Statistical Model for the Secondary Structure of RNA

A Novel Statistical Model for the Secondary Structure of RNA ISBN 978-1-8466-93-3 Proceedings of the 5th International ongress on Mathematical Biology (IMB11) Vol. 3 Nanjing, P. R. hina, June 3-5, 11 Novel Statistical Model for the Secondary Structure of RN Liu

More information

Characterising RNA secondary structure space using information entropy

Characterising RNA secondary structure space using information entropy Characterising RNA secondary structure space using information entropy Zsuzsanna Sükösd 1,2,3, Bjarne Knudsen 4, James WJ Anderson 5, Ádám Novák 5,6, Jørgen Kjems 2,3 and Christian NS Pedersen 1,7 1 Bioinformatics

More information

D Dobbs ISU - BCB 444/544X 1

D Dobbs ISU - BCB 444/544X 1 11/7/05 Protein Structure: Classification, Databases, Visualization Announcements BCB 544 Projects - Important Dates: Nov 2 Wed noon - Project proposals due to David/Drena Nov 4 Fri PM - Approvals/responses

More information

The Ensemble of RNA Structures Example: some good structures of the RNA sequence

The Ensemble of RNA Structures Example: some good structures of the RNA sequence The Ensemble of RNA Structures Example: some good structures of the RNA sequence GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCUGGUUCAAAUCCAGGUGCCCCCU free energy in kcal/mol (((((((..((((...))))...((((...))))(((((...)))))))))))).

More information

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate

More information

The wonderful world of RNA informatics

The wonderful world of RNA informatics December 9, 2012 Course Goals Familiarize you with the challenges involved in RNA informatics. Introduce commonly used tools, and provide an intuition for how they work. Give you the background and confidence

More information

Bio nformatics. Lecture 23. Saad Mneimneh

Bio nformatics. Lecture 23. Saad Mneimneh Bio nformatics Lecture 23 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely

More information

The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands

The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Thesis by Joseph Malcolm Schaeffer In Partial Fulfillment of the Requirements for the Degree of Master

More information

A Method for Aligning RNA Secondary Structures

A Method for Aligning RNA Secondary Structures Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN

More information

Unit 1: Chemistry - Guided Notes

Unit 1: Chemistry - Guided Notes Scientific Method Notes: Unit 1: Chemistry - Guided Notes 1 Common Elements in Biology: Atoms are made up of: 1. 2. 3. In order to be stable, an atom of an element needs a full valence shell of electrons.

More information

Protein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix)

Protein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix) Computat onal Biology Lecture 21 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely

More information

DANNY BARASH ABSTRACT

DANNY BARASH ABSTRACT JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales

More information

Novel Algorithms for Structural Alignment of Noncoding

Novel Algorithms for Structural Alignment of Noncoding Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) January 2010 Novel Algorithms for Structural Alignment of Noncoding RNAs Diana Kolbe Washington

More information

Contents. xiii. Preface v

Contents. xiii. Preface v Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak

More information

arxiv: v1 [q-bio.bm] 25 Jul 2012

arxiv: v1 [q-bio.bm] 25 Jul 2012 CoFold: thermodynamic RNA structure prediction with a kinetic twist arxiv:1207.6013v1 [q-bio.bm] 25 Jul 2012 Jeff R. Proctor and Irmtraud M. Meyer Centre for High-Throughput Biology & Department of Computer

More information

Introduction to Polymer Physics

Introduction to Polymer Physics Introduction to Polymer Physics Enrico Carlon, KU Leuven, Belgium February-May, 2016 Enrico Carlon, KU Leuven, Belgium Introduction to Polymer Physics February-May, 2016 1 / 28 Polymers in Chemistry and

More information

Neural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha

Neural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha Neural Networks for Protein Structure Prediction Brown, JMB 1999 CS 466 Saurabh Sinha Outline Goal is to predict secondary structure of a protein from its sequence Artificial Neural Network used for this

More information

Overview Multiple Sequence Alignment

Overview Multiple Sequence Alignment Overview Multiple Sequence Alignment Inge Jonassen Bioinformatics group Dept. of Informatics, UoB Inge.Jonassen@ii.uib.no Definition/examples Use of alignments The alignment problem scoring alignments

More information

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization. Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the

More information

A Structure-Based Flexible Search Method for Motifs in RNA

A Structure-Based Flexible Search Method for Motifs in RNA JOURNAL OF COMPUTATIONAL BIOLOGY Volume 14, Number 7, 2007 Mary Ann Liebert, Inc. Pp. 908 926 DOI: 10.1089/cmb.2007.0061 A Structure-Based Flexible Search Method for Motifs in RNA ISANA VEKSLER-LUBLINSKY,

More information

Gibbs Sampling Methods for Multiple Sequence Alignment

Gibbs Sampling Methods for Multiple Sequence Alignment Gibbs Sampling Methods for Multiple Sequence Alignment Scott C. Schmidler 1 Jun S. Liu 2 1 Section on Medical Informatics and 2 Department of Statistics Stanford University 11/17/99 1 Outline Statistical

