Harmonic Regression in the Biological Setting. Michael Gaffney, Ph.D., Pfizer Inc
|
|
- Jemima McKenzie
- 6 years ago
- Views:
Transcription
1 Harmonic Regression in the Biological Setting Michael Gaffney, Ph.D., Pfizer Inc
2 Two primary aims of harmonic regression 1. To describe the timing (phase) or degree of the diurnal variation (amplitude) of a physiological variable, e.g., blood pressure the amplitude of mean data underestimates the true amplitude unless all subjects are in phase 2. To analyze the treatment effect over a specific time period such as 24 hours in the presence of diurnal variability. harmonic regression analysis yields specific hypotheses that relate directly to the treatment effect over 24 hours.
3 Two Harmonic Model R it = M i + A 1i Cos (2π t / 24 T 1i ) + A 2i Cos (2π t / 12 T 2i ) R it is the response variable for the subject i at hour t t = 1,,24 M i is the 24 hour mean rate for subject i A 1i and T 1i are the amplitude and peak time of the 24 hour harmonic A 2i and T 2i are the amplitude and peak time of the 12 hour harmonic
4 Fourier Coefficients 1. R it = M i + A 1i Cos (2π t / 24 T 1i ) + A 2i Cos (2π t / 12 T 2i ) An alternative representation is 2. R it = M i + a 1i Cos (2π t / 24 ) + b 1i Sin (2π t / 24 ) + a 2i Cos (2π t / 12 ) + b 2i Sin (2π t / 12 ) Where, a 1i = A 1i Cos T 1i and b 1i = A 1i Sin T 1i Consequently, A 1i = ( a 1i2 + b 1i2 ) ½ and T 1i = arc tan (b 1i / a 1i )
5 Diurnal Rhythm of Mean Systolic BP in 41 Subjects
6 Distribution of Peak Times Hour Systolic BP N % % % % % 41
7 Diurnal Rhythm of Systolic BP in 6 Individual Subjects
8 Peak-trough difference Subject Estimated* Observed** Avg The estimated peak-trough difference of the hourly means is 20 mmhg.
9 Mean of individual subject amplitudes compared to amplitudes of mean hourly measurements Peak-trough difference A1 A2 Estimated Observed S M S M S M Systolic BP
10 Conclusions Mean of the Fourier coefficients = Fourier coefficients of the mean data but Mean of the transformed Fourier coefficients transformed Fourier coefficients of the mean data Diurnal rhythm of mean data does not adequately describe the diurnal rhythm of individual patients because individual patient harmonics are not in phase. - Amplitude of mean data underestimates the mean of the amplitudes - Timing of the diurnal rhythm of the mean data does not represent the timing of the diurnal rhythm of individual subjects There is no average diurnal curve when subjects are not in phase
11 Treatment Effect over 24 Hours The UUI rates at hour t for 3 baseline days were averaged to obtain the baseline UUI rate at hour t The UUI rates at hour t for 3 on-treatment days were averaged to obtain the treatment UUI rate at hour t The 5-hour moving average UUI rate at hour t was obtained by ( U t-2 + U t-1 + U t + U t+1 + U t+2 ) / 5
12
13
14
15
16 Properties of Moving Average The moving average transformation improves the harmonic fit of the data. The moving average is a high frequency filter that will filter out noise and result in a better estimation of low-frequency amplitudes. The amplitude is reduced after applying a moving average. The peak time is not affected by the moving average transformation. With respect to inferences regarding treatment effects, the moving average transformation has no effect because the standard deviation of the amplitude is reduced proportionally.
