Learning Your Identity and Disease from Research Papers: Information Leaks in Genome-Wide Association Study

Size: px
Start display at page:

Download "Learning Your Identity and Disease from Research Papers: Information Leaks in Genome-Wide Association Study"

Transcription

1 Learning Your Identity and Disease from Research Papers: Information Leaks in Genome-Wide Association Study Rui Wang, Yong Li, XiaoFeng Wang, Haixu Tang and Xiaoyong Zhou Indiana University at Bloomington

2 Genomic Revolutions Low-cost genotyping Revolutionary applications

3 Genome-Wide Association Study Case Group Control Group Single Nucleotide Polymorphism (SNP)

4 Identification Risk Consequence of identifications Participant protection De-identification Aggregation Is this sufficient?

5 Attack on Aggregated Data Single-allele frequencies Major: 0; Minor: 1 Homer s attack NIH s Reactions

6 The Rest of The Iceberg Other genome data Test statistics Linkage Disequilibrium (LD) Haplotype sequences Other sources Publications

7 Our Scary Findings ID from GWAS publications Test statistics LD statistics Allele Frequencies Statistical Identification Pair-wise allele frequencies SNP Sequences Work on real genome data Conclusion: Urgent needs to thoroughly study the problem

8 Why Doing This? Facilitate Dissemination of Genome Data SAFELY A Lesson From the Internet: Build Protection Into the Core!

9 Terms Alleles Single (0 1) Pair-wise (00, 01, 10, 11) Genotype Combinations of two sets of alleles Haplotype SNP Sequence (phased genotype) Locus Surrounding region of a SNP site

10 GWAS: Backgrounds GWAS Study Quality Control Info Leaks p values: leak joint allele frequencies of case & control Association Detection p values: leak case frequencies & control frequencies LD in Regions of Association r 2 : reveal LD of SNP sequences Replication Disclose cohorts with same frequency distributions

11 Homer s Attack Reference Group (Pop) Case Group (M) Pop j : 0.3 Pop j+1 : 0.6 Pop j+2 : 0.3 Y j : 1 Y j+1 : 0 Y j+2 : 1 Y i Pop i Y i M i M j : 0.8 M j+1 : 0.2 M j+2 : 0.6 H 0 Not in M D(Y i ) = Y i Pop i - Y i M i ΣD

12 What we can do Reverse engineer test statistics To find allele frequencies LD-based statistical identification Recover SNP sequences

13 Allele Frequency (Single) SNP 1 SNP2 SNP3 r 2 (1,3) C r 2 0* (1,2) r 2 (2,3) p 2 p 3

14 Allele Frequencies (Pair-wise) 2 2 (C00N *0C 2 (C N C C 0* ) 00 *0 0* ) L r< = < U C C C C C*1 C C C C 0* 1* *0 *1 = C = C = C = C 0* 0* 1* C + C 1* *0 + C + C *0 *1 (1) (2) (3) (4) (5) Catch: C 00 not unique Integer constraint Inaccurate r-squares Signs

15 Homer-Style Attack Based On LD? Why? Single AF: n LD: n(n-1)/2 But how? Validity of the test statistic D(Y i ) = Y i Pop i - Y i M i r 2 2 (C00C11 C10C01) = C 0* C 1* C *0 C *1

16 Our Statistical Attack We have to use signed r Distribution of T r? Markov model Reference? T T r = ( Y = 00 + Y T 1 i j N 11 ) ( r R + 1) / 2 ( Y 00 + Y 11 ) ( r C + 1) / 2 = ( r C r R )( Y 00 + Y 11 Y 01 Y 10 )

17 Recover SNP Sequences Contingency table problem Studied for decades Very difficult Divide-and-Conquer 1. Construct each haplotype block 2. Connect different blocks

18 Simple Defense Low-precision statistics Correlation among SNPs Thresholds How to determine them? Noises Consistency check Maximum-likelihood approximation

19 Evaluations Data: the HapMap project Locus: FGFR2 174 SNPs Used in a real GWAS study Population Africa backgrounds 200: half cases and half controls

20 Allele Frequencies and Signs

21 Statistical Powers 20 times more powerful than Homer s test (T p )

22 Recover Haplotypes Linear equation solving: rref Integer Programming: bintprog 100 individuals, 10 blocks, 174 SNPs System: 2.80GHz Core 2 Duo, 3GB memory Fully restored within 12 hours

23 Discussion Genotypes vs. Haplotypes Defense Differential privacy

24 Conclusion New attacks and new understanding Many open research problems

25 Contacts Dr. XiaoFeng Wang Web: du/xw7 System Security Lab: sysseclab.informatics.india na.edu Dr. Haixu Tang Web: du/hatang

