RNA Structure Prediction and Comparison. RNA folding
|
|
- Deirdre Robinson
- 6 years ago
- Views:
Transcription
1 RNA Structure Prediction and Comparison Session 3 RNA folding Faculty of Technology robert@techfak.uni-bielefeld.de Bielefeld, WS 2013/2014
2 Base Pair Maximization This was the first structure prediction algorithm by [Nussinov et al. 1978]: In M i,j we compute the maximum number of base pairs in a sequence r = r 1 r 2...r n : { } M i,j+1 = max M i,j, max [M i,k M k+1,j ] ρ(r k, r j+1 ) i k (j 3) r k, r j+1 {A, U, G, C} and ρ(r k, r j+1 ) = { 1 when rk and r j+1 can form a base pair, 0 otherwise. Note: This is an improved version of the original recurrences.
3 Nussinov ambiguity The recurrences originally given by Nussinov are highly ambiguous: The algorithm finds each structure many times. This does not preclude finding an optimal structure, but we cannot ask for ALL optimal structures an exponential number of redundant structures would be generated we cannot sensibly ask for near-optimal structures
4 An improved energy model Instead of maximizing pase pairs, we can maximize hyrdogen bonds: C G: 3 A U: 2 G U: 1 This is sometimes called the Nussinov-Jacobson energy model It favours lonely pairs, especially C G. Lonely pairs are not stable because they lack base pair stacking.
5 Exercise 1 Design a basepair maximization algorithm that avoids lonely pairs. 2 Modify the Nussinov algorithm such that not the number of base pairs is maximized, but the number of basepair-stackings. Why is this a good idea? 3 Is (1) and (2) above the same problem?
6 Computing the structure of minimal free energy Similar recurrences (in principle) as with base pair maximization Adding up local energy contributions from loops and stacking regions Minimization of energy (rather than base pair maximization). Traditionally, free energy in physics is negative; the unfolded state has energy 0. A grammar describing structures (cf. Session 2) must be much more sophisticated to accomodate the thermodynamic energy model.
7 Nearest neighbour energy computation G C G A A C C C U A U A C U A G G G U G A U G A A Energy = hairpinloop(cg, CUAG) + stackedpair(cg, UG) + stackedpair(ug, AU) + internalloop(4, 1) + stackedpair(ua, AU) + stackedpair(au, CG)
8 Zuker s algorithm and Mfold Zuker and Stiegler (1981) introduced the thermodynamic model, which still applies (in a much refined form) today their recurrences distinguish closed (V) from any kind (W) of structure the underlying grammar is ambiguous (but not as badly as Nussinov s) near-optimal structures can be sampled in a clever, but ad-hoc fashion Zuker s program Mfold has been continuously updated and used since 1981(!) until it was recently replaced by UnaFold
9 Exercise 1 Play with Zuker s algorithm using the ADP pages
10 RNA-Folding in the WWW (running out) http: //bibiserv/techfak.uni-bielefeld.de/rnashapes The Vienna RNA package today is the most widely used program. It is open source and contains RNAfold, RNAsubopt, RNAalifold and many other RNA-related programs.
