Shape Based Indexing For Faster Search Of RNA Family Databases

Transcription

1 For Faster Search Of RNA Family Databases Stefan Janssen Jens Reeder Robert Giegerich 26. April 2008

2 RNA homology Why? build homologous groups find new group members How? sequence & structure

3 Covariance Models used in Rfam sequence & structure analog to HMMs base pairing expensive runtime: O ( N 4), N = sequence length R = #families (607 in Rfam) One query against Rfam = O ( R N 4) 20 min.

4 Abstract shapes approach thermodynamical folding + abstraction many levels of abstraction ignore primary sequence homologue = share a common shape shapes are composed of: [ ]

5 Shape based filter families represented by shapes store shapes in a data structure calculate shape for query string use query shape to search for correct family fast: O ( N 3) Problems: several families share same shape several shapes within one family sometimes sequence matters...

6 Abstract shapes approach Arrangement of helices adjacency embedding As trees adjacency = sibling nodes embedding = parent - child relation

7 Tree representation

8 Tree representation HL Hairpin-Loop: C UAGC G

9 Tree representation IL HL Internal loop: A G x G U

10 Tree representation IL HL three stacked regions: C x G and G x C and U x A

11 Tree representation SS SS E IL HL Single stranded regions CC and A + adjacency

12 Primary sequence SS SS E IL HL primary sequence: CCCGUAGCUAGCGGUACGA

13 Shape string: [[ ]] SS SS E IL HL [ ] HL base left, region, base right = [ ]

14 Shape string: [[ ]] SS SS E IL [ ] [] IL base left, region left, structure, region right, base right = [ + +structure + + ]

15 Shape string: [[ ]] SS SS E [[]] base left, structure, base right = structure

16 Shape string: [[ ]] SS [[]] SS E SS region = E = ɛ

17 Shape string: [[ ]] [[]] structure left, structure right = [ structure left + +structure right ]

18 General workflow of an 1 compute family shape spectrum fss (f ), f Rfam 2 merge all fss (f ) into a suitable data structure I Rfam 3 compute a query shape spectrum qss (x), for a given query x 4 access I Rfam to determine the match set: M(x) = {f qss(x) fss(f ) } 5 if M(x) = end, otherwise execute cmsearch f (x) f M(x)

19 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} f = family, x = sequence, π(x) = shape

20 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} f = family, x = sequence, π(x) = shape

21 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} 3 1-Hybrid-shape-index: fss(f ) = {fss(f ) Consensus fss(f ) SS cons } f = family, x = sequence, π(x) = shape

22 Family shape spectra fss (f ) Union-shape-index: fss(f ) = {π (rnafold C (SS cons, x)) x f } f = family, x = sequence, π(x) = shape

23 Family shape spectra fss (f ) 1 1-SS cons-shape-index: fss(f ) = {π(ss cons)} 2 1-Consensus-shape-index: fss(f ) = rankmin{ x f RNAshapes(0, π, x)} 3 1-Hybrid-shape-index: fss(f ) = {fss(f ) Consensus fss(f ) SS cons } 4 Union-shape-index: fss(f ) = {π (rnafold C (SS cons, x)) x f } 5 k-best-shape-index: fss(f ) = x f RNAshapes(k, π, x) f = family, x = sequence, π(x) = shape

24 Query shape spectra qss (x) 1 1-shape-spectrum: qss(x) = RNAshapes(1, π, x) 2 k-best-shape-spectrum: qss(x) = RNAshapes(k, π, x) f = family, x = sequence, π(x) = shape

25 Further Improvements 1 Multilevel Abstraction [_[_[_]]_[_[_]_]]_ [[_[]][_[]_]] [[[]][[]]] [[][[]]] [[][]]

26 Further Improvements 1 Multilevel Abstraction 2 Using folding energies Coronavirus packaging signal (RF00182) UnaL2 LINE 3' element (RF00436) Hepatitis C virus stem-loop VII (RF00468) common shape for all sequences: single hairpin = [] number of sequences GC = 0.57 GC = 0.55 GC = length normalized energies

27 Further Improvements 1 Multilevel Abstraction 2 Using folding energies 3 Omitting difficult families

28 k-best-shape-index 1-SS_cons-shape-index 1-consensus-shape-index 1-hybrid-shape-index 1-union-shape-index 1-RNAalifold-shape-index k-rnalishapes-shape-index cmsearch --hmmfilter

29 Thanks for your attention is available at:

30 CGUCUUAAACUCAUCACCGUGUGGAGCUGCGACCCUUCCCUAGAUUCGAAGACGAG ((((((...(((..(((...))))))...(((..((...))..))))))))).. Shape Type 5: [[][]] Shape Type 4: [[][[]]] Shape Type 3: [[[]][[]]] Shape Type 2: [[ []][ [] ]] Shape Type 1: [ [ [ ]] [ [ ] ]] 20 C U G U G G A G G C* A* C* C* U* * C U A 10 C C 30 A * U G U G C * C * G C A A C U U C * * A G A U C C U 40 A 50 A U* A U* G C* A U* C 56 G* 1 G A C * G 1

31

32 [[[[]]]][[[]]] [[][]][][] [[[]][[[]]]] [[][[][]]] 53,116 more shapes 12,156 more shapes [][[[[]]]] [] _[_[_[]]]_ >Query: hg17_ct_rnazset190_s5031 _[_[_[_[_[]]_[_[]_]_]_]_]_[] [_[_[_[_[]]_[_[]_]_]_]_]_[] _[_[_[_[_[]]_[_[]_]]_]_]_[]_ [_[_[[_[]][_[]_]]_]_][] [[_[_[[_[]][_[]_]]_]_][]] [_[]_][_[_[[_[]_][]]_]_] [[[[[]][[]]]]][] [[[[[[]][[]]]]][]] [[]][[[[[]][]]]] 112,489 more shapes [[[_[_[]_]_]_]_] [_[[_[[]_]_]_]]_ [_[_[_[]_]_]_][_[_[]_]] 93,840 more shapes [[_[_[[_[]][_[]_]]_]_][]] [_[]_][_[_[[_[]_][]]_]_] [[[[[]][[]]]]][] 59,337 more shapes [[[[[[]][[]]]]][]] [[]][[[[[]][]]]]

33 cmsearch HMM-filter BLAST-filter

34