17 Example: 3-hour Moving Average X t = ( X t-1 + X t + X t+1 ) / 3 is the subject s transformed measurement at hour t X t = a cos 2π t / 24 + b sin 2π t / 24 Order time from the peak time for each subject, i.e., peak time is 0 for each subject. The harmonic regression on the 3-hour moving average is identical to the average of the original harmonic regression and the harmonic regressions with a time shift of hour Time shift 0: a= A b = 0 Time shift 1: Tan 15 o = b* / a* therefore, [ (a*) 2 + (a*tan 15 o ) 2 ] ½ = a a* = a / (1 + Tan 2 15 o ) ½ Therefore the amplitude of the 3-hour moving average data is: A [ / (1 + Tan 2 15 o ) ½ ] / 3
18 Mean Baseline, Treatment and Change in Amplitudes for UUI rate - 5 Hour Moving Average Placebo Active (N=416) (N=443) Variable Mean SD Mean SD Mean (B) Mean (T) C (p<0.0001) A 1 (B) A 1 (T) C (p<0.0001) A 2 (B) A 2 (T) C (p=0.001)
19
20
21
22 Change from baseline in UUI Rate by Peak time Placebo High Dose Peak Time (peak hour hours) (p<0.0001) Off-Peak (p<0.0001)
Accounting for Baseline Observations in Randomized Clinical Trials
Accounting for Baseline Observations in Randomized Clinical Trials Scott S Emerson, MD, PhD Department of Biostatistics, University of Washington, Seattle, WA 9895, USA October 6, 0 Abstract In clinical
More informationAccounting for Baseline Observations in Randomized Clinical Trials
Accounting for Baseline Observations in Randomized Clinical Trials Scott S Emerson, MD, PhD Department of Biostatistics, University of Washington, Seattle, WA 9895, USA August 5, 0 Abstract In clinical
More informationUnit 5 PreCalculus Review
Class: Date: Unit 5 PreCalculus Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Find the terminal point P (x, y) on the unit circle determined by
More informationÊ 7, 45 Ê 7 Ë 7 Ë. Time: 100 minutes. Name: Class: Date:
Class: Date: Time: 100 minutes Test1 (100 Trigonometry) Instructor: Koshal Dahal SHOW ALL WORK, EVEN FOR MULTIPLE CHOICE QUESTIONS, TO RECEIVE FULL CREDIT. 1. Find the terminal point P (x, y) on the unit
More informationCorrelation and Simple Linear Regression
Correlation and Simple Linear Regression Sasivimol Rattanasiri, Ph.D Section for Clinical Epidemiology and Biostatistics Ramathibodi Hospital, Mahidol University E-mail: sasivimol.rat@mahidol.ac.th 1 Outline
More informationBiostatistics 4: Trends and Differences
Biostatistics 4: Trends and Differences Dr. Jessica Ketchum, PhD. email: McKinneyJL@vcu.edu Objectives 1) Know how to see the strength, direction, and linearity of relationships in a scatter plot 2) Interpret
More informationCorrelation & Regression. Dr. Moataza Mahmoud Abdel Wahab Lecturer of Biostatistics High Institute of Public Health University of Alexandria
بسم الرحمن الرحيم Correlation & Regression Dr. Moataza Mahmoud Abdel Wahab Lecturer of Biostatistics High Institute of Public Health University of Alexandria Correlation Finding the relationship between
More informationSampling Variability and Confidence Intervals. John McGready Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationESS Finite Impulse Response Filters and the Z-transform
9. Finite Impulse Response Filters and the Z-transform We are going to have two lectures on filters you can find much more material in Bob Crosson s notes. In the first lecture we will focus on some of
More informationModule 17: Two-Sample t-tests, with equal variances for the two populations
Module 17: Two-Sample t-tests, with equal variances for the two populations This module describes one of the most utilized statistical tests, the two-sample t-test conducted under the assumption that the
More informationBiological Systems Modeling & Simulation. Konstantinos P. Michmizos, PhD
Biological Systems Modeling & Simulation 2 Konstantinos P. Michmizos, PhD June 25, 2012 Previous Lecture Biomedical Signal examples (1-d, 2-d, 3-d, ) Purpose of Signal Analysis Noise Frequency domain (1-d,
More informationBios 6648: Design & conduct of clinical research
Bios 6648: Design & conduct of clinical research Section 2 - Formulating the scientific and statistical design designs 2.5(b) Binary 2.5(c) Skewed baseline (a) Time-to-event (revisited) (b) Binary (revisited)