11 Algebraic Dynamic Programming (Preview) In the next semester, we will study a particular convenient way to implement RNA folding and other related algorithms: Algebraic Dynamic Programming Describe problem decomposition by tree grammar Describe scoring rules by evaluation algebra Use ASCII notation for tree grammar Compile via Bellman s GAP Grammar + algebra = excutable code
12 Structures as trees Recall the tree representation: sr A C G U sr br sr sr hl U G G C A A A C G UUUA
13 A non-ambiguous grammar without lonely pairs wuchty98 Z = struct struct str str str block strong bl comps ul nil region strong singlestrand empty comps cons ul cons singlestrand ss block comps block block ul region singlestrand strong sr sr ( ) with basepairing base strong base base weak base weak hl sr sr ( base region3 base base bl base base br base region strong strong region ml sr base cons base base il base ) with basepairing block comps region strong region region3 region with minsize 3
14 Exercise Consider the sequence and the two structures ((...))(...). CGAAACGAUUGUG ((.((...)).)) and construct a tree for each structure (if possible)
15 Tree grammar in GAP-L A part of the above tree grammar written in GAP-L strong = sr(base,strong,weak) with basepairing sr(base,weak,base) with basepairing # h weak = hl(base,region3,base) with basepairing sr(base,bl(region,strong),base) with basepairing... ml(base,cons(block,comps),base) with basepairing # h
16 Four evaluation algebras Ans enum = T Σ enum = (str,..., h) where str(s) = Str s ss((i,j)) = Ss (i,j) hl(a,(i,j),b) = Hl a (i,j) b sr(a,s,b) = Sr a s b bl((i,j),s) = Bl (i,j) s br(s,(i,j)) = Br s (i,j) il((i,j),s,(i,j )) = Il (i,j) s (i,j ) ml(a,s,b) = Ml a s b nil((i,j)) = Nil (i,j) cons(s,s ) = Cons s s ul(s) = Ul s h([s 1,..., s r ]) = [s 1,..., s r ] Ans bpmax = IN bpmax = (str,..., h) where str(s) = s ss((i,j)) = 0 hl(a,(i,j),b) = 1 sr(a,s,b) = s + 1 bl((i,j),s) = s br(s,(i,j)) = s il((i,j),s,(i,j )) = s ml(a,s,b) = s + 1 nil((i,j)) = 0 cons(s,s ) = s + s ul(s) = s h([]) = [] h([s 1,..., s r ]) = [ max i ] 1 i r Ans pretty = dot-bracket strings pretty = (str,..., h) where str(s) = s ss((i,j)) = dots(j-i) hl(a,(i,j),b) = ( ++dots(j-i)++ ) sr(a,s,b) = ( ++s++ ) bl((i,j),s) = dots(j-i)++s br(s,(i,j)) = s++dots(j-i) il((i,j),s,(i,j )) = dots(j-i)++s++ dots(j -i ) ml(a,s,b) = ( ++s++ ) nil((i,j)) = cons(s,s ) = s++s ul(s) = s h([s 1,..., s r ]) = [s 1,..., s r ] Ans count = IN count = (str,..., h) where str(s) = s ss((i,j)) = 1 hl(a,(i,j),b) = 1 sr(a,s,b) = s bl((i,j),s) = s br(s,(i,j)) = s il((i,j),s,(i,j )) = s ml(a,s,b) = s nil((i,j)) = 1 cons(s,s ) = s * s ul(s) = s h([]) = [] h([s 1,..., s r ]) = [s 1 + Bielefeld + s r ] University
17 Remark on a simplification The shown grammar and its evaluation algebras are a little too simple for energy minimization:
18 Remark on a simplification The shown grammar and its evaluation algebras are a little too simple for energy minimization: the same funktion bl is used for attaching an unpaired region to a block in a multiloop forming a left bulge, i.e. an unpaired region left of a closed substructure the enegy model has different energy contributions for these cases You find a proper RNA folding grammar at
19 Model refinement: Dangling bases Dangling bases are a refinement of thr energy model, which is not always implemented fully in folding programs. Unpaired bases neighboring stacks can be integrated into the stack. The energy contribution can be almost as good as with another base pair....((u((...(((a((..))a)))...((b((...))b)).))u))... How many dangles?
20 Model refinement: Dangling bases Dangling bases are a refinement of thr energy model, which is not always implemented fully in folding programs. Unpaired bases neighboring stacks can be integrated into the stack. The energy contribution can be almost as good as with another base pair....((u((...(((a((..))a)))...((b((...))b)).))u))... How many dangles?...a((u((b..c(((a((..))a)))d.e((b((...))b))f))u))g... a or g dangles to U (outside) c or d dangles to A e or f dangles to B b or f dangles to U (inside) f can dangle either to B or to U ambiguous dangle Each possible dangle has a different energy contribution, the best combination must be determined.
