Extending the hypergraph analogy for RNA dynamic programming
|
|
- Toby Christian Beasley
- 5 years ago
- Views:
Transcription
1 Extending the hypergraph analogy for RN dynamic programming Yann Ponty Balaji Raman édric Saule Polytechnique/NRS/INRI MIB France Yann Ponty, Balaji Raman, édric Saule
2 RN Folding RN = Biopolymer composed of nucleotides,,, and : denosine, : ytosine, : uanine et : racil anonical base-pairs / / / Watson/rick Wobble RN folding = Stochastic continuous process directed by (resulting) the pairing of nucleotides. nderstanding RN folding is a key step toward understanding and predicting its function(s). Yann Ponty, Balaji Raman, édric Saule
3 RN structure(s) Three levels of representation: Primary structure Secondary structure Tertiary structures Source: 5s rrn (PDB K73:B) Well, almost... Yann Ponty, Balaji Raman, édric Saule
4 RN structure(s) Three levels of representation: Primary structure Secondary + structure Tertiary structures Source: 5s rrn (PDB K73:B) Well, almost... Yann Ponty, Balaji Raman, édric Saule
5 Discarded by secondary structure Non-canonical base-pairs ny basepair other than {(-), (-), (-)} Or interacting using a non-standard edge/orientation (W/W-is) [LW0]. / canonical pair (W/W-is) non-canonical pair (Sugar/W-Trans) Pseudoknots Pseudoknots within a group I Ribozyme (PDBID: Y0Q:) More expressive model, but ab initio folding with pseudoknots: NP-omplete [LP00]... yet polynomial for restricted classes [DR + 04]. Yann Ponty, Balaji Raman, édric Saule
6 Our objective(s) uthors omplexity uthors omplexity Lyngso and Pedersen O(n 5 ) ao and hen O(n 6 ) Reeder and iegerich O(n 4 ) Dirk and Pierce O(n 5 ) kutso and emara O(n 5 ) Rivas and Eddy O(n 6 ) hen, Jabbari and ondon O(n 5 ) Many DP algorithms proposed for folding with restricted pseudoknots. Decompositions induce high complexities and/or are ambiguous, prohibiting ensemble-based approaches: Partition function, BP prob.... Is it possible to come up with highly expressive, unambiguous decompositions? Our programme To unify DP RN algorithms into a single abstract framework. To reformulate ensemble-based applications within this framework. Improve existing algorithms by working on their decomposition at an abstract level. May benet to RN-RN interaction prediction, parameterized approaches... Yann Ponty, Balaji Raman, édric Saule
7 DP Example: Nussinov/Jacobson decomposition Nearest-neighbor model Free-energy = Weighted sum over base-pairs oal: iven RN sequence ω, nd Minimum Free Energy (MFE) secondary structure compatible with base-pairing. i j = i i+ j + θ i k j N i,t = 0, t [i, i + θ] N i+,j N i,j = min j min k=i+θ+ Eω i,ω + N k i+,k + N k+,j i non apparié i apparié à k E, = E, = 3.0 kal mol, E, = E, = 2.0 kal mol, and E, = E, =.0 kal mol. Once the minimal energy is gured out, the corresponding secondary structure is obtained through a backtrack procedure. Yann Ponty, Balaji Raman, édric Saule
8 More complex/realistic example Turner model Free-energy = Weighted sum over loops E H (i, j) M E i,j = S (i, j) + M i+,j min Min i,j (E BI (i, i, j, j) + M i,j ) a + c + Min k (M i+,k + M k,j ) { M i,j = Min k min (Mi,k, b(k )) + M } k,j M { i,j = Min k b + M i,j, c + M } i,j EH(i, j): Energy of terminal loop closed by base-pair (i, j) EBI (i, j): Energy of bulge/internal loop renement closed by bp (i, j) ES (i, j): Stacking energy (i, j)/(i +, j ) a,c,b: Penalties for multiple loops, helix and unpaired base in multiloop. Yann Ponty, Balaji Raman, édric Saule
9 Beyond minimization dditional motivation: o beyond energy minimization. urrent driving hypothesis = Boltzmann ensemble of low energy Functional folding? Ill-dened folding: mrn? Bistable RN Kinetics? Decompositions will have to be unambiguous... Yann Ponty, Balaji Raman, édric Saule
10 Dynamic programming Starting from an instance, or problem: Search space: May depend on instance Objective function: Dened on search space, may depend on instance Dynamic programming equation: Relates value of objective function for problem to that of its sub-problems (substructure property), relying on a decomposition of search space ompute obj. fun. for sub-problems (se backtrack to build solution). Nussinov example: Search space: Secondary structures inducing valid bps. Objective function: Free-energy DP equation/decomposition: MFE obtained by minimizing energy on subsequence(s) lternative view: DP equation generates search space ND implements a specic application. Detach two conceptually dierent entities. Yann Ponty, Balaji Raman, édric Saule
11 Existing DP abstract frameworks Parsing approaches Search space modeled by context-free grammar(s) (F). (Multitape)-attribute grammars (Lefebvre, Waldispühl et al): ompute and minimize score based on attribute algebra. Pros: aptures simple pseudoknots through synchronized multiple tapes. ons: Designed for optimization. Multi-tapes can be overkill for almost F. lgebraic Dynamic Programming (iegerich et al) Pros: dresses general applications thanks to an algebraic approach. ons: Pseudoknots require hacking the formalism. Other Hypergraphs (..., Roytberg/Finkelstein) Pros: Very exible. Mild inuence of order. ny F can be transformed into equivalent hypergraph. ons: No generic implementation (yet!). Yann Ponty, Balaji Raman, édric Saule
12 Existing DP abstract frameworks Parsing approaches Search space modeled by context-free grammar(s) (F). (Multitape)-attribute grammars (Lefebvre, Waldispühl et al): ompute and minimize score based on attribute algebra. Pros: aptures simple pseudoknots through synchronized multiple tapes. ons: Designed for optimization. Multi-tapes can be overkill for almost F. lgebraic Dynamic Programming (iegerich et al) Pros: dresses general applications thanks to an algebraic approach. ons: Pseudoknots require hacking the formalism. Other Hypergraphs (..., Roytberg/Finkelstein) Pros: Very exible. Mild inuence of order. ny F can be transformed into equivalent hypergraph. ons: No generic implementation (yet!). Yann Ponty, Balaji Raman, édric Saule
13 Existing DP abstract frameworks Parsing approaches Search space modeled by context-free grammar(s) (F). (Multitape)-attribute grammars (Lefebvre, Waldispühl et al): ompute and minimize score based on attribute algebra. Pros: aptures simple pseudoknots through synchronized multiple tapes. ons: Designed for optimization. Multi-tapes can be overkill for almost F. lgebraic Dynamic Programming (iegerich et al) Pros: dresses general applications thanks to an algebraic approach. ons: Pseudoknots require hacking the formalism. Other Hypergraphs (..., Roytberg/Finkelstein) Pros: Very exible. Mild inuence of order. ny F can be transformed into equivalent hypergraph. ons: No generic implementation (yet!). Yann Ponty, Balaji Raman, édric Saule