More informationBiomedical Signal Processing and Signal Modeling
Biomedical Signal Processing and Signal Modeling Eugene N. Bruce University of Kentucky A Wiley-lnterscience Publication JOHN WILEY & SONS, INC. New York Chichester Weinheim Brisbane Singapore Toronto
More informationBios 6649: Clinical Trials - Statistical Design and Monitoring
Bios 6649: Clinical Trials - Statistical Design and Monitoring Spring Semester 2015 John M. Kittelson Department of Biostatistics & Informatics Colorado School of Public Health University of Colorado Denver
More informationω 0 = 2π/T 0 is called the fundamental angular frequency and ω 2 = 2ω 0 is called the
he ime-frequency Concept []. Review of Fourier Series Consider the following set of time functions {3A sin t, A sin t}. We can represent these functions in different ways by plotting the amplitude versus
More informationThe general concept of pharmacokinetics
The general concept of pharmacokinetics Hartmut Derendorf, PhD University of Florida Pharmacokinetics the time course of drug and metabolite concentrations in the body Pharmacokinetics helps to optimize
More information7, 48 7, 6 7, 45. Name: Class: Date: Multiple Choice Questions
Class: Date: Practice Test (00 Trigonometry) Instructor: Koshal Dahal Multiple Choice Questions SHOWALLWORK,EVENFORMULTIPLECHOICEQUESTIONS,TORECEIVECREDIT.. Find the terminal point P (x, y) on the unit
More informationPower and Sample Size Bios 662
Power and Sample Size Bios 662 Michael G. Hudgens, Ph.D. mhudgens@bios.unc.edu http://www.bios.unc.edu/ mhudgens 2008-10-31 14:06 BIOS 662 1 Power and Sample Size Outline Introduction One sample: continuous
More informationCorrelation. Engineering Mathematics III
Correlation Correlation Finding the relationship between two quantitative variables without being able to infer causal relationships Correlation is a statistical technique used to determine the degree
More informationAcknowledgements. Outline. Marie Diener-West. ICTR Leadership / Team INTRODUCTION TO CLINICAL RESEARCH. Introduction to Linear Regression
INTRODUCTION TO CLINICAL RESEARCH Introduction to Linear Regression Karen Bandeen-Roche, Ph.D. July 17, 2012 Acknowledgements Marie Diener-West Rick Thompson ICTR Leadership / Team JHU Intro to Clinical
More informationModeling and Simulation for Determination of the Therapeutic Window of MK-2295: a TRPV1 Antagonist
Modeling and Simulation for Determination of the Therapeutic Window of MK-2295: a TRPV1 Antagonist William S. Denney *, Yaming Hang *, Marissa Dockendorf *, Chi-Chung Li *, Samer R. Eid *, Robert Valesky
More informationHierarchical Time-series Modelling for Haemodialysis. Tingting Zhu 24 th October 2016
Hierarchical Time-series Modelling for Haemodialysis Tingting Zhu 24 th October 2016 Content Background on haemodialysis Methods o Gaussian Process Regression (GPR) o Hierarchical Gaussian Process Regression
More informationELEG 3124 SYSTEMS AND SIGNALS Ch. 5 Fourier Transform
Department of Electrical Engineering University of Arkansas ELEG 3124 SYSTEMS AND SIGNALS Ch. 5 Fourier Transform Dr. Jingxian Wu wuj@uark.edu OUTLINE 2 Introduction Fourier Transform Properties of Fourier
More informationINTERFERENCE OF LIGHT
INTERFERENCE OF LIGHT Physics Without Fear Want to be good in Physics? Remember: PHYSICS IS AN ACTIVE SPORT Physics is like a sport. To be good in a sport, you must practice. Likewise, to be good in Physics
More information(c) cos Arctan ( 3) ( ) PRECALCULUS ADVANCED REVIEW FOR FINAL FIRST SEMESTER
PRECALCULUS ADVANCED REVIEW FOR FINAL FIRST SEMESTER Work the following on notebook paper ecept for the graphs. Do not use our calculator unless the problem tells ou to use it. Give three decimal places
More informationUnderstanding the Individual Contributions to Multivariate Outliers in Assessments of Data Quality
Understanding the Individual Contributions to Multivariate Outliers in Assessments of Data Quality Richard C. Zink, Ph.D. Senior Director, Data Management and Statistics TARGET PharmaSolutions Inc. rzink@targetpharmasolutions.com
More informationSEISMIC WAVE PROPAGATION. Lecture 2: Fourier Analysis