21 The problem of dangles Dangling bases are a problem not from the thermodynamic point of view, but algorithmically: Given a concrete structure, it is easy to evaluate the best dangles and their energy contribution In structure prediction, the search space explodes when dangles/no-dangles are considered alternative structures
22 Dangling options in RNAfold Pragmatics in RNAfold: -d0: NoDangle no dangling energies -d1: Microstate all dangling alternatives considered as different structures -d2: Overdangle all possible dangles are calculated everywhere (including some impossible ones); folding energies are corrected after MFE prediction; the true MFE structure may NOT be found. We will come back to the dangle problem in the Session on probabilistic shape analysis.
23 Sneak preview Next topic: Abstract shape analysis computing a representative set of near-optimal structures
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationCombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming
ombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming Matthew Macauley Department of Mathematical Sciences lemson niversity http://www.math.clemson.edu/~macaule/ Math
More informationRNA Abstract Shape Analysis
ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationRNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev
RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC
More informationRNA Folding Algorithms. Michal Ziv-Ukelson Ben Gurion University of the Negev
RNA Folding Algorithms Michal Ziv-Ukelson Ben Gurion University of the Negev The RNA Folding Problem: Given an RNA sequence, predict its energetically most stable structure (minimal free energy). AUCCCCGUAUCGAUC
More informationRNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationCS681: Advanced Topics in Computational Biology
CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 10 Lecture 1 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ RNA folding Prediction of secondary structure
More informationThe Ensemble of RNA Structures Example: some good structures of the RNA sequence
The Ensemble of RNA Structures Example: some good structures of the RNA sequence GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCUGGUUCAAAUCCAGGUGCCCCCU free energy in kcal/mol (((((((..((((...))))...((((...))))(((((...)))))))))))).
More informationAlgebraic Dynamic Programming. Solving Satisfiability with ADP
Algebraic Dynamic Programming Session 12 Solving Satisfiability with ADP Robert Giegerich (Lecture) Stefan Janssen (Exercises) Faculty of Technology Summer 2013 http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationAlgebraic Dynamic Programming. Dynamic Programming, Old Country Style
Algebraic Dynamic Programming Session 2 Dynamic Programming, Old Country Style Robert Giegerich (Lecture) Stefan Janssen (Exercises) Faculty of Technology Summer 2013 http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationAlgebraic Dynamic Programming
Algebraic Dynamic Programming Unit 2.b: Introduction to Bellman s GAP Robert Giegerich 1 (Lecture) Benedikt Löwes (Exercises) Faculty of Technology Bielefeld University http://www.techfak.uni-bielefeld.de/ags/pi/lehre/adp
More informationBIOINF 4120 Bioinforma2cs 2 - Structures and Systems -
BIOINF 4120 Bioinforma2cs 2 - Structures and Systems - Oliver Kohlbacher Summer 2014 3. RNA Structure Part II Overview RNA Folding Free energy as a criterion Folding free energy of RNA Zuker- SCegler algorithm
More informationClassified Dynamic Programming
Bled, Feb. 2009 Motivation Our topic: Programming methodology A trade-off in dynamic programming between search space design and evaluation of candidates A trade-off between modifying your code and adding
More informationCOMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES
COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES ÉRIC FUSY AND PETER CLOTE Abstract. It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is 1.104366
More informationCONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models
Supplementary Material for CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Chuong B Do, Daniel A Woods, and Serafim Batzoglou Stanford University, Stanford, CA 94305, USA, {chuongdo,danwoods,serafim}@csstanfordedu,
More informationA tutorial on RNA folding methods and resources
A tutorial on RNA folding methods and resources Alain Denise, LRI/IGM, Université Paris-Sud with invaluable help from Yann Ponty, CNRS/Ecole Polytechnique 1 Master BIBS 2014-2015 Goals To help your work