More information

Sparse RNA folding revisited: space efficient minimum free energy structure prediction

Sparse RNA folding revisited: space efficient minimum free energy structure prediction DOI 10.1186/s13015-016-0071-y Algorithms for Molecular Biology RESEARCH ARTICLE Sparse RNA folding revisited: space efficient minimum free energy structure prediction Sebastian Will 1* and Hosna Jabbari

More information

DYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES

DYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES DYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES UNYANEE POOLSAP, YUKI KATO, TATSUYA AKUTSU Bioinformatics Center, Institute for Chemical Research, Kyoto University, Gokasho,

More information

A nucleotide-level coarse-grained model of RNA

A nucleotide-level coarse-grained model of RNA A nucleotide-level coarse-grained model of RNA Petr Šulc, Flavio Romano, Thomas E. Ouldridge, Jonathan P. K. Doye, and Ard A. Louis Citation: The Journal of Chemical Physics 140, 235102 (2014); doi: 10.1063/1.4881424

More information

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction RNA Secondary Structure Prediction 1 RNA structure prediction methods Base-Pair Maximization Context-Free Grammar Parsing. Free Energy Methods Covariance Models 2 The Nussinov-Jacobson Algorithm q = 9

More information

Masterarbeit. Titel der Masterarbeit. Computational Refinement of SHAPE RNA probing Experiments. verfasst von. Roman Wilhelm Ochsenreiter, BSc

Masterarbeit. Titel der Masterarbeit. Computational Refinement of SHAPE RNA probing Experiments. verfasst von. Roman Wilhelm Ochsenreiter, BSc Masterarbeit Titel der Masterarbeit omputational Refinement of SHPE RN probing Experiments verfasst von Roman Wilhelm Ochsenreiter, BSc angestrebter akademischer rad Master of Science (MSc) Wien, 2015

More information

RNA-RNA interaction is NP-complete and some approximation algorithms

RNA-RNA interaction is NP-complete and some approximation algorithms RNA-RNA interaction is NP-complete and some approximation algorithms Saad Mneimneh Visiting Professor, Computer Science, Hunter College of CUNY 695 Park Avenue, New York, NY 10021 saad@alum.mit.edu dedicated

More information

Chapter 1. A Method to Predict the 3D Structure of an RNA Scaffold. Xiaojun Xu and Shi-Jie Chen. Abstract. 1 Introduction

Chapter 1. A Method to Predict the 3D Structure of an RNA Scaffold. Xiaojun Xu and Shi-Jie Chen. Abstract. 1 Introduction Chapter 1 Abstract The ever increasing discoveries of noncoding RNA functions draw a strong demand for RNA structure determination from the sequence. In recently years, computational studies for RNA structures,

More information

A statistical sampling algorithm for RNA secondary structure prediction

A statistical sampling algorithm for RNA secondary structure prediction 7280±7301 Nucleic Acids Research, 2003, Vol. 31, No. 24 DOI: 10.1093/nar/gkg938 A statistical sampling algorithm for RNA secondary structure prediction Ye Ding* and Charles E. Lawrence Bioinformatics Center,

More information

Bioinformatics Advance Access published July 14, Jens Reeder, Robert Giegerich

Bioinformatics Advance Access published July 14, Jens Reeder, Robert Giegerich Bioinformatics Advance Access published July 14, 2005 BIOINFORMATICS Consensus Shapes: An Alternative to the Sankoff Algorithm for RNA Consensus Structure Prediction Jens Reeder, Robert Giegerich Faculty

More information

Computational approaches for RNA energy parameter estimation

Computational approaches for RNA energy parameter estimation Computational approaches for RNA energy parameter estimation Mirela Andronescu 1, Anne Condon 2, Holger H. Hoos 2, David H. Mathews 3, and Kevin P. Murphy 2 1 Dept. of Genome Sciences, University of Washington,

More information

Conserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna.

Conserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna. onserved RN Structures Ivo L. Hofacker Institut for Theoretical hemistry, University Vienna http://www.tbi.univie.ac.at/~ivo/ Bled, January 2002 Energy Directed Folding Predict structures from sequence

More information

Predicting RNA Secondary Structure Using Profile Stochastic Context-Free Grammars and Phylogenic Analysis

Predicting RNA Secondary Structure Using Profile Stochastic Context-Free Grammars and Phylogenic Analysis Fang XY, Luo ZG, Wang ZH. Predicting RNA secondary structure using profile stochastic context-free grammars and phylogenic analysis. JOURNAL OF COMPUTER SCIENCE AND TECHNOLOGY 23(4): 582 589 July 2008

More information

Biomolecules. Energetics in biology. Biomolecules inside the cell

Biomolecules. Energetics in biology. Biomolecules inside the cell Biomolecules Energetics in biology Biomolecules inside the cell Energetics in biology The production of energy, its storage, and its use are central to the economy of the cell. Energy may be defined as