SEISMIC WAVE PROPAGATION Lecture 2: Fourier Analysis Fourier Series & Fourier Transforms Fourier Series Review of trigonometric identities Analysing the square wave Fourier Transform Transforms of some
More informationFundamentals to Biostatistics. Prof. Chandan Chakraborty Associate Professor School of Medical Science & Technology IIT Kharagpur
Fundamentals to Biostatistics Prof. Chandan Chakraborty Associate Professor School of Medical Science & Technology IIT Kharagpur Statistics collection, analysis, interpretation of data development of new
More informationFILTERING IN THE FREQUENCY DOMAIN
1 FILTERING IN THE FREQUENCY DOMAIN Lecture 4 Spatial Vs Frequency domain 2 Spatial Domain (I) Normal image space Changes in pixel positions correspond to changes in the scene Distances in I correspond
More informationMeasures of Central Tendency and their dispersion and applications. Acknowledgement: Dr Muslima Ejaz
Measures of Central Tendency and their dispersion and applications Acknowledgement: Dr Muslima Ejaz LEARNING OBJECTIVES: Compute and distinguish between the uses of measures of central tendency: mean,
More informationAPPM 1235 Final Exam Spring 2018
APPM 35 Final Exam Spring 08 INSTRUCTIONS: Outside paper and electronic devices are not permitted. Exam is worth 50 points. Neatness counts. Unless indicated, answers with no supporting work may receive
More informationSignal Modeling, Statistical Inference and Data Mining in Astrophysics
ASTRONOMY 6523 Spring 2013 Signal Modeling, Statistical Inference and Data Mining in Astrophysics Course Approach The philosophy of the course reflects that of the instructor, who takes a dualistic view
More informationEF 152 Exam 2 - Fall, 2016 Page 1 Copy 223
EF 152 Exam 2 - Fall, 2016 Page 1 Copy 223 Instructions Do not open the exam until instructed to do so. Do not leave if there is less than 5 minutes to go in the exam. When time is called, immediately
More informationNew Developments in East
New Developments in East MAMS: Multi-arm Multi-stage Trials Presented at the Fifth East User Group Meeting March 16, 2016 Cyrus Mehta, Ph.D. President, Cytel Inc Multi-arm Multi-stage Designs Generaliza8on
More informationMathematical statistics
November 15 th, 2018 Lecture 21: The two-sample t-test Overview Week 1 Week 2 Week 4 Week 7 Week 10 Week 14 Probability reviews Chapter 6: Statistics and Sampling Distributions Chapter 7: Point Estimation
More informationSupporting Information. Methods. Equations for four regimes
Supporting Information A Methods All analytical expressions were obtained starting from quation 3, the tqssa approximation of the cycle, the derivation of which is discussed in Appendix C. The full mass
More informationOSE801 Engineering System Identification. Lecture 09: Computing Impulse and Frequency Response Functions
OSE801 Engineering System Identification Lecture 09: Computing Impulse and Frequency Response Functions 1 Extracting Impulse and Frequency Response Functions In the preceding sections, signal processing
More informationHeart rate control and variability
Heart rate control and variability Na (Lina) Li (CDS13 ) EE @ SEAS Harvard University CDS @ 20 The persistent mystery Young, fit, healthy more extreme Resting Heart Rate (bpm) 60 0 50 100 150 200 250 300
More informationPreview from Notesale.co.uk Page 2 of 42
. CONCEPTS & FORMULAS. INTRODUCTION Radian The angle subtended at centre of a circle by an arc of length equal to the radius of the circle is radian r o = o radian r r o radian = o = 6 Positive & Negative
More informationHypothesis Testing, Power, Sample Size and Confidence Intervals (Part 2)
Hypothesis Testing, Power, Sample Size and Confidence Intervals (Part 2) B.H. Robbins Scholars Series June 23, 2010 1 / 29 Outline Z-test χ 2 -test Confidence Interval Sample size and power Relative effect
More informationDepartment of Mathematics & Statistics STAT 2593 Final Examination 17 April, 2000
Department of Mathematics & Statistics STAT 2593 Final Examination 17 April, 2000 TIME: 3 hours. Total marks: 80. (Marks are indicated in margin.) Remember that estimate means to give an interval estimate.