More informationComputing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model
Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model J. Waldispühl 1,3 P. Clote 1,2, 1 Department of Biology, Higgins 355, Boston
More informationproteins are the basic building blocks and active players in the cell, and
12 RN Secondary Structure Sources for this lecture: R. Durbin, S. Eddy,. Krogh und. Mitchison, Biological sequence analysis, ambridge, 1998 J. Setubal & J. Meidanis, Introduction to computational molecular
More informationRNA Secondary Structure Prediction
RNA Secondary Structure Prediction 1 RNA structure prediction methods Base-Pair Maximization Context-Free Grammar Parsing. Free Energy Methods Covariance Models 2 The Nussinov-Jacobson Algorithm q = 9
More informationShape Based Indexing For Faster Search Of RNA Family Databases
For Faster Search Of RNA Family Databases Stefan Janssen Jens Reeder Robert Giegerich 26. April 2008 RNA homology Why? build homologous groups find new group members How? sequence & structure Covariance
More informationRNA Folding and Interaction Prediction: A Survey
RNA Folding and Interaction Prediction: A Survey Syed Ali Ahmed Graduate Center, City University of New York New York, NY November 19, 2015 Abstract The problem of computationally predicting the structure
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationNon-context-Free Languages. CS215, Lecture 5 c
Non-context-Free Languages CS215, Lecture 5 c 2007 1 The Pumping Lemma Theorem. (Pumping Lemma) Let be context-free. There exists a positive integer divided into five pieces, Proof for for each, and..
More informationSupplementary Material
Supplementary Material Sm-I Formal Description of the Sampling Process In the sequel, given an RNA molecule r consisting of n nucleotides, we denote the corresponding sequence fragment from position i
More informationComputational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters
Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters 1 Binod Kumar, Assistant Professor, Computer Sc. Dept, ISTAR, Vallabh Vidyanagar,
More informationBCB 444/544 Fall 07 Dobbs 1
BCB 444/544 Required Reading (before lecture) Lecture 25 Mon Oct 15 - Lecture 23 Protein Tertiary Structure Prediction Chp 15 - pp 214-230 More RNA Structure Wed Oct 17 & Thurs Oct 18 - Lecture 24 & Lab
More informationLecture 8: RNA folding
1/16, Lecture 8: RNA folding Hamidreza Chitsaz Colorado State University chitsaz@cs.colostate.edu Fall 2018 September 13, 2018 2/16, Nearest Neighbor Model 3/16, McCaskill s Algorithm for MFE Structure
More informationSparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction
Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction Sebastian Will 1 and Hosna Jabbari 2 1 Bioinformatics/IZBI, University Leipzig, swill@csail.mit.edu 2 Ingenuity Lab, National
More informationLecture 8: RNA folding
1/16, Lecture 8: RNA folding Hamidreza Chitsaz Colorado State University chitsaz@cs.colostate.edu Spring 2018 February 15, 2018 2/16, Nearest Neighbor Model 3/16, McCaskill s Algorithm for MFE Structure
More informationDynamic Programming (CLRS )
Dynamic Programming (CLRS.-.) Today we discuss a technique called dynamic programming. It is neither especially dynamic nor especially programming related. We will discuss dynamic programming by looking
More information13 Comparative RNA analysis
13 Comparative RNA analysis Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison, Biological sequence analysis, Cambridge, 1998 D.W. Mount. Bioinformatics: Sequences and Genome analysis,
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationComplete Suboptimal Folding of RNA and the Stability of Secondary Structures
Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA
More informationDot Bracket Notation for RNA and DNA nanostructures. Slides by Reem Mokhtar
Dot Bracket Notation for RNA and DNA nanostructures Slides by Reem Mokhtar Graphical/Data Purpose: - Ease of interaction and design - Aid in validating designs Representations might include - GUI input
More informationDynamic Programming: Matrix chain multiplication (CLRS 15.2)
Dynamic Programming: Matrix chain multiplication (CLRS.) The problem Given a sequence of matrices A, A, A,..., A n, find the best way (using the minimal number of multiplications) to compute their product.