14 Hypergraphs Hypergaphs generalize directed graphs to arcs of arbitrary in/out degrees. Denition (Hypergraph) directed hypergaph H is a couple (V, E) such that: V is a set of vertices E is a set of hyperarcs e = (t(e) h(e)) such that t(e), h(e) E Forward hypergraphs, or F-graphs, are hypergraphs whose arcs have ingoing degree exactly. Yann Ponty, Balaji Raman, édric Saule
15 Hypergraphs Hypergaphs generalize directed graphs to arcs of arbitrary in/out degrees. Denition (Hypergraph) directed hypergaph H is a couple (V, E) such that: V is a set of vertices E is a set of hyperarcs e = (t(e) h(e)) such that t(e), h(e) E Forward hypergraphs, or F-graphs, are hypergraphs whose arcs have ingoing degree exactly. Yann Ponty, Balaji Raman, édric Saule
16 Weight: Score: 3 45 Weight: Score: 32 Weight: Score: 88 Weight: Score: 6 Weight: Score: F-graph ll F-paths starting from vertex 7 3 Denition (F-path) F-path is a tree having root s V, whose children are F-paths built from the outgoing vertices of some arc e = (s t) E. Remark: Vertices of out degree 0 (t = ) provide a terminal case to the above recursive denition. F-graph is independent i any arc is present at most once in each F-path. numerical value fonction π : E R can be assigned to each arc e E: Weight of a path is the product of its arcs' values Score of a path is the sum of its arcs' values Yann Ponty, Balaji Raman, édric Saule
17 Weight: Score: 3 45 Weight: Score: 32 Weight: Score: 88 Weight: Score: 6 Weight: Score: F-graph ll F-paths starting from vertex 7 3 Denition (F-path) F-path is a tree having root s V, whose children are F-paths built from the outgoing vertices of some arc e = (s t) E. Remark: Vertices of out degree 0 (t = ) provide a terminal case to the above recursive denition. F-graph is independent i any arc is present at most once in each F-path. numerical value fonction π : E R can be assigned to each arc e E: Weight of a path is the product of its arcs' values Score of a path is the sum of its arcs' values Yann Ponty, Balaji Raman, édric Saule
18 Weight: Score: 3 45 Weight: Score: 32 Weight: Score: 88 Weight: Score: 6 Weight: Score: F-graph ll F-paths starting from vertex 7 3 Denition (F-path) F-path is a tree having root s V, whose children are F-paths built from the outgoing vertices of some arc e = (s t) E. Remark: Vertices of out degree 0 (t = ) provide a terminal case to the above recursive denition. F-graph is independent i any arc is present at most once in each F-path. numerical value fonction π : E R can be assigned to each arc e E: Weight of a path is the product of its arcs' values Score of a path is the sum of its arcs' values Yann Ponty, Balaji Raman, édric Saule
19 Weight: Score: 3 45 Weight: Score: 32 Weight: Score: 88 Weight: Score: 6 Weight: Score: F-graph ll F-paths starting from vertex 7 3 Denition (F-path) F-path is a tree having root s V, whose children are F-paths built from the outgoing vertices of some arc e = (s t) E. Remark: Vertices of out degree 0 (t = ) provide a terminal case to the above recursive denition. F-graph is independent i any arc is present at most once in each F-path. numerical value fonction π : E R can be assigned to each arc e E: Weight of a path is the product of its arcs' values Score of a path is the sum of its arcs' values Yann Ponty, Balaji Raman, édric Saule
20 Basic algorithms H = (s 0, V, E, π): acyclic hypergraph s 0: Initial node π: value function Some questions naturally arise: What is the (min/max)imal score m s of an F-path starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the number n s of F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the total weight w s of all F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. m s = min e=(s t) E ( w(e) + u t m u ) s w(e) w(e ) w(e ) t t + t 2 Yann Ponty, Balaji Raman, édric Saule
21 Basic algorithms H = (s 0, V, E, π): acyclic hypergraph s 0: Initial node π: value function Some questions naturally arise: What is the (min/max)imal score m s of an F-path starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the number n s of F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the total weight w s of all F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. t n s = (s t) E u t n u s t t 2 Yann Ponty, Balaji Raman, édric Saule
22 Basic algorithms H = (s 0, V, E, π): acyclic hypergraph s 0: Initial node π: value function Some questions naturally arise: What is the (min/max)imal score m s of an F-path starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the number n s of F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. What is the total weight w s of all F-paths starting from s V? omplexities: Θ( E + V ) time/θ( V ) memory. t w s = w(e) e=(s h(e)) E s h(e) w s s w(e) w(e ) w(e ) t t 2 Yann Ponty, Balaji Raman, édric Saule
23 Denition (Weighted distribution) ssume a weighted, Boltzmann-like, distribution on the set T of F-Paths: e p P(p π) = π(e), p T. w s0 Ensemble related questions arise: How to generate a random F-path p from T w.r.t. weighted distribution? omplexities: Θ( E + V ) time/θ( V ) memory precomputation + O( p + e p h(e) ) time generation. What is the probability that a given arc be present in a random F-Path? Inside/outside algorithm. Distribution of additive features lgorithm: hoose e i = (s ti ) with probability p s,i such that: p s,i = w(e) s w t s w s Iterate the process over all ti 's. s w(e) w(e ) w(e ) t t t 2 Yann Ponty, Balaji Raman, édric Saule
24 Denition (Weighted distribution) ssume a weighted, Boltzmann-like, distribution on the set T of F-Paths: e p P(p π) = π(e), p T. w s0 Ensemble related questions arise: How to generate a random F-path p from T w.r.t. weighted distribution? omplexities: Θ( E + V ) time/θ( V ) memory precomputation + O( p + e p h(e) ) time generation. What is the probability that a given arc be present in a random F-Path? Inside/outside algorithm. Distribution of additive features Yann Ponty, Balaji Raman, édric Saule
25 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 Yann Ponty, Balaji Raman, édric Saule
