RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
|
|
- Noel Ryan
- 5 years ago
- Views:
Transcription
1 RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm,
2 RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi loop f. exterior loop g. dangling nucleotide h. energy penalty after stem i. coaxial stacking n_web.png
3 Most nucleotides are bound to helical structures 4 types of loops: H: hairpins I: interior loops B: bulges M: multi-loops Example of secondary structure of RNA helical hairpin-loop bulge Interior loop RNAse P from Bacillus subtilis (M. Zuker)
4 Timeline of secondary structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98
5 FIRST STEP: THERMODYNAMIC PREDICTION
6 Thermodynamic prediction algorithms R. Lorenz et al. / Methods 103 (2016) 86 98
7 secondary structure prediction programs for RNA Mfold RNAfold (Vienna RNA server) RNA structure html
8 Structure prediction methods 1.8 N possibilites (N = length of sequence) Normally free energy minimization Combinatorial puzzling pieces of sec. Structure Recursive one nucleotide addition Comparative sequence analysis Context free grammar for training (without energy calculations)
9 BP MAXIMIZATION: NUSSINOV (1978) { } ) (4 (3) (2) (1) (0) ) ( ) ( min ) ( ) ( ) ( ), ( 4 0 ) ( min ) (, 1, 1, 1, 1 1,,, + + < = = < < + + j k k i j k i j i j i j i j i j i j i S E S E S E S E S E r r i j für S E S E α (0): rule prevent to strong bends in the structure (1): basepairing of r i and r j sum of energy for basepairing and part of secondary structure before E(S i+1,j-1 ) (2): base r i no basepairing to R i,j (3): base r j no basepairing to R i,j (4): bifurcation; bases r i and r j are bound in two different parts of the secondary structure
10 Dot Plot for trnaphe
11 Old energy rules (2.3) best structure kcal/mol worst structure kcal/mol
12 New energy rules (3.0) -For changing the temperature use RNA 2.3 -Decide if the RNA is circular or linear -The maximum between paired bases is not so important -To check the possible structures use a greater window size to increase the energy difference
13 Output RNAFold First you get the best predicted structure in dot-bracket notation and the minimum free energy.
14 Predicted secondary structure base pairing probability and entropy can be checked with the partition function - forbid the wobble pair GU - forbid to build 1 bp Helices - prediction for 37 C
15 RNAfold Example using snorna: snr44 Prediction:
16 RNA structure
17 Structure comparison using MFE R. Lorenz et al. / Methods 103 (2016) 86 98
18 NEXT STEP: TERTIARY STRUCTURE PREDICTION
19 RNA structures are complex Not only two different structural elements Single and double stranded regions Pseudoknots between single stranded regions
20 Tertiary structure elements increasing complexity for prediction pseudoknot kissing hairpins hairpin loop-bulge contact
21 Structure prediction including pseudknots R. Lorenz et al. 2016
22 P. Zhao et al RNA kinetic folding
23 Main classes of structure prediction Iterated Loop Matching algorithm An iterated loop matching approach to the prediction of RNA secondary structures with pseudoknots (Ruan, Stormo, Zhang; 2004) Stochastic modelling using parallel grammars Stochastic modeling of RNA pseudoknotted structures: a grammatical approach (Cai, Russell, Wu; 2003) Graph-theoretical / Multisequence approaches A graph theoretical approach to predict common RNA secondary sructure motifs including pseudoknots in unaligned sequences (Yongmei, Stormo, Xing; 2004)
24 Contrafold Do et al. 2006
25 Dynalign or PPfold Using multiple sequence alignment (Ppfold) Or having template sequence for corrections (Dynalign) Calculation of the free energy having inforamtion about conserved regions
26 BENCHMARKING AND DRAWBACKS FOR SECONDARY STRUCTURE PREDICTION
27 Comparison single vs. multiple sequence algorithms Multiple sequences Single sequence (Medium similarity) Multiple sequences (High similarity) P. Gardner et al. 2004
28 Comparative RNA structure prediction strategies P. Gardner et al. 2004
29 Comparison of comparative structure prediction strategies Sensitivity: True predicted positives vs. all true positives P. Gardner et al Selectivity: All true predicted vs. all predicted
30 Prediction of single RNA secondary Accuracy: structure About 500 nt long RNAs 70% of correct basepairs >500 nt long RNAs fall down to 40% accuracy Reasons: simplifications in the energy model inaccuracies of parameters ignoring the effect of binding to ions proteins and other ligands non-equilibrium states of the RNA R. Lorenz et al. / Methods 103 (2016) 86 98
31 Prediction of multiple RNA secondary structures Multiple sequence advances: Additional information like phylogenetic tree, substitution model unpaired/paired Energy-based and evolutionary based Drawbacks: Dependent on the alignment quality Pairwise identity >80% for consensus structure