More informationRNA Secondary Structure Prediction: taking conservation into account
RNA Secondary Structure Prediction: taking conservation into account 1 13 June 2006 2 Main approaches to RNA secondary structure prediction Energy minimization (Single-strand Folding) does not require
More informationRNA Secondary Structure Prediction
RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential
More informationComputational approaches for RNA energy parameter estimation
omputational approaches for RNA energy parameter estimation by Mirela Ştefania Andronescu M.Sc., The University of British olumbia, 2003 B.Sc., Bucharest Academy of Economic Studies, 1999 A THESIS SUBMITTED
More informationSparse RNA folding revisited: space efficient minimum free energy structure prediction
DOI 10.1186/s13015-016-0071-y Algorithms for Molecular Biology RESEARCH ARTICLE Sparse RNA folding revisited: space efficient minimum free energy structure prediction Sebastian Will 1* and Hosna Jabbari
More informationBioinformatics Advance Access published July 14, Jens Reeder, Robert Giegerich
Bioinformatics Advance Access published July 14, 2005 BIOINFORMATICS Consensus Shapes: An Alternative to the Sankoff Algorithm for RNA Consensus Structure Prediction Jens Reeder, Robert Giegerich Faculty
More informationDynamic Programming. Shuang Zhao. Microsoft Research Asia September 5, Dynamic Programming. Shuang Zhao. Outline. Introduction.
Microsoft Research Asia September 5, 2005 1 2 3 4 Section I What is? Definition is a technique for efficiently recurrence computing by storing partial results. In this slides, I will NOT use too many formal
More informationDANNY BARASH ABSTRACT
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales
More informationThe Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands
The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Joseph Schaeffer, Caltech (slides by John Reif) Entropy: Is a measure of disorder or randomness of a
More informationCharacterising RNA secondary structure space using information entropy
Characterising RNA secondary structure space using information entropy Zsuzsanna Sükösd 1,2,3, Bjarne Knudsen 4, James WJ Anderson 5, Ádám Novák 5,6, Jørgen Kjems 2,3 and Christian NS Pedersen 1,7 1 Bioinformatics
More informationPlease give details of your answer. A direct answer without explanation is not counted.
Please give details of your answer. A direct answer without explanation is not counted. Your answers must be in English. Please carefully read problem statements. During the exam you are not allowed to
More informationRNA$2 nd $structure$predic0on
RNA$2 nd $structure$predic0on Recall Nucleic Acids - RNA and DNA The carrier of genetic information - The blueprints of proteins Nucleotides Bases Adenine (A) Guanine (G) Cytosine(C) Thymine(T) Uracil
More informationRecursion: Introduction and Correctness
Recursion: Introduction and Correctness CSE21 Winter 2017, Day 7 (B00), Day 4-5 (A00) January 25, 2017 http://vlsicad.ucsd.edu/courses/cse21-w17 Today s Plan From last time: intersecting sorted lists and
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationRNA folding with hard and soft constraints
DOI 10.1186/s13015-016-0070-z Algorithms for Molecular Biology RESEARCH RNA folding with hard and soft constraints Ronny Lorenz 1*, Ivo L. Hofacker 1,2,3 and Peter F. Stadler 1,3,4,5,6,7 Open Access Abstract
More informationPure Multiple RNA Secondary Structure Alignments: A Progressive Profile Approach
IEEE TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. 1, NO. 1, JANUARY-MARCH 2004 1 Pure Multiple RNA Secondary Structure Alignments: A Progressive Profile Approach Matthias Höchsmann, Björn
More information3. Branching Algorithms
3. Branching Algorithms COMP6741: Parameterized and Exact Computation Serge Gaspers Semester 2, 2015 Contents 1 Introduction 1 2 Maximum Independent Set 3 2.1 Simple Analysis................................................