26 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 Yann Ponty, Balaji Raman, édric Saule
27 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 Yann Ponty, Balaji Raman, édric Saule
28 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 Yann Ponty, Balaji Raman, édric Saule
29 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 Yann Ponty, Balaji Raman, édric Saule
30 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s s t t 2 Yann Ponty, Balaji Raman, édric Saule
31 Inside/outside algorithm F-path using a given arc e (s t ) Inside: Some F-path built from t Distinguished arc e Outside: ontext where e is used: Path p = (s 0, s,..., s ) using F-arcs (e,..., e k ) For each vertex in some h(e i )/p complete F-path by adding siblings to the vertices in p. s 0 s t t 2 If F-graph is acyclic and independent, this decomposition is complete and unambiguous, and induces the following DP equations for the cumulated probability p e of all F-paths featuring e = (s t ): bs π(e) s p e = t w s b s = s=s0 + w s0 e =(s t ) E s. t. s t π(e ) b s s t s s w s, s V Yann Ponty, Balaji Raman, édric Saule
32 Ensemble applications Denition (Weighted distribution) ssume a weighted, Boltzmann-like, distribution on the set T of F-Paths: e p P(p π) = π(e), p T. w s0 Ensemble related questions arise: How to generate a random F-path p from T w.r.t. weighted distribution? omplexities: Θ( E + V ) time/θ( V ) memory precomputation + O( p + e p h(e) ) time generation. What is the probability that a given arc be present in a random F-Path? Inside/outside algorithm omplexities: O( V + E + e E h(e) 2 )time/θ( V ) memory How to characterize the distribution of some additive features? Extraction of generalized moments Yann Ponty, Balaji Raman, édric Saule
33 Moments of a feature distribution Let T be the set of F-paths associated with a given hypergraph. Denition (Feature) feature is a function α : E R inherited additively by F-paths through α(p) = α(e) e p Example: Let us consider additive price α function over F-arcs and its associated random variable X α. Within the weighted distribution, what is the expected price of an F-path? B... the variance of the price X α of an F-path? How does the price X α correlates with the weight X π? = p T π(p) α(p) ws0 = E(X α) B = = p T π(p) α(p)2 ws0 E(X α X π) E(X α)e(x π) (E(X 2 α ) E(X α) 2 )(E(Xπ 2 ) E(Xπ)2 ) E(X α) 2 = E(X 2 α) E(X α) 2 an be expressed in term of the moments of the feature(s) distribution. How to extract them? Yann Ponty, Balaji Raman, édric Saule
34 oal: To extract the (combined) moment of an additive feature : E(X k α X α km m ) = π(p) w s0 p T m α i (p) km Diculty: Mixing additive (features) and multiplicative algebraic aspects (weighted distribution). Solution: Modify hypergraph to introduce controlled ambiguity. Denition (Feature-pointed F-graph) Let H = (s 0, V, E, π) be a weighted F-graph and α : E R some feature. The α-pointing of H is an F-graph H α = (s α 0, V α, E α, π α ) such that: Pointed versions of vertices are introduced V α := V {s α s V } New arcs are introduced to propagate a point or erase it. Propagation P α := { (s t) E s α (t,..., t α,..., t i k ) i [, k] } i= t Point erasure M α := (s t) E {(s α t)} E α := E P α M α Weight function { is extended to partially incorporate feature function π α (e π(e α ) If e P E ) := α(e ) π(e α ) Otherwise (e, M α e E α ) Yann Ponty, Balaji Raman, édric Saule
35 Example: Simple 0 (dashed) or (plain) feature function α Initial F-graph 4 Pointed F-graph π = π = π = π = 3 6 π = 4 6 π = π = 4 π = Initial F-Paths 6 nalogs in H of boxed F-path Rationale: Through pointing, each F-path p in H is duplicated p times in H ( analogs of p). Each copy features a point erasure over a dierent F-arc. The total weight, under π α, of all analogs of p is now π(p) α(p). Yann Ponty, Balaji Raman, édric Saule
36 Extracting moments Input: F-graph H = (s 0, V, E, π) oal: To extract the (higher order) moment of an additive feature : lgorithm E(X k α X α km m ) = π(p) w s0 p T pply weighted count algorithm to H w s0. m α i (p) km i= Point H repeatedly (commutative transform) H. pply weighted count algorithm to H Return w /w s0. w = p T π(p) m α i (p) km. omplexities: O ( 2 k V + e E ( h(e) + ) ( h(e) + 2)k) time O(2 k V ) memory, with k = m i= k i. Remarks: an be improved by pointing k i times in one go instead of pointing repeatedly. Without loss of generality, h(e) = 2 can be assumed (NF). i= Yann Ponty, Balaji Raman, édric Saule
37 Half time summary Message # Specic applications of Dynamic Programming could (and should) be detached from the equation, and be expressed at an abstract level. Sec. str. Nussinov Sec. str. Turner PK Dirks/Pierce Moments extraction Random generation ount Min/max score Weighted count rc probability... Message #2 Thanks to a pointing operator (formal derivative), one can extract arbitrary moments of features distribution under a weighted/boltzmann distribution. redits: Roytberg and Finkelstein for Hypergraph DP in Bioinformatics, L. Hwang for algebraic hypergraph DP, Flajolet et al for formal derivative through pointing... Let us now address the construction of suitable F-graphs... Yann Ponty, Balaji Raman, édric Saule
38 Half time summary Message # Specic applications of Dynamic Programming could (and should) be detached from the equation, and be expressed at an abstract level. Sec. str. Nussinov Sec. str. Turner PK Dirks/Pierce Hypergraph Moments extraction Random generation ount Min/max score Weighted count rc probability... Message #2 Thanks to a pointing operator (formal derivative), one can extract arbitrary moments of features distribution under a weighted/boltzmann distribution. redits: Roytberg and Finkelstein for Hypergraph DP in Bioinformatics, L. Hwang for algebraic hypergraph DP, Flajolet et al for formal derivative through pointing... Let us now address the construction of suitable F-graphs... Yann Ponty, Balaji Raman, édric Saule
39 Half time summary Message # Specic applications of Dynamic Programming could (and should) be detached from the equation, and be expressed at an abstract level. Sec. str. Nussinov Sec. str. Turner PK Dirks/Pierce Hypergraph Moments extraction Random generation ount Min/max score Weighted count rc probability... Message #2 Thanks to a pointing operator (formal derivative), one can extract arbitrary moments of features distribution under a weighted/boltzmann distribution. redits: Roytberg and Finkelstein for Hypergraph DP in Bioinformatics, L. Hwang for algebraic hypergraph DP, Flajolet et al for formal derivative through pointing... Let us now address the construction of suitable F-graphs... Yann Ponty, Balaji Raman, édric Saule