More informationBiostatistics for biomedical profession. BIMM34 Karin Källen & Linda Hartman November-December 2015
Biostatistics for biomedical profession BIMM34 Karin Källen & Linda Hartman November-December 2015 12015-11-02 Who needs a course in biostatistics? - Anyone who uses quntitative methods to interpret biological
More informationSubgroup analysis using regression modeling multiple regression. Aeilko H Zwinderman
Subgroup analysis using regression modeling multiple regression Aeilko H Zwinderman who has unusual large response? Is such occurrence associated with subgroups of patients? such question is hypothesis-generating:
More informationInvestigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification
Page 1 of 13 Investigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification The use of the Lomb-Scargle Periodogram (LSP) for the analysis of biological signal rhythms
More informationPractice of SAS Logistic Regression on Binary Pharmacodynamic Data Problems and Solutions. Alan J Xiao, Cognigen Corporation, Buffalo NY
Practice of SAS Logistic Regression on Binary Pharmacodynamic Data Problems and Solutions Alan J Xiao, Cognigen Corporation, Buffalo NY ABSTRACT Logistic regression has been widely applied to population
More informationANOVA Situation The F Statistic Multiple Comparisons. 1-Way ANOVA MATH 143. Department of Mathematics and Statistics Calvin College
1-Way ANOVA MATH 143 Department of Mathematics and Statistics Calvin College An example ANOVA situation Example (Treating Blisters) Subjects: 25 patients with blisters Treatments: Treatment A, Treatment
More informationName: Biostatistics 1 st year Comprehensive Examination: Applied in-class exam. June 8 th, 2016: 9am to 1pm
Name: Biostatistics 1 st year Comprehensive Examination: Applied in-class exam June 8 th, 2016: 9am to 1pm Instructions: 1. This is exam is to be completed independently. Do not discuss your work with
More informationNRCSE. Misalignment and use of deterministic models
NRCSE Misalignment and use of deterministic models Work with Veronica Berrocal Peter Craigmile Wendy Meiring Paul Sampson Gregory Nikulin The choice of spatial scale some questions 1. Which spatial scale
More informationIntroduction to Biomedical Engineering
Introduction to Biomedical Engineering Biosignal processing Kung-Bin Sung 6/11/2007 1 Outline Chapter 10: Biosignal processing Characteristics of biosignals Frequency domain representation and analysis
More informationA Bayesian Perspective on Residential Demand Response Using Smart Meter Data
A Bayesian Perspective on Residential Demand Response Using Smart Meter Data Datong-Paul Zhou, Maximilian Balandat, and Claire Tomlin University of California, Berkeley [datong.zhou, balandat, tomlin]@eecs.berkeley.edu
More informationAP CALCULUS AB SECTION I, Part A Time 55 Minutes Number of questions 28 A CALCULATOR MAY NOT BE USED ON THIS PART OF THE EXAM
AP CALCULUS AB SECTION I, Part A Time 55 Minutes Number of questions 28 Time Began: Time Ended: A CALCULATOR MAY NOT BE USED ON THIS PART OF THE EXAM Directions: Solve each of the following problems, using
More informationEE 435. Lecture 28. Data Converters Linearity INL/DNL Spectral Performance
EE 435 Lecture 8 Data Converters Linearity INL/DNL Spectral Performance Performance Characterization of Data Converters Static characteristics Resolution Least Significant Bit (LSB) Offset and Gain Errors
More informationDamped Harmonic Oscillator
Damped Harmonic Oscillator Note: We use Newton s 2 nd Law instead of Conservation of Energy since we will have energy transferred into heat. F spring = -kx; F resistance = -bv. Note also: We use F ar =
More informationWelcome! Webinar Biostatistics: sample size & power. Thursday, April 26, 12:30 1:30 pm (NDT)
. Welcome! Webinar Biostatistics: sample size & power Thursday, April 26, 12:30 1:30 pm (NDT) Get started now: Please check if your speakers are working and mute your audio. Please use the chat box to
More informationCase Studies in Bayesian Data Science
Case Studies in Bayesian Data Science 4: The Bootstrap as an Approximate BNP Method David Draper Department of Applied Mathematics and Statistics University of California, Santa Cruz draper@ucsc.edu Short
More informationParametric Estimation and Model Selection based on Amplitude-only Data in PS-Interferometry. (How Many Lines or Points are There?)