32 HOW PROBING CAN IMPROVE STRUCTURE PREDICTION?
33 High throughput probing and guided structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98
34 Usage of experimental data Structure probing: Biochemical method to find structure of nucleic acids on molecular level Physical methods: Crystalstructures, NMR Chemical methods: Modification of nucleic acids DMS or SHAPE
35 SHAPE for guided structure prediction Selective 2 -hydroxyl acylation analyzed by primer extension = SHAPE 2 -Hydroxyl group of ribose is bound by 1-methyl-7-nitroisatoic anhydrid (1M7) Reacts on all unbound riboses in the RNA molecule Reverse transcriptase is stopping and falls of comparison to control shows unbound regions of the RNA
36 Guided structure prediction R. Lorenz et al. / Methods 103 (2016) 86 98
37 DMS for high throughput Sequencing DMS methylates nitrogen in Adenin and Tyrosin Unbound bases, end of helices and GU basepairs are detectable
38 Genome-wide Structurome
39 Mod-seq for footprinting
40 Limitations by experimental setup effectiveness of the probing agent can be influenced by solvent accessibility tertiary and even quaternary interactions bulky enzymes may not be able to reach all parts of the RNA de- and re-naturing steps devoid of any RNA-binding proteins or other factors
41 Future perspectives slightest error in hard constraints might yield an entirely wrong prediction secondary structures does not account for tertiary effects such as non-canonical base pairs extremely short hairpin loops and long interior loops are excluded
42
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationproteins are the basic building blocks and active players in the cell, and
12 RN Secondary Structure Sources for this lecture: R. Durbin, S. Eddy,. Krogh und. Mitchison, Biological sequence analysis, ambridge, 1998 J. Setubal & J. Meidanis, Introduction to computational molecular
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationComputational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters
Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters 1 Binod Kumar, Assistant Professor, Computer Sc. Dept, ISTAR, Vallabh Vidyanagar,
More informationBCB 444/544 Fall 07 Dobbs 1
BCB 444/544 Required Reading (before lecture) Lecture 25 Mon Oct 15 - Lecture 23 Protein Tertiary Structure Prediction Chp 15 - pp 214-230 More RNA Structure Wed Oct 17 & Thurs Oct 18 - Lecture 24 & Lab
More informationIn Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
More informationUsing SetPSO to determine RNA secondary structure
Using SetPSO to determine RNA secondary structure by Charles Marais Neethling Submitted in partial fulfilment of the requirements for the degree of Master of Science (Computer Science) in the Faculty of
More informationCS681: Advanced Topics in Computational Biology
CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 10 Lecture 1 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ RNA folding Prediction of secondary structure
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationRNA Secondary Structure Prediction
RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential
More informationRNA Folding and Interaction Prediction: A Survey
RNA Folding and Interaction Prediction: A Survey Syed Ali Ahmed Graduate Center, City University of New York New York, NY November 19, 2015 Abstract The problem of computationally predicting the structure
More informationLecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression
C N F O N G A V B O N F O M A C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/NA Structure Prediction pigenectics pigenomics: Gene xpression ranscription factors
More informationRNA Structure Prediction and Comparison. RNA folding
RNA Structure Prediction and Comparison Session 3 RNA folding Faculty of Technology robert@techfak.uni-bielefeld.de Bielefeld, WS 2013/2014 Base Pair Maximization This was the first structure prediction
More informationBIOINFORMATICS. Prediction of RNA secondary structure based on helical regions distribution
BIOINFORMATICS Prediction of RNA secondary structure based on helical regions distribution Abstract Motivation: RNAs play an important role in many biological processes and knowing their structure is important
More informationComputing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model
Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model J. Waldispühl 1,3 P. Clote 1,2, 1 Department of Biology, Higgins 355, Boston
More informationGrand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world
Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic
More informationRNA and Protein Structure Prediction
RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure
More informationRecitaLon CB Lecture #10 RNA Secondary Structure
RecitaLon 3-19 CB Lecture #10 RNA Secondary Structure 1 Announcements 2 Exam 1 grades and answer key will be posted Friday a=ernoon We will try to make exams available for pickup Friday a=ernoon (probably
More informationCONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models
Supplementary Material for CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Chuong B Do, Daniel A Woods, and Serafim Batzoglou Stanford University, Stanford, CA 94305, USA, {chuongdo,danwoods,serafim}@csstanfordedu,
More informationBIOINF 4120 Bioinforma2cs 2 - Structures and Systems -
BIOINF 4120 Bioinforma2cs 2 - Structures and Systems - Oliver Kohlbacher Summer 2014 3. RNA Structure Part II Overview RNA Folding Free energy as a criterion Folding free energy of RNA Zuker- SCegler algorithm
More informationRNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology"
RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology" Day 1" Many biologically interesting roles for RNA" RNA secondary structure prediction" 3 4 Approaches to Structure
More informationCombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming
ombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming Matthew Macauley Department of Mathematical Sciences lemson niversity http://www.math.clemson.edu/~macaule/ Math
More informationAlgorithmic Aspects of RNA Secondary Structures
Algorithmic Aspects of RNA Secondary Structures Stéphane Vialette CNRS & LIGM, Université Paris-Est Marne-la-Vallée, France 214-115 S. Vialette (CNRS & LIGM) RNA Secondary Structures 214-215 1 / 124 Introduction
More informationSemi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach
Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2011 Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach Jianping
More informationBachelor Thesis. RNA Secondary Structure Prediction
Bachelor Thesis RNA Secondary Structure Prediction Sophie Schneiderbauer soschnei@uos.de Cognitive Science, University Of Osnabrück First supervisor: Prof. Dr. Volker Sperschneider Second supervisor: Prof.
More informationComputational approaches for RNA energy parameter estimation
omputational approaches for RNA energy parameter estimation by Mirela Ştefania Andronescu M.Sc., The University of British olumbia, 2003 B.Sc., Bucharest Academy of Economic Studies, 1999 A THESIS SUBMITTED
More informationRNA folding with hard and soft constraints
DOI 10.1186/s13015-016-0070-z Algorithms for Molecular Biology RESEARCH RNA folding with hard and soft constraints Ronny Lorenz 1*, Ivo L. Hofacker 1,2,3 and Peter F. Stadler 1,3,4,5,6,7 Open Access Abstract
More informationRNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev
RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC
More informationRNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev
RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC
More informationUsing distance geomtry to generate structures
Using distance geomtry to generate structures David A. Case Genomic systems and structures, Spring, 2009 Converting distances to structures Metric Matrix Distance Geometry To describe a molecule in terms
More informationCOMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES
COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES ÉRIC FUSY AND PETER CLOTE Abstract. It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is 1.104366
More informationLab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816
More informationRNA$2 nd $structure$predic0on
RNA$2 nd $structure$predic0on Recall Nucleic Acids - RNA and DNA The carrier of genetic information - The blueprints of proteins Nucleotides Bases Adenine (A) Guanine (G) Cytosine(C) Thymine(T) Uracil
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationRNA Abstract Shape Analysis
ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:
More informationStructure-Based Comparison of Biomolecules
Structure-Based Comparison of Biomolecules Benedikt Christoph Wolters Seminar Bioinformatics Algorithms RWTH AACHEN 07/17/2015 Outline 1 Introduction and Motivation Protein Structure Hierarchy Protein
More informationSupplementary Material
Supplementary Material Sm-I Formal Description of the Sampling Process In the sequel, given an RNA molecule r consisting of n nucleotides, we denote the corresponding sequence fragment from position i
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationA Combinatorial Framework for Multiple RNA Interaction Prediction
City University of New York (CUNY) CUNY Academic Works Dissertations, Theses, and Capstone Projects Graduate Center 9-2017 A Combinatorial Framework for Multiple RNA Interaction Prediction Syed Ali Ahmed
More informationJunction-Explorer Help File
Junction-Explorer Help File Dongrong Wen, Christian Laing, Jason T. L. Wang and Tamar Schlick Overview RNA junctions are important structural elements of three or more helices in the organization of the
More informationSparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction
Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction Sebastian Will 1 and Hosna Jabbari 2 1 Bioinformatics/IZBI, University Leipzig, swill@csail.mit.edu 2 Ingenuity Lab, National
More informationRapid Dynamic Programming Algorithms for RNA Secondary Structure
ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of
More informationDot Bracket Notation for RNA and DNA nanostructures. Slides by Reem Mokhtar
Dot Bracket Notation for RNA and DNA nanostructures Slides by Reem Mokhtar Graphical/Data Purpose: - Ease of interaction and design - Aid in validating designs Representations might include - GUI input
More informationQuantitative modeling of RNA single-molecule experiments. Ralf Bundschuh Department of Physics, Ohio State University
Quantitative modeling of RN single-molecule experiments Ralf Bundschuh Department of Physics, Ohio State niversity ollaborators: lrich erland, LM München Terence Hwa, San Diego Outline: Single-molecule
More informationA Novel Statistical Model for the Secondary Structure of RNA
ISBN 978-1-8466-93-3 Proceedings of the 5th International ongress on Mathematical Biology (IMB11) Vol. 3 Nanjing, P. R. hina, June 3-5, 11 Novel Statistical Model for the Secondary Structure of RN Liu
More informationCharacterising RNA secondary structure space using information entropy
Characterising RNA secondary structure space using information entropy Zsuzsanna Sükösd 1,2,3, Bjarne Knudsen 4, James WJ Anderson 5, Ádám Novák 5,6, Jørgen Kjems 2,3 and Christian NS Pedersen 1,7 1 Bioinformatics
More informationD Dobbs ISU - BCB 444/544X 1
11/7/05 Protein Structure: Classification, Databases, Visualization Announcements BCB 544 Projects - Important Dates: Nov 2 Wed noon - Project proposals due to David/Drena Nov 4 Fri PM - Approvals/responses
More informationThe Ensemble of RNA Structures Example: some good structures of the RNA sequence
The Ensemble of RNA Structures Example: some good structures of the RNA sequence GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCUGGUUCAAAUCCAGGUGCCCCCU free energy in kcal/mol (((((((..((((...))))...((((...))))(((((...)))))))))))).
More informationProtein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
More informationThe wonderful world of RNA informatics
December 9, 2012 Course Goals Familiarize you with the challenges involved in RNA informatics. Introduce commonly used tools, and provide an intuition for how they work. Give you the background and confidence
More informationBio nformatics. Lecture 23. Saad Mneimneh
Bio nformatics Lecture 23 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationThe Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands
The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Thesis by Joseph Malcolm Schaeffer In Partial Fulfillment of the Requirements for the Degree of Master
More informationA Method for Aligning RNA Secondary Structures
Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN
More informationUnit 1: Chemistry - Guided Notes
Scientific Method Notes: Unit 1: Chemistry - Guided Notes 1 Common Elements in Biology: Atoms are made up of: 1. 2. 3. In order to be stable, an atom of an element needs a full valence shell of electrons.
More informationProtein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix)
Computat onal Biology Lecture 21 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationDANNY BARASH ABSTRACT
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales
More informationNovel Algorithms for Structural Alignment of Noncoding
Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) January 2010 Novel Algorithms for Structural Alignment of Noncoding RNAs Diana Kolbe Washington
More informationContents. xiii. Preface v
Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak
More informationarxiv: v1 [q-bio.bm] 25 Jul 2012
CoFold: thermodynamic RNA structure prediction with a kinetic twist arxiv:1207.6013v1 [q-bio.bm] 25 Jul 2012 Jeff R. Proctor and Irmtraud M. Meyer Centre for High-Throughput Biology & Department of Computer
More informationIntroduction to Polymer Physics
Introduction to Polymer Physics Enrico Carlon, KU Leuven, Belgium February-May, 2016 Enrico Carlon, KU Leuven, Belgium Introduction to Polymer Physics February-May, 2016 1 / 28 Polymers in Chemistry and
More informationNeural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha
Neural Networks for Protein Structure Prediction Brown, JMB 1999 CS 466 Saurabh Sinha Outline Goal is to predict secondary structure of a protein from its sequence Artificial Neural Network used for this
More informationOverview Multiple Sequence Alignment
Overview Multiple Sequence Alignment Inge Jonassen Bioinformatics group Dept. of Informatics, UoB Inge.Jonassen@ii.uib.no Definition/examples Use of alignments The alignment problem scoring alignments
More information1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.
Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the
More informationA Structure-Based Flexible Search Method for Motifs in RNA
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 14, Number 7, 2007 Mary Ann Liebert, Inc. Pp. 908 926 DOI: 10.1089/cmb.2007.0061 A Structure-Based Flexible Search Method for Motifs in RNA ISANA VEKSLER-LUBLINSKY,
More informationGibbs Sampling Methods for Multiple Sequence Alignment
Gibbs Sampling Methods for Multiple Sequence Alignment Scott C. Schmidler 1 Jun S. Liu 2 1 Section on Medical Informatics and 2 Department of Statistics Stanford University 11/17/99 1 Outline Statistical
More informationSparse RNA folding revisited: space efficient minimum free energy structure prediction
DOI 10.1186/s13015-016-0071-y Algorithms for Molecular Biology RESEARCH ARTICLE Sparse RNA folding revisited: space efficient minimum free energy structure prediction Sebastian Will 1* and Hosna Jabbari
More informationDYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES
DYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES UNYANEE POOLSAP, YUKI KATO, TATSUYA AKUTSU Bioinformatics Center, Institute for Chemical Research, Kyoto University, Gokasho,
More informationA nucleotide-level coarse-grained model of RNA
A nucleotide-level coarse-grained model of RNA Petr Šulc, Flavio Romano, Thomas E. Ouldridge, Jonathan P. K. Doye, and Ard A. Louis Citation: The Journal of Chemical Physics 140, 235102 (2014); doi: 10.1063/1.4881424
More informationRNA Secondary Structure Prediction
RNA Secondary Structure Prediction 1 RNA structure prediction methods Base-Pair Maximization Context-Free Grammar Parsing. Free Energy Methods Covariance Models 2 The Nussinov-Jacobson Algorithm q = 9
More informationMasterarbeit. Titel der Masterarbeit. Computational Refinement of SHAPE RNA probing Experiments. verfasst von. Roman Wilhelm Ochsenreiter, BSc
Masterarbeit Titel der Masterarbeit omputational Refinement of SHPE RN probing Experiments verfasst von Roman Wilhelm Ochsenreiter, BSc angestrebter akademischer rad Master of Science (MSc) Wien, 2015
More informationRNA-RNA interaction is NP-complete and some approximation algorithms
RNA-RNA interaction is NP-complete and some approximation algorithms Saad Mneimneh Visiting Professor, Computer Science, Hunter College of CUNY 695 Park Avenue, New York, NY 10021 saad@alum.mit.edu dedicated
More informationChapter 1. A Method to Predict the 3D Structure of an RNA Scaffold. Xiaojun Xu and Shi-Jie Chen. Abstract. 1 Introduction
Chapter 1 Abstract The ever increasing discoveries of noncoding RNA functions draw a strong demand for RNA structure determination from the sequence. In recently years, computational studies for RNA structures,
More informationA statistical sampling algorithm for RNA secondary structure prediction
7280±7301 Nucleic Acids Research, 2003, Vol. 31, No. 24 DOI: 10.1093/nar/gkg938 A statistical sampling algorithm for RNA secondary structure prediction Ye Ding* and Charles E. Lawrence Bioinformatics Center,
More informationBioinformatics Advance Access published July 14, Jens Reeder, Robert Giegerich
Bioinformatics Advance Access published July 14, 2005 BIOINFORMATICS Consensus Shapes: An Alternative to the Sankoff Algorithm for RNA Consensus Structure Prediction Jens Reeder, Robert Giegerich Faculty
More informationComputational approaches for RNA energy parameter estimation
Computational approaches for RNA energy parameter estimation Mirela Andronescu 1, Anne Condon 2, Holger H. Hoos 2, David H. Mathews 3, and Kevin P. Murphy 2 1 Dept. of Genome Sciences, University of Washington,
More informationConserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna.