40 Mfold/nafold decomposition This decomposition is provably unambiguous and complete, and yields an F-graph that is acyclic, independent, and has Θ(n 2 ) vertices and O(n 3 ) arcs. Yann Ponty, Balaji Raman, édric Saule
41 Mfold/nafold decomposition This decomposition is provably unambiguous and complete, and yields an F-graph that is acyclic, independent, and has Θ(n 2 ) vertices and O(n 3 ) arcs. pplication lgorithm Time Memory Reference Energy minimization Min. score + π T O(n 3 ) O(n 2 ) [ZS8] Partition function Base-pairing probabilities Statistical sampling (k-samples) Moments of energy (Mean, Var.) k-th moment of additive features orrelations of additive features eneralized moments π count + e π T RT O(n 3 ) O(n 2 ) [Mc90] rc prob. + e π T RT O(n 3 ) O(n 2 ) [Mc90] Rand. gen. + e π T RT O(n 3 + k n log n) O(n 2 ) [DL03, Pon08] Moments + e π T RT O(n 3 ) O(n 2 ) [MMN05] Moments + e π T RT O(k 3.n 3 ) O(k.n 2 ) Moments + e π T RT O(n 3 ) O(n 2 ) Moments + e π T RT O(4 k.n 3 ) O(2 k.n 2 ) Yann Ponty, Balaji Raman, édric Saule
42 Basic pseudoknots (kutsu) Yann Ponty, Balaji Raman, édric Saule
43 Basic pseudoknots (kutsu) nambiguous decomposition capturing simple pseudoknots kutsu et al. yields O(n 4 )/O(n 4 ) time/memory algorithms for nearest neighbor energy model, and O(n 5 ) time/o(n 4 ) memory for Turner model. We can now answer new questions: What probability for the MFE within kutsu's class of conformations? What is the expected number of pseudoknots within a given sequence?... Yann Ponty, Balaji Raman, édric Saule
44 onclusion sing Hypergraphs, we were able to successfully detach conformation space from application. Implementation? We still have to mess with indices :( Start from F? Limited... (and already done by DP) but maybe worthy se Mathias Möhl's split types? ccount for additional parameters (RNMutants, RNBor... ) Pseudoknots gene scanning (in progress). Non-canonical motifs? Rebuild distributions from truncated moments ( Economics??) Yann Ponty, Balaji Raman, édric Saule
45 References I. ondon, B. Davy, B. Rastegari, S. Zhao, and F. Tarrant. lassifying RN pseudoknotted structures. Theoretical omputer Science, 320():3550, Y. Ding and E. Lawrence. statistical sampling algorithm for RN secondary structure prediction. Nucleic cids Res, 3(24): , R. B. Lyngsø and. N. S. Pedersen. RN pseudoknot prediction in energy-based models. Journal of omputational Biology, 7(3-4):409427, N. Leontis and E. Westhof. eometric nomenclature and classication of RN base pairs. RN, 7:49952, 200. J.S. Mcaskill. The equilibrium partition function and base pair binding probabilities for RN secondary structure. Biopolymers, 29:059, 990. István Miklós, Irmtraud M Meyer, and Borbála Nagy. Moments of the boltzmann distribution for rna secondary structures. Bull Math Biol, 67(5):03047, Sep Y. Ponty. Ecient sampling of RN secondary structures from the boltzmann ensemble of low-energy: The boustrophedon method. J Math Biol, 56(-2):0727, Jan M. Zuker and P. Stiegler. Optimal computer folding of large RN sequences using thermodynamics and auxiliary information. Nucleic cids Res, 9:3348, 98. Yann Ponty, Balaji Raman, édric Saule
46 omplexity of secondary structure folding Figure: lternative strategy for interior loops, creating the symmetric part rst and the asymmetric part afterward. Due to interior loops, the set F-arcs generated for the Q case have apparent cardinality in O(n 4 ), while we claims O(n 3 ) complexities. pragmatic answer may point out that it is common practice to upper bound the interior loop size (j j) + (i i) to a predened constant K = 30, bringing back the overall complexity to O(n 3 ). more theoretically-sound approach achieves a similar complexity while remaining exact by further decomposing internal loops into a symmetric loop followed by a fully asymmetric one, as illustrated in Figure. Such a modication introduces a new case in the decomposition and captures with l the asymmetry of the loop, but the log nature of the entropy term in the Turner model then requires a small approximation. Yann Ponty, Balaji Raman, édric Saule
Impact Of The Energy Model On The Complexity Of RNA Folding With Pseudoknots
Impact Of The Energy Model On The omplexity Of RN Folding With Pseudoknots Saad Sheikh, Rolf Backofen Yann Ponty, niversity of Florida, ainesville, S lbert Ludwigs niversity, Freiburg, ermany LIX, NRS/Ecole
More informationRNA Secondary Structure Prediction
RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential
More informationFlexible RNA design under structure and sequence constraints using a language theoretic approach
Flexible RN design under structure and sequence constraints using a language theoretic approach Yu Zhou,, Yann Ponty Stéphane Vialette Jérôme Waldispühl Yi Zhang lain Denise LRI, niv. Paris-Sud, Orsay
More informationRNA Abstract Shape Analysis
ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:
More informationTowards firm foundations for the rational design of RNA molecules
39 28 4 8 282 28 98 32 3 36 68 3 82 : (405)-43-> 43 42 4 40 8 25 37 46 26 36 24 27 E23_9 34 22 3 33 32 E23_2 2 48 o 9 Towards firm foundations for the rational design of RN molecules 47 2 E23_6 E23_ 45
More informationproteins are the basic building blocks and active players in the cell, and
12 RN Secondary Structure Sources for this lecture: R. Durbin, S. Eddy,. Krogh und. Mitchison, Biological sequence analysis, ambridge, 1998 J. Setubal & J. Meidanis, Introduction to computational molecular
More informationA Novel Statistical Model for the Secondary Structure of RNA
ISBN 978-1-8466-93-3 Proceedings of the 5th International ongress on Mathematical Biology (IMB11) Vol. 3 Nanjing, P. R. hina, June 3-5, 11 Novel Statistical Model for the Secondary Structure of RN Liu
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationThe Ensemble of RNA Structures Example: some good structures of the RNA sequence
The Ensemble of RNA Structures Example: some good structures of the RNA sequence GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCUGGUUCAAAUCCAGGUGCCCCCU free energy in kcal/mol (((((((..((((...))))...((((...))))(((((...)))))))))))).
More informationRNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi
More informationLecture 8: RNA folding
1/16, Lecture 8: RNA folding Hamidreza Chitsaz Colorado State University chitsaz@cs.colostate.edu Fall 2018 September 13, 2018 2/16, Nearest Neighbor Model 3/16, McCaskill s Algorithm for MFE Structure
More informationCombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming
ombinatorial approaches to RNA folding Part II: Energy minimization via dynamic programming Matthew Macauley Department of Mathematical Sciences lemson niversity http://www.math.clemson.edu/~macaule/ Math
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationLecture 8: RNA folding
1/16, Lecture 8: RNA folding Hamidreza Chitsaz Colorado State University chitsaz@cs.colostate.edu Spring 2018 February 15, 2018 2/16, Nearest Neighbor Model 3/16, McCaskill s Algorithm for MFE Structure
More informationConserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna.
onserved RN Structures Ivo L. Hofacker Institut for Theoretical hemistry, University Vienna http://www.tbi.univie.ac.at/~ivo/ Bled, January 2002 Energy Directed Folding Predict structures from sequence
More information98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationCS681: Advanced Topics in Computational Biology
CS681: Advanced Topics in Computational Biology Can Alkan EA224 calkan@cs.bilkent.edu.tr Week 10 Lecture 1 http://www.cs.bilkent.edu.tr/~calkan/teaching/cs681/ RNA folding Prediction of secondary structure
More informationComputational approaches for RNA energy parameter estimation
omputational approaches for RNA energy parameter estimation by Mirela Ştefania Andronescu M.Sc., The University of British olumbia, 2003 B.Sc., Bucharest Academy of Economic Studies, 1999 A THESIS SUBMITTED
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationof all secondary structures of k-point mutants of a is an RNA sequence s = s 1,..., s n obtained by mutating
BIOINFORMICS Vol. 00 no. 00 2005 Pages 1 10 Energy landscape of k-point mutants of an RN molecule P. Clote 1,2, J. Waldispühl 1,3,4,, B. Behzadi 3, J.-M. Steyaert 3, 1 Department of Biology, Higgins 355,
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationRNA Structure Prediction and Comparison. RNA folding
RNA Structure Prediction and Comparison Session 3 RNA folding Faculty of Technology robert@techfak.uni-bielefeld.de Bielefeld, WS 2013/2014 Base Pair Maximization This was the first structure prediction
More informationClassified Dynamic Programming
Bled, Feb. 2009 Motivation Our topic: Programming methodology A trade-off in dynamic programming between search space design and evaluation of candidates A trade-off between modifying your code and adding
More informationRNA Folding and Interaction Prediction: A Survey
RNA Folding and Interaction Prediction: A Survey Syed Ali Ahmed Graduate Center, City University of New York New York, NY November 19, 2015 Abstract The problem of computationally predicting the structure
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationA Method for Aligning RNA Secondary Structures
Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN
More informationLocal Alignment of RNA Sequences with Arbitrary Scoring Schemes
Local Alignment of RNA Sequences with Arbitrary Scoring Schemes Rolf Backofen 1, Danny Hermelin 2, ad M. Landau 2,3, and Oren Weimann 4 1 Institute of omputer Science, Albert-Ludwigs niversität Freiburg,
More informationQuantitative modeling of RNA single-molecule experiments. Ralf Bundschuh Department of Physics, Ohio State University
Quantitative modeling of RN single-molecule experiments Ralf Bundschuh Department of Physics, Ohio State niversity ollaborators: lrich erland, LM München Terence Hwa, San Diego Outline: Single-molecule
More informationBIOINFORMATICS. Fast evaluation of internal loops in RNA secondary structure prediction. Abstract. Introduction
BIOINFORMATICS Fast evaluation of internal loops in RNA secondary structure prediction Abstract Motivation: Though not as abundant in known biological processes as proteins, RNA molecules serve as more
More informationStructure-Based Comparison of Biomolecules
Structure-Based Comparison of Biomolecules Benedikt Christoph Wolters Seminar Bioinformatics Algorithms RWTH AACHEN 07/17/2015 Outline 1 Introduction and Motivation Protein Structure Hierarchy Protein
More informationCOMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES
COMBINATORICS OF LOCALLY OPTIMAL RNA SECONDARY STRUCTURES ÉRIC FUSY AND PETER CLOTE Abstract. It is a classical result of Stein and Waterman that the asymptotic number of RNA secondary structures is 1.104366
More informationComputational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters
Computational Approaches for determination of Most Probable RNA Secondary Structure Using Different Thermodynamics Parameters 1 Binod Kumar, Assistant Professor, Computer Sc. Dept, ISTAR, Vallabh Vidyanagar,
More informationSparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction
Sparse RNA Folding Revisited: Space-Efficient Minimum Free Energy Prediction Sebastian Will 1 and Hosna Jabbari 2 1 Bioinformatics/IZBI, University Leipzig, swill@csail.mit.edu 2 Ingenuity Lab, National
More informationThe Double Helix. CSE 417: Algorithms and Computational Complexity! The Central Dogma of Molecular Biology! DNA! RNA! Protein! Protein!