Parametric Estimation and Model Selection based on Amplitude-only Data in PS-Interferometry (How Many Lines or Points are There?), Richard Bamler, Michael Eineder and Bert Kampes DLR s PSIC4 results: Marseille
More information1-Way ANOVA MATH 143. Spring Department of Mathematics and Statistics Calvin College
1-Way ANOVA MATH 143 Department of Mathematics and Statistics Calvin College Spring 2010 The basic ANOVA situation Two variables: 1 Categorical, 1 Quantitative Main Question: Do the (means of) the quantitative
More informationThe t-distribution. Patrick Breheny. October 13. z tests The χ 2 -distribution The t-distribution Summary
Patrick Breheny October 13 Patrick Breheny Biostatistical Methods I (BIOS 5710) 1/25 Introduction Introduction What s wrong with z-tests? So far we ve (thoroughly!) discussed how to carry out hypothesis
More informationMath 2300 Calculus II University of Colorado
Math 3 Calculus II University of Colorado Spring Final eam review problems: ANSWER KEY. Find f (, ) for f(, y) = esin( y) ( + y ) 3/.. Consider the solid region W situated above the region apple apple,
More informationTime Series Analysis -- An Introduction -- AMS 586
Time Series Analysis -- An Introduction -- AMS 586 1 Objectives of time series analysis Data description Data interpretation Modeling Control Prediction & Forecasting 2 Time-Series Data Numerical data
More informationPrinciples and Design of IoT systems Level 11 course [20 credits] Week 3. Professor D K Arvind dka AT inf.ed.ac.uk
Principles and Design of IoT systems Level 11 course [20 credits] Week 3 Professor D K Arvind dka AT inf.ed.ac.uk References J.J. Carr, Sensors and Circuits Prentice Hall. Altman DG, Bland JM. Measurement
More informationSIMULTANEOUS ESTIMATION OF CILOSTAZOL AND ASPIRIN IN SYNTHETIC MIXTURE USING HPTLC METHOD
Int. J. Chem. Sci.: 6(3), 2008, 1377-1384 SIMULTANEOUS ESTIMATION OF CILOSTAZOL AND ASPIRIN IN SYNTHETIC MIXTURE USING HPTLC METHOD JAYESH V. PATEL, C. N. PATEL, P. U. PATEL a PANKAJ H. PRAJAPATI, I. S.
More information9.4 Enhancing the SNR of Digitized Signals
9.4 Enhancing the SNR of Digitized Signals stepping and averaging compared to ensemble averaging creating and using Fourier transform digital filters removal of Johnson noise and signal distortion using
More informationSuperposition and Standing Waves
Physics 1051 Lecture 9 Superposition and Standing Waves Lecture 09 - Contents 14.5 Standing Waves in Air Columns 14.6 Beats: Interference in Time 14.7 Non-sinusoidal Waves Trivia Questions 1 How many wavelengths
More informationFrequency Resolution Effects on FRF Estimation: Cyclic Averaging vs. Large Block Size
Frequency Resolution Effects on FRF Estimation: Cyclic Averaging vs. Large Block Size Allyn W. Phillips, PhD Andrew. Zucker Randall J. Allemang, PhD Research Assistant Professor Research Assistant Professor
More informationTutorial 9 The Discrete Fourier Transform (DFT) SIPC , Spring 2017 Technion, CS Department
Tutorial 9 The Discrete Fourier Transform (DFT) SIPC 236327, Spring 2017 Technion, CS Department The DFT Matrix The DFT matrix of size M M is defined as DFT = 1 M W 0 0 W 0 W 0 W where W = e i2π M i =
More informationLecture 7 Time-dependent Covariates in Cox Regression
Lecture 7 Time-dependent Covariates in Cox Regression So far, we ve been considering the following Cox PH model: λ(t Z) = λ 0 (t) exp(β Z) = λ 0 (t) exp( β j Z j ) where β j is the parameter for the the
More informationEEG- Signal Processing
Fatemeh Hadaeghi EEG- Signal Processing Lecture Notes for BSP, Chapter 5 Master Program Data Engineering 1 5 Introduction The complex patterns of neural activity, both in presence and absence of external
More informationStrauss PDEs 2e: Section Exercise 1 Page 1 of 6
Strauss PDEs 2e: Section 3 - Exercise Page of 6 Exercise Carefully derive the equation of a string in a medium in which the resistance is proportional to the velocity Solution There are two ways (among
More informationSystem Modeling and Identification CHBE 702 Korea University Prof. Dae Ryook Yang
System Modeling and Identification CHBE 702 Korea University Prof. Dae Ryook Yang 1-1 Course Description Emphases Delivering concepts and Practice Programming Identification Methods using Matlab Class
More informationBayesian Statistics Comparing Two Proportions or Means
Bayesian Statistics Comparing Two Proportions or Means Michael Anderson, PhD Hélène Carabin, DVM, PhD Department of Biostatistics and Epidemiology The University of Oklahoma Health Sciences Center May