onserved RN Structures Ivo L. Hofacker Institut for Theoretical hemistry, University Vienna http://www.tbi.univie.ac.at/~ivo/ Bled, January 2002 Energy Directed Folding Predict structures from sequence
More informationPredicting RNA Secondary Structure Using Profile Stochastic Context-Free Grammars and Phylogenic Analysis
Fang XY, Luo ZG, Wang ZH. Predicting RNA secondary structure using profile stochastic context-free grammars and phylogenic analysis. JOURNAL OF COMPUTER SCIENCE AND TECHNOLOGY 23(4): 582 589 July 2008
More informationBiomolecules. Energetics in biology. Biomolecules inside the cell
Biomolecules Energetics in biology Biomolecules inside the cell Energetics in biology The production of energy, its storage, and its use are central to the economy of the cell. Energy may be defined as
More informationShape Based Indexing For Faster Search Of RNA Family Databases
For Faster Search Of RNA Family Databases Stefan Janssen Jens Reeder Robert Giegerich 26. April 2008 RNA homology Why? build homologous groups find new group members How? sequence & structure Covariance
More informationDetecting non-coding RNA in Genomic Sequences
Detecting non-coding RNA in Genomic Sequences I. Overview of ncrnas II. What s specific about RNA detection? III. Looking for known RNAs IV. Looking for unknown RNAs Daniel Gautheret INSERM ERM 206 & Université
More informationRNA Graph Partitioning for the Discovery of RNA Modularity: A Novel Application of Graph Partition Algorithm to Biology
for the Discovery of RNA Modularity: A Novel Application of Graph Partition Algorithm to Biology Namhee Kim., Zhe Zheng., Shereef Elmetwaly, Tamar Schlick* Department of Chemistry and Courant Institute
More informationIntroduction to Computational Structural Biology
Introduction to Computational Structural Biology Part I 1. Introduction The disciplinary character of Computational Structural Biology The mathematical background required and the topics covered Bibliography
More informationThe wonderful world of NUCLEIC ACID NMR!
Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically
More informationThe Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands
The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Joseph Schaeffer, Caltech (slides by John Reif) Entropy: Is a measure of disorder or randomness of a
More informationStable stem enabled Shannon entropies distinguish non-coding RNAs from random backgrounds
RESEARCH Stable stem enabled Shannon entropies distinguish non-coding RNAs from random backgrounds Open Access Yingfeng Wang 1*, Amir Manzour 3, Pooya Shareghi 1, Timothy I Shaw 3, Ying-Wai Li 4, Russell
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr
More informationComplete Suboptimal Folding of RNA and the Stability of Secondary Structures
Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA
More informationImpact Of The Energy Model On The Complexity Of RNA Folding With Pseudoknots
Impact Of The Energy Model On The omplexity Of RN Folding With Pseudoknots Saad Sheikh, Rolf Backofen Yann Ponty, niversity of Florida, ainesville, S lbert Ludwigs niversity, Freiburg, ermany LIX, NRS/Ecole
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10657 Supplementary Text Introduction. All retroviruses contain three genes: namely, gag, pol and env, which code for structural, enzymatic and glycoprotein receptor proteins, respectively.
More informationFinding Consensus Energy Folding Landscapes Between RNA Sequences
University of Central Florida Electronic Theses and Dissertations Masters Thesis (Open Access) Finding Consensus Energy Folding Landscapes Between RNA Sequences 2015 Joshua Burbridge University of Central
More informationA tutorial on RNA folding methods and resources
A tutorial on RNA folding methods and resources Alain Denise, LRI/IGM, Université Paris-Sud with invaluable help from Yann Ponty, CNRS/Ecole Polytechnique 1 Master BIBS 2014-2015 Goals To help your work
More informationA phylogenetic view on RNA structure evolution
3 2 9 4 7 3 24 23 22 8 phylogenetic view on RN structure evolution 9 26 6 52 7 5 6 37 57 45 5 84 63 86 77 65 3 74 7 79 8 33 9 97 96 89 47 87 62 32 34 42 73 43 44 4 76 58 75 78 93 39 54 82 99 28 95 52 46
More informationBiphasic Folding Kinetics of RNA Pseudoknots and Telomerase RNA Activity
doi:10.1016/j.jmb.2007.01.006 J. Mol. Biol. (2007) 367, 909 924 Biphasic Folding Kinetics of RNA Pseudoknots and Telomerase RNA Activity Song Cao and Shi-Jie Chen 1 Department of Physics, University of
More informationBIOINFORMATICS. Fast evaluation of internal loops in RNA secondary structure prediction. Abstract. Introduction
BIOINFORMATICS Fast evaluation of internal loops in RNA secondary structure prediction Abstract Motivation: Though not as abundant in known biological processes as proteins, RNA molecules serve as more
More information