More information

Shape Based Indexing For Faster Search Of RNA Family Databases

Shape Based Indexing For Faster Search Of RNA Family Databases For Faster Search Of RNA Family Databases Stefan Janssen Jens Reeder Robert Giegerich 26. April 2008 RNA homology Why? build homologous groups find new group members How? sequence & structure Covariance

More information

Detecting non-coding RNA in Genomic Sequences

Detecting non-coding RNA in Genomic Sequences Detecting non-coding RNA in Genomic Sequences I. Overview of ncrnas II. What s specific about RNA detection? III. Looking for known RNAs IV. Looking for unknown RNAs Daniel Gautheret INSERM ERM 206 & Université

More information

RNA Graph Partitioning for the Discovery of RNA Modularity: A Novel Application of Graph Partition Algorithm to Biology

RNA Graph Partitioning for the Discovery of RNA Modularity: A Novel Application of Graph Partition Algorithm to Biology for the Discovery of RNA Modularity: A Novel Application of Graph Partition Algorithm to Biology Namhee Kim., Zhe Zheng., Shereef Elmetwaly, Tamar Schlick* Department of Chemistry and Courant Institute

More information

Introduction to Computational Structural Biology

Introduction to Computational Structural Biology Introduction to Computational Structural Biology Part I 1. Introduction The disciplinary character of Computational Structural Biology The mathematical background required and the topics covered Bibliography

More information

The wonderful world of NUCLEIC ACID NMR!

The wonderful world of NUCLEIC ACID NMR! Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically

More information

The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands

The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Joseph Schaeffer, Caltech (slides by John Reif) Entropy: Is a measure of disorder or randomness of a

More information

Stable stem enabled Shannon entropies distinguish non-coding RNAs from random backgrounds

Stable stem enabled Shannon entropies distinguish non-coding RNAs from random backgrounds RESEARCH Stable stem enabled Shannon entropies distinguish non-coding RNAs from random backgrounds Open Access Yingfeng Wang 1*, Amir Manzour 3, Pooya Shareghi 1, Timothy I Shaw 3, Ying-Wai Li 4, Russell

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

Sequence analysis and comparison

Sequence analysis and comparison The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748 CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr

More information

Complete Suboptimal Folding of RNA and the Stability of Secondary Structures

Complete Suboptimal Folding of RNA and the Stability of Secondary Structures Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA

More information

Impact Of The Energy Model On The Complexity Of RNA Folding With Pseudoknots

Impact Of The Energy Model On The Complexity Of RNA Folding With Pseudoknots Impact Of The Energy Model On The omplexity Of RN Folding With Pseudoknots Saad Sheikh, Rolf Backofen Yann Ponty, niversity of Florida, ainesville, S lbert Ludwigs niversity, Freiburg, ermany LIX, NRS/Ecole

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.

More information

Finding Consensus Energy Folding Landscapes Between RNA Sequences

Finding Consensus Energy Folding Landscapes Between RNA Sequences University of Central Florida Electronic Theses and Dissertations Masters Thesis (Open Access) Finding Consensus Energy Folding Landscapes Between RNA Sequences 2015 Joshua Burbridge University of Central

More information

A tutorial on RNA folding methods and resources

A tutorial on RNA folding methods and resources A tutorial on RNA folding methods and resources Alain Denise, LRI/IGM, Université Paris-Sud with invaluable help from Yann Ponty, CNRS/Ecole Polytechnique 1 Master BIBS 2014-2015 Goals To help your work

More information

A phylogenetic view on RNA structure evolution

A phylogenetic view on RNA structure evolution 3 2 9 4 7 3 24 23 22 8 phylogenetic view on RN structure evolution 9 26 6 52 7 5 6 37 57 45 5 84 63 86 77 65 3 74 7 79 8 33 9 97 96 89 47 87 62 32 34 42 73 43 44 4 76 58 75 78 93 39 54 82 99 28 95 52 46

More information

Biphasic Folding Kinetics of RNA Pseudoknots and Telomerase RNA Activity

Biphasic Folding Kinetics of RNA Pseudoknots and Telomerase RNA Activity doi:10.1016/j.jmb.2007.01.006 J. Mol. Biol. (2007) 367, 909 924 Biphasic Folding Kinetics of RNA Pseudoknots and Telomerase RNA Activity Song Cao and Shi-Jie Chen 1 Department of Physics, University of

More information

BIOINFORMATICS. Fast evaluation of internal loops in RNA secondary structure prediction. Abstract. Introduction

BIOINFORMATICS. Fast evaluation of internal loops in RNA secondary structure prediction. Abstract. Introduction BIOINFORMATICS Fast evaluation of internal loops in RNA secondary structure prediction Abstract Motivation: Though not as abundant in known biological processes as proteins, RNA molecules serve as more

More information