More informationTri-diurnal anisotropy of cosmic ray daily variation for the solar cycle 23
Indian Journal of Radio & Space Physics Vol. 39, December 2010, pp. 341-345 Tri-diurnal anisotropy of cosmic ray daily variation for the solar cycle 23 Kamlesh Singh & Pankaj K Shrivastava $,* Department
More informationBIOSIGNAL PROCESSING. Hee Chan Kim, Ph.D. Department of Biomedical Engineering College of Medicine Seoul National University
BIOSIGNAL PROCESSING Hee Chan Kim, Ph.D. Department of Biomedical Engineering College of Medicine Seoul National University INTRODUCTION Biosignals (biological signals) : space, time, or space-time records
More informationA TWO-STAGE LINEAR MIXED-EFFECTS/COX MODEL FOR LONGITUDINAL DATA WITH MEASUREMENT ERROR AND SURVIVAL
A TWO-STAGE LINEAR MIXED-EFFECTS/COX MODEL FOR LONGITUDINAL DATA WITH MEASUREMENT ERROR AND SURVIVAL Christopher H. Morrell, Loyola College in Maryland, and Larry J. Brant, NIA Christopher H. Morrell,
More informationAPPM 1350 Final Exam Fall 2017
APPM 350 Final Exam Fall 207. (26 pts) Evaluate the following. (a) Let g(x) cos 3 (π 2x). Find g (π/3). (b) Let y ( x) x. Find y (4). (c) lim r 0 e /r ln(r) + (a) (9 pt) g (x) 3 cos 2 (π 2x)( sin(π 2x))(
More informationUNIVERSITY OF MASSACHUSETTS Department of Mathematics and Statistics Applied Statistics Friday, January 15, 2016
UNIVERSITY OF MASSACHUSETTS Department of Mathematics and Statistics Applied Statistics Friday, January 15, 2016 Work all problems. 60 points are needed to pass at the Masters Level and 75 to pass at the
More informationTAC1 TAC4 TAC7 TAC14 TAC21
Table S1 Gene qrt-pcr primer sequence Amplification efficiency α-sma (FW) 5 - GCCAGTCGCTGTCAGGAACCC -3 (RV) 5 - AGCCGGCCTAGAGCCCA -3 Procollagen-I (FW) 5 - AAGACGGGAGGGCGAGTGCT -3 (RV) 5 - AACGGGTCCCCTTGGGCCTT
More informationAnalysis of Longitudinal Data. Patrick J. Heagerty PhD Department of Biostatistics University of Washington
Analsis of Longitudinal Data Patrick J. Heagert PhD Department of Biostatistics Universit of Washington 1 Auckland 2008 Session Three Outline Role of correlation Impact proper standard errors Used to weight
More informationCorrelation and simple linear regression S5
Basic medical statistics for clinical and eperimental research Correlation and simple linear regression S5 Katarzyna Jóźwiak k.jozwiak@nki.nl November 15, 2017 1/41 Introduction Eample: Brain size and
More informationTO EARN ANY CREDIT, YOU MUST SHOW STEPS LEADING TO THE ANSWER
Prof. Israel N. Nwaguru MATH 11 CHAPTER,,, AND - REVIEW WORKOUT EACH PROBLEM NEATLY AND ORDERLY ON SEPARATE SHEET THEN CHOSE THE BEST ANSWER TO EARN ANY CREDIT, YOU MUST SHOW STEPS LEADING TO THE ANSWER
More informationCORRELATION BETWEEN PHOTONS IN TWO COHERENT BEAMS OF LIGHT
J. Astrophys. Astr. (1994) 15, 13 19 Reproduced from Nature (London) (1956) 177, 27-32 CORRELATION BETWEEN PHOTONS IN TWO COHERENT BEAMS OF LIGHT By R.Hanbury Brown University of Manchester, Jodrell Bank
More information6.1: Reciprocal, Quotient & Pythagorean Identities
Math Pre-Calculus 6.: Reciprocal, Quotient & Pythagorean Identities A trigonometric identity is an equation that is valid for all values of the variable(s) for which the equation is defined. In this chapter
More informationL-statistics based Modification of Reconstruction Algorithms for Compressive Sensing in the Presence of Impulse Noise
L-statistics based Modification of Reconstruction Algorithms for Compressive Sensing in the Presence of Impulse Noise Srdjan Stanković, Irena Orović and Moeness Amin 1 Abstract- A modification of standard
More informationSection Inference for a Single Proportion
Section 8.1 - Inference for a Single Proportion Statistics 104 Autumn 2004 Copyright c 2004 by Mark E. Irwin Inference for a Single Proportion For most of what follows, we will be making two assumptions
More informationAbsolute Convergence and the Ratio Test
Absolute Convergence and the Ratio Test MATH 211, Calculus II J. Robert Buchanan Department of Mathematics Spring 2018 Bacground Remar: All previously covered tests for convergence/divergence apply only
More informationSampling distributions:
Sampling distributions: In Psychology we generally make inferences about populations on the basis of limited samples. We therefore need to know what relationship exists between samples and populations.