The Double Helix SE 417: lgorithms and omputational omplexity! Winter 29! W. L. Ruzzo! Dynamic Programming, II" RN Folding! http://www.rcsb.org/pdb/explore.do?structureid=1t! Los lamos Science The entral
More informationCONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models
Supplementary Material for CONTRAfold: RNA Secondary Structure Prediction without Physics-Based Models Chuong B Do, Daniel A Woods, and Serafim Batzoglou Stanford University, Stanford, CA 94305, USA, {chuongdo,danwoods,serafim}@csstanfordedu,
More informationMoments of the Boltzmann distribution for RNA secondary structures
Bulletin of Mathematical Biology 67 (2005) 1031 1047 www.elsevier.com/locate/ybulm Moments of the Boltzmann distribution for RNA secondary structures István Miklós a, Irmtraud M. Meyer b,,borbála Nagy
More informationComputational RNA Secondary Structure Design:
omputational RN Secondary Structure Design: Empirical omplexity and Improved Methods by Rosalía guirre-hernández B.Sc., niversidad Nacional utónoma de México, 996 M. Eng., niversidad Nacional utónoma de
More informationA tutorial on RNA folding methods and resources
A tutorial on RNA folding methods and resources Alain Denise, LRI/IGM, Université Paris-Sud with invaluable help from Yann Ponty, CNRS/Ecole Polytechnique 1 Master BIBS 2014-2015 Goals To help your work
More informationLecture 12. DNA/RNA Structure Prediction. Epigenectics Epigenomics: Gene Expression
C N F O N G A V B O N F O M A C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/NA Structure Prediction pigenectics pigenomics: Gene xpression ranscription factors
More informationSparse RNA folding revisited: space efficient minimum free energy structure prediction
DOI 10.1186/s13015-016-0071-y Algorithms for Molecular Biology RESEARCH ARTICLE Sparse RNA folding revisited: space efficient minimum free energy structure prediction Sebastian Will 1* and Hosna Jabbari
More informationJunction-Explorer Help File
Junction-Explorer Help File Dongrong Wen, Christian Laing, Jason T. L. Wang and Tamar Schlick Overview RNA junctions are important structural elements of three or more helices in the organization of the
More informationLab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816
More informationarxiv: v1 [q-bio.bm] 16 Aug 2015
Asymptotic connectivity for the network of RNA secondary structures. Clote arxiv:1508.03815v1 [q-bio.bm] 16 Aug 2015 Biology Department, Boston College, Chestnut Hill, MA 02467, clote@bc.edu Abstract Given
More informationRNA folding with hard and soft constraints
DOI 10.1186/s13015-016-0070-z Algorithms for Molecular Biology RESEARCH RNA folding with hard and soft constraints Ronny Lorenz 1*, Ivo L. Hofacker 1,2,3 and Peter F. Stadler 1,3,4,5,6,7 Open Access Abstract
More informationarxiv: v3 [math.co] 17 Jan 2018
An infinite class of unsaturated rooted trees corresponding to designable RNA secondary structures arxiv:1709.08088v3 [math.co] 17 Jan 2018 Jonathan Jedwab Tara Petrie Samuel Simon 23 September 2017 (revised
More informationComputational and physical models of RNA structure
omputational and physical models of RN structure Ralf Bundschuh Ohio State niversity July 25, 2007 Ralf Bundschuh (Ohio State niversity) Modelling RN structure July 25, 2007 1 / 98 Outline of all lectures
More informationLecture 7: Dynamic Programming I: Optimal BSTs
5-750: Graduate Algorithms February, 06 Lecture 7: Dynamic Programming I: Optimal BSTs Lecturer: David Witmer Scribes: Ellango Jothimurugesan, Ziqiang Feng Overview The basic idea of dynamic programming
More informationInference in Graphical Models Variable Elimination and Message Passing Algorithm
Inference in Graphical Models Variable Elimination and Message Passing lgorithm Le Song Machine Learning II: dvanced Topics SE 8803ML, Spring 2012 onditional Independence ssumptions Local Markov ssumption
More informationComputing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model
Computing the partition function and sampling for saturated secondary structures of RNA, with respect to the Turner energy model J. Waldispühl 1,3 P. Clote 1,2, 1 Department of Biology, Higgins 355, Boston
More informationNotes on MapReduce Algorithms
Notes on MapReduce Algorithms Barna Saha 1 Finding Minimum Spanning Tree of a Dense Graph in MapReduce We are given a graph G = (V, E) on V = N vertices and E = m N 1+c edges for some constant c > 0. Our
More informationSearch and Lookahead. Bernhard Nebel, Julien Hué, and Stefan Wölfl. June 4/6, 2012
Search and Lookahead Bernhard Nebel, Julien Hué, and Stefan Wölfl Albert-Ludwigs-Universität Freiburg June 4/6, 2012 Search and Lookahead Enforcing consistency is one way of solving constraint networks:
More informationOn the Sizes of Decision Diagrams Representing the Set of All Parse Trees of a Context-free Grammar
Proceedings of Machine Learning Research vol 73:153-164, 2017 AMBN 2017 On the Sizes of Decision Diagrams Representing the Set of All Parse Trees of a Context-free Grammar Kei Amii Kyoto University Kyoto
More informationOn low energy barrier folding pathways for nucleic acid sequences
On low energy barrier folding pathways for nucleic acid sequences Leigh-Anne Mathieson and Anne Condon U. British Columbia, Department of Computer Science, Vancouver, BC, Canada Abstract. Secondary structure
More informationRNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology"
RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology" Day 1" Many biologically interesting roles for RNA" RNA secondary structure prediction" 3 4 Approaches to Structure
More informationComplete Suboptimal Folding of RNA and the Stability of Secondary Structures
Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA
More informationDYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES
DYNAMIC PROGRAMMING ALGORITHMS FOR RNA STRUCTURE PREDICTION WITH BINDING SITES UNYANEE POOLSAP, YUKI KATO, TATSUYA AKUTSU Bioinformatics Center, Institute for Chemical Research, Kyoto University, Gokasho,
More informationComplexity Theory VU , SS The Polynomial Hierarchy. Reinhard Pichler
Complexity Theory Complexity Theory VU 181.142, SS 2018 6. The Polynomial Hierarchy Reinhard Pichler Institut für Informationssysteme Arbeitsbereich DBAI Technische Universität Wien 15 May, 2018 Reinhard
More informationOutline. Complexity Theory EXACT TSP. The Class DP. Definition. Problem EXACT TSP. Complexity of EXACT TSP. Proposition VU 181.