More informationPrediction of RNA secondary structure including kissing hairpin motifs
Prediction of RNA secondary structure including kissing hairpin motifs Corinna Theis, Stefan Janssen, and Robert Giegerich Faculty of Technology, Bielefeld University 33501 Bielefeld, Germany robert@techfak.uni-bielefeld.de
More information3. Branching Algorithms COMP6741: Parameterized and Exact Computation
3. Branching Algorithms COMP6741: Parameterized and Exact Computation Serge Gaspers 12 1 School of Computer Science and Engineering, UNSW Australia 2 Optimisation Resarch Group, NICTA Semester 2, 2015
More informationRNA Secondary Structure Prediction: taking conservation into account
RNA Secondary Structure Prediction: taking conservation into account 1 Assumptions of the RNA secondary structure prediction algorithm, based on MFE: 1. The most likely structure of the RNA molecule is
More informationRNA evolution and Genotype to Phenotype maps
RNA evolution and Genotype to Phenotype maps E.S. Colizzi November 8, 2018 Introduction Biological evolution occurs in a population because 1) different genomes can generate different reproductive success
More informationBIOINFORMATICS. Fast evaluation of internal loops in RNA secondary structure prediction. Abstract. Introduction
BIOINFORMATICS Fast evaluation of internal loops in RNA secondary structure prediction Abstract Motivation: Though not as abundant in known biological processes as proteins, RNA molecules serve as more
More informationCHEM-UP! D A Y The Academic Support Daytona State College (Chem-Up 3, Page 1 of 101)
CHEM-UP! D A Y 3-2013 The Academic Support Center @ Daytona State College (Chem-Up 3, Page 1 of 101) Chapter 4 Lecture Basic Chemistry Chem Up! An Introduction to Basic Chemistry Concepts Day 3 Fourth
More informationWhat is the Matrix? Linear control of finite-dimensional spaces. November 28, 2010
What is the Matrix? Linear control of finite-dimensional spaces. November 28, 2010 Scott Strong sstrong@mines.edu Colorado School of Mines What is the Matrix? p. 1/20 Overview/Keywords/References Advanced
More informationRapid Dynamic Programming Algorithms for RNA Secondary Structure
ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of
More informationFinite Automata and Formal Languages
Finite Automata and Formal Languages TMV26/DIT32 LP4 2 Lecture 6 April 5th 2 Regular expressions (RE) are an algebraic way to denote languages. Given a RE R, it defines the language L(R). Actually, they
More informationFinding Consensus Energy Folding Landscapes Between RNA Sequences
University of Central Florida Electronic Theses and Dissertations Masters Thesis (Open Access) Finding Consensus Energy Folding Landscapes Between RNA Sequences 2015 Joshua Burbridge University of Central
More informationSemi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach
Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2011 Semi-Supervised CONTRAfold for RNA Secondary Structure Prediction: A Maximum Entropy Approach Jianping
More informationAlgorithmic Aspects of RNA Secondary Structures
Algorithmic Aspects of RNA Secondary Structures Stéphane Vialette CNRS & LIGM, Université Paris-Est Marne-la-Vallée, France 214-115 S. Vialette (CNRS & LIGM) RNA Secondary Structures 214-215 1 / 124 Introduction
More informationProperties of Context-Free Languages
Properties of Context-Free Languages Seungjin Choi Department of Computer Science and Engineering Pohang University of Science and Technology 77 Cheongam-ro, Nam-gu, Pohang 37673, Korea seungjin@postech.ac.kr
More informationBIOINFORMATICS. Prediction of RNA secondary structure based on helical regions distribution
BIOINFORMATICS Prediction of RNA secondary structure based on helical regions distribution Abstract Motivation: RNAs play an important role in many biological processes and knowing their structure is important
More informationMultiple Sequence Alignment using Profile HMM
Multiple Sequence Alignment using Profile HMM. based on Chapter 5 and Section 6.5 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. students Beatrice Miron, Oana Răţoi,
More informationLecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression
C N F O N G A V B O N F O M A C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/NA Structure Prediction pigenectics pigenomics: Gene xpression ranscription factors
More informationLecture 21: The one dimensional Wave Equation: D Alembert s Solution
Introductory lecture notes on Partial Differential Equations - c Anthony Peirce. Not to be copied, used, or revised without explicit written permission from the copyright owner. 1 Lecture 21: The one dimensional
More informationProperties of context-free Languages
Properties of context-free Languages We simplify CFL s. Greibach Normal Form Chomsky Normal Form We prove pumping lemma for CFL s. We study closure properties and decision properties. Some of them remain,
More information/633 Introduction to Algorithms Lecturer: Michael Dinitz Topic: Dynamic Programming II Date: 10/12/17
601.433/633 Introduction to Algorithms Lecturer: Michael Dinitz Topic: Dynamic Programming II Date: 10/12/17 12.1 Introduction Today we re going to do a couple more examples of dynamic programming. While
More informationGrand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world
Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic
More informationCHAPTER 1. Relations. 1. Relations and Their Properties. Discussion
CHAPTER 1 Relations 1. Relations and Their Properties 1.1. Definition of a Relation. Definition 1.1.1. A binary relation from a set A to a set B is a subset R A B. If (a, b) R we say a is Related to b
More informationLewis Dot Structures. a. Duet Rule: 2 electrons needed to satisfy valence shell. i. What follows this rule? Hydrogen and Helium
1. Important points about Lewis Dot: Lewis Dot Structures a. Duet Rule: 2 electrons needed to satisfy valence shell. i. What follows this rule? Hydrogen and Helium b. Octet Rule: 8 electrons needed to
More informationSupplementary Material
Supplementary Material Sm-I Computing Inside and Outside Probabilities In order the determine all inside and outside variables for a given sequence r L r, we decided to use the SCFG G r as the basis for
More informationMoments of the Boltzmann distribution for RNA secondary structures
Bulletin of Mathematical Biology 67 (2005) 1031 1047 www.elsevier.com/locate/ybulm Moments of the Boltzmann distribution for RNA secondary structures István Miklós a, Irmtraud M. Meyer b,,borbála Nagy
More information114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009
114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 9 Protein tertiary structure Sources for this chapter, which are all recommended reading: D.W. Mount. Bioinformatics: Sequences and Genome
More informationThe Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands
The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Thesis by Joseph Malcolm Schaeffer In Partial Fulfillment of the Requirements for the Degree of Master
More informationCOMP598: Advanced Computational Biology Methods and Research
COMP598: Advanced Computational Biology Methods and Research Modeling the evolution of RNA in the sequence/structure network Jerome Waldispuhl School of Computer Science, McGill RNA world In prebiotic
More informationComputational Models
Slides modified by Benny Chor, based on original slides by Maurice Herlihy, Brown University. p. 1 Computational Models Inroduction to the Theory of Computing Instructor: Prof. Benny Chor (benny at cs
More informationThis lecture covers Chapter 7 of HMU: Properties of CFLs
This lecture covers Chapter 7 of HMU: Properties of CFLs Chomsky Normal Form Pumping Lemma for CFs Closure Properties of CFLs Decision Properties of CFLs Additional Reading: Chapter 7 of HMU. Chomsky Normal
More informationA two length scale polymer theory for RNA loop free energies and helix stacking
A two length scale polymer theory for RNA loop free energies and helix stacking Daniel P. Aalberts and Nagarajan Nandagopal Physics Department, Williams College, Williamstown, MA 01267 RNA, in press (2010).