More informationCopyright 2015 Quintiles
fficiency of Ranomize Concentration-Controlle Trials Relative to Ranomize Dose-Controlle Trials, an Application to Personalize Dosing Trials Russell Reeve, PhD Quintiles, Inc. Copyright 2015 Quintiles
More informationSample Size. Vorasith Sornsrivichai, MD., FETP Epidemiology Unit, Faculty of Medicine Prince of Songkla University
Sample Size Vorasith Sornsrivichai, MD., FETP Epidemiology Unit, Faculty of Medicine Prince of Songkla University All nature is but art, unknown to thee; All chance, direction, which thou canst not see;
More informationDigital Band-pass Modulation PROF. MICHAEL TSAI 2011/11/10
Digital Band-pass Modulation PROF. MICHAEL TSAI 211/11/1 Band-pass Signal Representation a t g t General form: 2πf c t + φ t g t = a t cos 2πf c t + φ t Envelope Phase Envelope is always non-negative,
More informationDiscrete Multivariate Statistics
Discrete Multivariate Statistics Univariate Discrete Random variables Let X be a discrete random variable which, in this module, will be assumed to take a finite number of t different values which are
More informationBENG 186B Winter 2014 Quiz 3. March 5, NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra.
BENG 186B Winter 2014 Quiz 3 March 5, 2014 NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra. Circle your final answers in the space provided; show your
More informationAlternating Series, Absolute and Conditional Convergence Á + s -1dn Á + s -1dn 4
.6 Alternating Series, Absolute and Conditional Convergence 787.6 Alternating Series, Absolute and Conditional Convergence A series in which the terms are alternately positive and negative is an alternating
More informationCHAPTER 4 FOURIER SERIES S A B A R I N A I S M A I L
CHAPTER 4 FOURIER SERIES 1 S A B A R I N A I S M A I L Outline Introduction of the Fourier series. The properties of the Fourier series. Symmetry consideration Application of the Fourier series to circuit
More informationNo Calc. 1 p (seen anywhere) 1 p. 1 p. No Calc. (b) Find an expression for cos 140. (c) Find an expression for tan (a) (i) sin 140 = p A1 N1
IBSL /4 IB REVIEW: Trig KEY (0points). Let p = sin 40 and q = cos 0. Give your answers to the following in terms of p and/or q. (a) Write down an expression for (i) sin 40; (ii) cos 70. (b) Find an expression
More informationCourse content (will be adapted to the background knowledge of the class):
Biomedical Signal Processing and Signal Modeling Lucas C Parra, parra@ccny.cuny.edu Departamento the Fisica, UBA Synopsis This course introduces two fundamental concepts of signal processing: linear systems
More informationUniversal structures of normal and pathological heart rate variability (Supplemental Information)
Universal structures of normal and pathological heart rate variability (Supplemental Information) Alfonso M. Gañán-Calvo 1, Juan Fajardo-López 2 1 Depto. de Ingeniería Aeroespacial y Mecánica de Fluidos,
More informationA GENERIC FRAMEWORK FOR THE DEVELOPMENT OF THE SIGNAL SIMULATOR
A GENERIC FRAMEWORK FOR THE DEVELOPMENT OF THE SIGNAL SIMULATOR 1 SUDHAKAR S DUBEY, 2 SHAMI TRIPATHI M.E. Students Electronics and Telecommunication Engineering, Thakur College of Engineering and Technology,
More informationLesson 7.3 Exercises, pages
Lesson 7. Exercises, pages 8 A. Write each expression in terms of a single trigonometric function. cos u a) b) sin u cos u cot U tan U P DO NOT COPY. 7. Reciprocal and Quotient Identities Solutions 7 c)
More informationVibration Testing. an excitation source a device to measure the response a digital signal processor to analyze the system response
Vibration Testing For vibration testing, you need an excitation source a device to measure the response a digital signal processor to analyze the system response i) Excitation sources Typically either
More informationComparison of Different Methods of Sample Size Re-estimation for Therapeutic Equivalence (TE) Studies Protecting the Overall Type 1 Error
Comparison of Different Methods of Sample Size Re-estimation for Therapeutic Equivalence (TE) Studies Protecting the Overall Type 1 Error by Diane Potvin Outline 1. Therapeutic Equivalence Designs 2. Objectives
More information