Complexity Theory Complexity Theory Outline Complexity Theory VU 181.142, SS 2018 6. The Polynomial Hierarchy Reinhard Pichler Institut für Informationssysteme Arbeitsbereich DBAI Technische Universität
More informationSupplementary Material
Supplementary Material Sm-I Formal Description of the Sampling Process In the sequel, given an RNA molecule r consisting of n nucleotides, we denote the corresponding sequence fragment from position i
More informationCSE 417T: Introduction to Machine Learning. Final Review. Henry Chai 12/4/18
CSE 417T: Introduction to Machine Learning Final Review Henry Chai 12/4/18 Overfitting Overfitting is fitting the training data more than is warranted Fitting noise rather than signal 2 Estimating! "#$
More informationProbabilistic Model Checking Michaelmas Term Dr. Dave Parker. Department of Computer Science University of Oxford
Probabilistic Model Checking Michaelmas Term 20 Dr. Dave Parker Department of Computer Science University of Oxford Overview PCTL for MDPs syntax, semantics, examples PCTL model checking next, bounded
More informationCFG PSA Algorithm. Sequence Alignment Guided By Common Motifs Described By Context Free Grammars
FG PS lgorithm Sequence lignment Guided By ommon Motifs Described By ontext Free Grammars motivation Find motifs- conserved regions that indicate a biological function or signature. Other algorithm do
More informationRapid Dynamic Programming Algorithms for RNA Secondary Structure
ADVANCES IN APPLIED MATHEMATICS 7,455-464 I f Rapid Dynamic Programming Algorithms for RNA Secondary Structure MICHAEL S. WATERMAN* Depurtments of Muthemutics und of Biologicul Sciences, Universitk of
More informationBIOINFORMATICS. Prediction of RNA secondary structure based on helical regions distribution
BIOINFORMATICS Prediction of RNA secondary structure based on helical regions distribution Abstract Motivation: RNAs play an important role in many biological processes and knowing their structure is important
More informationRNAscClust clustering RNAs using structure conservation and graph-based motifs
RNsclust clustering RNs using structure conservation and graph-based motifs Milad Miladi 1 lexander Junge 2 miladim@informatikuni-freiburgde ajunge@rthdk 1 Bioinformatics roup, niversity of Freiburg 2
More informationComputer Science & Engineering 423/823 Design and Analysis of Algorithms
Computer Science & Engineering 423/823 Design and Analysis of Algorithms Lecture 03 Dynamic Programming (Chapter 15) Stephen Scott and Vinodchandran N. Variyam sscott@cse.unl.edu 1/44 Introduction Dynamic
More informationChapter 1. A Method to Predict the 3D Structure of an RNA Scaffold. Xiaojun Xu and Shi-Jie Chen. Abstract. 1 Introduction
Chapter 1 Abstract The ever increasing discoveries of noncoding RNA functions draw a strong demand for RNA structure determination from the sequence. In recently years, computational studies for RNA structures,
More informationGrand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world
Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic
More informationThis lecture covers Chapter 5 of HMU: Context-free Grammars
This lecture covers Chapter 5 of HMU: Context-free rammars (Context-free) rammars (Leftmost and Rightmost) Derivations Parse Trees An quivalence between Derivations and Parse Trees Ambiguity in rammars
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationChapter 11. Approximation Algorithms. Slides by Kevin Wayne Pearson-Addison Wesley. All rights reserved.
Chapter 11 Approximation Algorithms Slides by Kevin Wayne. Copyright @ 2005 Pearson-Addison Wesley. All rights reserved. 1 Approximation Algorithms Q. Suppose I need to solve an NP-hard problem. What should
More informationFeature selection. c Victor Kitov August Summer school on Machine Learning in High Energy Physics in partnership with
Feature selection c Victor Kitov v.v.kitov@yandex.ru Summer school on Machine Learning in High Energy Physics in partnership with August 2015 1/38 Feature selection Feature selection is a process of selecting
More informationLocal Probability Models
Readings: K&F 3.4, 5.~5.5 Local Probability Models Lecture 3 pr 4, 2 SE 55, Statistical Methods, Spring 2 Instructor: Su-In Lee University of Washington, Seattle Outline Last time onditional parameterization
More informationLoopy Belief Propagation for Bipartite Maximum Weight b-matching
Loopy Belief Propagation for Bipartite Maximum Weight b-matching Bert Huang and Tony Jebara Computer Science Department Columbia University New York, NY 10027 Outline 1. Bipartite Weighted b-matching 2.