More informationLecture Notes on Inductive Definitions
Lecture Notes on Inductive Definitions 15-312: Foundations of Programming Languages Frank Pfenning Lecture 2 September 2, 2004 These supplementary notes review the notion of an inductive definition and
More informationSA-REPC - Sequence Alignment with a Regular Expression Path Constraint
SA-REPC - Sequence Alignment with a Regular Expression Path Constraint Nimrod Milo Tamar Pinhas Michal Ziv-Ukelson Ben-Gurion University of the Negev, Be er Sheva, Israel Graduate Seminar, BGU 2010 Milo,
More informationarxiv: v3 [math.co] 17 Jan 2018
An infinite class of unsaturated rooted trees corresponding to designable RNA secondary structures arxiv:1709.08088v3 [math.co] 17 Jan 2018 Jonathan Jedwab Tara Petrie Samuel Simon 23 September 2017 (revised
More informationLab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816
More informationAlgorithmic Approach to Counting of Certain Types m-ary Partitions
Algorithmic Approach to Counting of Certain Types m-ary Partitions Valentin P. Bakoev Abstract Partitions of integers of the type m n as a sum of powers of m (the so called m-ary partitions) and their
More informationLecture 4: September 19
CSCI1810: Computational Molecular Biology Fall 2017 Lecture 4: September 19 Lecturer: Sorin Istrail Scribe: Cyrus Cousins Note: LaTeX template courtesy of UC Berkeley EECS dept. Disclaimer: These notes
More informationSupplementary Notes on Inductive Definitions
Supplementary Notes on Inductive Definitions 15-312: Foundations of Programming Languages Frank Pfenning Lecture 2 August 29, 2002 These supplementary notes review the notion of an inductive definition
More informationIntroduction to Theory of Computing
CSCI 2670, Fall 2012 Introduction to Theory of Computing Department of Computer Science University of Georgia Athens, GA 30602 Instructor: Liming Cai www.cs.uga.edu/ cai 0 Lecture Note 3 Context-Free Languages
More informationPart 1. The Review of Linear Programming
In the name of God Part 1. The Review of Linear Programming 1.2. Spring 2010 Instructor: Dr. Masoud Yaghini Outline Introduction Basic Feasible Solutions Key to the Algebra of the The Simplex Algorithm
More informationarxiv: v1 [q-bio.bm] 25 Jul 2012
CoFold: thermodynamic RNA structure prediction with a kinetic twist arxiv:1207.6013v1 [q-bio.bm] 25 Jul 2012 Jeff R. Proctor and Irmtraud M. Meyer Centre for High-Throughput Biology & Department of Computer
More informationParsing. Based on presentations from Chris Manning s course on Statistical Parsing (Stanford)
Parsing Based on presentations from Chris Manning s course on Statistical Parsing (Stanford) S N VP V NP D N John hit the ball Levels of analysis Level Morphology/Lexical POS (morpho-synactic), WSD Elements
More informationFinite Automata Theory and Formal Languages TMV027/DIT321 LP4 2018
Finite Automata Theory and Formal Languages TMV027/DIT321 LP4 2018 Lecture 14 Ana Bove May 14th 2018 Recap: Context-free Grammars Simplification of grammars: Elimination of ǫ-productions; Elimination of
More informationElementary maths for GMT
Elementary maths for GMT Linear Algebra Part 2: Matrices, Elimination and Determinant m n matrices The system of m linear equations in n variables x 1, x 2,, x n a 11 x 1 + a 12 x 2 + + a 1n x n = b 1
More informationLecture 20 : Markov Chains
CSCI 3560 Probability and Computing Instructor: Bogdan Chlebus Lecture 0 : Markov Chains We consider stochastic processes. A process represents a system that evolves through incremental changes called
More informationToday s Outline. CS 362, Lecture 13. Matrix Chain Multiplication. Paranthesizing Matrices. Matrix Multiplication. Jared Saia University of New Mexico
Today s Outline CS 362, Lecture 13 Jared Saia University of New Mexico Matrix Multiplication 1 Matrix Chain Multiplication Paranthesizing Matrices Problem: We are given a sequence of n matrices, A 1, A
More informationExtending the hypergraph analogy for RNA dynamic programming
Extending the hypergraph analogy for RN dynamic programming Yann Ponty Balaji Raman édric Saule Polytechnique/NRS/INRI MIB France Yann Ponty, Balaji Raman, édric Saule RN Folding RN = Biopolymer composed
More information