More informationarxiv: v1 [q-bio.bm] 21 Oct 2010
TT2NE: A novel algorithm to predict RNA secondary structures with pseudoknots Michaël Bon and Henri Orland Institut de Physique Théorique, CEA Saclay, CNRS URA 2306, arxiv:1010.4490v1 [q-bio.bm] 21 Oct
More informationLOCAL SEQUENCE-STRUCTURE MOTIFS IN RNA
Journal of Bioinformatics and omputational Biology c Imperial ollege Press LOL SEQENE-STRTRE MOTIFS IN RN ROLF BKOFEN and SEBSTIN WILL hair for Bioinformatics at the Institute of omputer Science, Friedrich-Schiller-niversitaet
More informationDANNY BARASH ABSTRACT
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales
More informationThe Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands
The Multistrand Simulator: Stochastic Simulation of the Kinetics of Multiple Interacting DNA Strands Joseph Schaeffer, Caltech (slides by John Reif) Entropy: Is a measure of disorder or randomness of a
More informationComputer Science & Engineering 423/823 Design and Analysis of Algorithms
Computer Science & Engineering 423/823 Design and Analysis of s Lecture 09 Dynamic Programming (Chapter 15) Stephen Scott (Adapted from Vinodchandran N. Variyam) 1 / 41 Spring 2010 Dynamic programming
More informationNotes. Relations. Introduction. Notes. Relations. Notes. Definition. Example. Slides by Christopher M. Bourke Instructor: Berthe Y.
Relations Slides by Christopher M. Bourke Instructor: Berthe Y. Choueiry Spring 2006 Computer Science & Engineering 235 Introduction to Discrete Mathematics Sections 7.1, 7.3 7.5 of Rosen cse235@cse.unl.edu
More informationDisconnecting Networks via Node Deletions
1 / 27 Disconnecting Networks via Node Deletions Exact Interdiction Models and Algorithms Siqian Shen 1 J. Cole Smith 2 R. Goli 2 1 IOE, University of Michigan 2 ISE, University of Florida 2012 INFORMS
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationDynamic Programming. Weighted Interval Scheduling. Algorithmic Paradigms. Dynamic Programming
lgorithmic Paradigms Dynamic Programming reed Build up a solution incrementally, myopically optimizing some local criterion Divide-and-conquer Break up a problem into two sub-problems, solve each sub-problem
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationA fast algorithm to generate necklaces with xed content
Theoretical Computer Science 301 (003) 477 489 www.elsevier.com/locate/tcs Note A fast algorithm to generate necklaces with xed content Joe Sawada 1 Department of Computer Science, University of Toronto,
More informationPhylogenetic Networks, Trees, and Clusters
Phylogenetic Networks, Trees, and Clusters Luay Nakhleh 1 and Li-San Wang 2 1 Department of Computer Science Rice University Houston, TX 77005, USA nakhleh@cs.rice.edu 2 Department of Biology University
More informationSome hierarchies for the communication complexity measures of cooperating grammar systems
Some hierarchies for the communication complexity measures of cooperating grammar systems Juraj Hromkovic 1, Jarkko Kari 2, Lila Kari 2 June 14, 2010 Abstract We investigate here the descriptional and
More informationMasterarbeit. Titel der Masterarbeit. Computational Refinement of SHAPE RNA probing Experiments. verfasst von. Roman Wilhelm Ochsenreiter, BSc
Masterarbeit Titel der Masterarbeit omputational Refinement of SHPE RN probing Experiments verfasst von Roman Wilhelm Ochsenreiter, BSc angestrebter akademischer rad Master of Science (MSc) Wien, 2015
More informationMotif Prediction in Amino Acid Interaction Networks
Motif Prediction in Amino Acid Interaction Networks Omar GACI and Stefan BALEV Abstract In this paper we represent a protein as a graph where the vertices are amino acids and the edges are interactions
More informationOutline. Complexity Theory. Example. Sketch of a log-space TM for palindromes. Log-space computations. Example VU , SS 2018
Complexity Theory Complexity Theory Outline Complexity Theory VU 181.142, SS 2018 3. Logarithmic Space Reinhard Pichler Institute of Logic and Computation DBAI Group TU Wien 3. Logarithmic Space 3.1 Computational
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationCDA6530: Performance Models of Computers and Networks. Chapter 3: Review of Practical Stochastic Processes
CDA6530: Performance Models of Computers and Networks Chapter 3: Review of Practical Stochastic Processes Definition Stochastic process X = {X(t), t2 T} is a collection of random variables (rvs); one rv
More informationGRAPH ALGORITHMS Week 7 (13 Nov - 18 Nov 2017)
GRAPH ALGORITHMS Week 7 (13 Nov - 18 Nov 2017) C. Croitoru croitoru@info.uaic.ro FII November 12, 2017 1 / 33 OUTLINE Matchings Analytical Formulation of the Maximum Matching Problem Perfect Matchings
More informationA Generalization of Wigner s Law
A Generalization of Wigner s Law Inna Zakharevich June 2, 2005 Abstract We present a generalization of Wigner s semicircle law: we consider a sequence of probability distributions (p, p 2,... ), with mean
More informationChapter 6. Properties of Regular Languages
Chapter 6 Properties of Regular Languages Regular Sets and Languages Claim(1). The family of languages accepted by FSAs consists of precisely the regular sets over a given alphabet. Every regular set is
More informationRelations Graphical View
Introduction Relations Computer Science & Engineering 235: Discrete Mathematics Christopher M. Bourke cbourke@cse.unl.edu Recall that a relation between elements of two sets is a subset of their Cartesian
More informationProbabilistic Graphical Models
Probabilistic Graphical Models Brown University CSCI 2950-P, Spring 2013 Prof. Erik Sudderth Lecture 12: Gaussian Belief Propagation, State Space Models and Kalman Filters Guest Kalman Filter Lecture by
More informationSoft Inference and Posterior Marginals. September 19, 2013
Soft Inference and Posterior Marginals September 19, 2013 Soft vs. Hard Inference Hard inference Give me a single solution Viterbi algorithm Maximum spanning tree (Chu-Liu-Edmonds alg.) Soft inference
More informationBackground: comparative genomics. Sequence similarity. Homologs. Similarity vs homology (2) Similarity vs homology. Sequence Alignment (chapter 6)
Sequence lignment (chapter ) he biological problem lobal alignment Local alignment Multiple alignment Background: comparative genomics Basic question in biology: what properties are shared among organisms?
More informationOn Finding Subpaths With High Demand
Zuse Institute Berlin Takustr. 7 14195 Berlin Germany STEPHAN SCHWARTZ, LEONARDO BALESTRIERI, RALF BORNDÖRFER On Finding Subpaths With High Demand ZIB Report 18-27 (Juni 2018) Zuse Institute Berlin Takustr.
More information