26 References Good: from the same population Bad: from different populations good reference average reference

27 More In-depth Studies Larger populations: Low-precision statistics (200 cases, 200 references)

Introduction to Linkage Disequilibrium

Introduction to Linkage Disequilibrium Introduction to September 10, 2014 Suppose we have two genes on a single chromosome gene A and gene B such that each gene has only two alleles Aalleles : A 1 and A 2 Balleles : B 1 and B 2 Suppose we have

More information

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo

Friday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization

More information

1 Springer. Nan M. Laird Christoph Lange. The Fundamentals of Modern Statistical Genetics

1 Springer. Nan M. Laird Christoph Lange. The Fundamentals of Modern Statistical Genetics 1 Springer Nan M. Laird Christoph Lange The Fundamentals of Modern Statistical Genetics 1 Introduction to Statistical Genetics and Background in Molecular Genetics 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

More information

p(d g A,g B )p(g B ), g B

p(d g A,g B )p(g B ), g B Supplementary Note Marginal effects for two-locus models Here we derive the marginal effect size of the three models given in Figure 1 of the main text. For each model we assume the two loci (A and B)

More information

Private Computation with Genomic Data for Genome-Wide Association and Linkage Studies

Private Computation with Genomic Data for Genome-Wide Association and Linkage Studies Private Computation with Genomic Data for Genome-Wide Association and Linkage Studies Abstract Ali Shahbazi 1, Fattaneh Bayatbabolghani 1, and Marina Blanton 2 1 Department of Computer Science and Engineering,

More information

Genotype Imputation. Biostatistics 666

Genotype Imputation. Biostatistics 666 Genotype Imputation Biostatistics 666 Previously Hidden Markov Models for Relative Pairs Linkage analysis using affected sibling pairs Estimation of pairwise relationships Identity-by-Descent Relatives

More information

How to analyze many contingency tables simultaneously?

How to analyze many contingency tables simultaneously? How to analyze many contingency tables simultaneously? Thorsten Dickhaus Humboldt-Universität zu Berlin Beuth Hochschule für Technik Berlin, 31.10.2012 Outline Motivation: Genetic association studies Statistical

More information

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power

Proportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion

More information

Probability of Detecting Disease-Associated SNPs in Case-Control Genome-Wide Association Studies

Probability of Detecting Disease-Associated SNPs in Case-Control Genome-Wide Association Studies Probability of Detecting Disease-Associated SNPs in Case-Control Genome-Wide Association Studies Ruth Pfeiffer, Ph.D. Mitchell Gail Biostatistics Branch Division of Cancer Epidemiology&Genetics National

More information

Differential Privacy with Bounded Priors: Reconciling Utility and Privacy in Genome-Wide Association Studies

Differential Privacy with Bounded Priors: Reconciling Utility and Privacy in Genome-Wide Association Studies Differential Privacy with ounded Priors: Reconciling Utility and Privacy in Genome-Wide Association Studies ASTRACT Florian Tramèr Zhicong Huang Jean-Pierre Hubaux School of IC, EPFL firstname.lastname@epfl.ch

More information

(Genome-wide) association analysis

(Genome-wide) association analysis (Genome-wide) association analysis 1 Key concepts Mapping QTL by association relies on linkage disequilibrium in the population; LD can be caused by close linkage between a QTL and marker (= good) or by

More information

Hybrid CPU/GPU Acceleration of Detection of 2-SNP Epistatic Interactions in GWAS

Hybrid CPU/GPU Acceleration of Detection of 2-SNP Epistatic Interactions in GWAS Hybrid CPU/GPU Acceleration of Detection of 2-SNP Epistatic Interactions in GWAS Jorge González-Domínguez*, Bertil Schmidt*, Jan C. Kässens**, Lars Wienbrandt** *Parallel and Distributed Architectures

More information

Bayesian Inference of Interactions and Associations

Bayesian Inference of Interactions and Associations Bayesian Inference of Interactions and Associations Jun Liu Department of Statistics Harvard University http://www.fas.harvard.edu/~junliu Based on collaborations with Yu Zhang, Jing Zhang, Yuan Yuan,

More information

Genotype Imputation. Class Discussion for January 19, 2016

Genotype Imputation. Class Discussion for January 19, 2016 Genotype Imputation Class Discussion for January 19, 2016 Intuition Patterns of genetic variation in one individual guide our interpretation of the genomes of other individuals Imputation uses previously

More information

Binomial Mixture Model-based Association Tests under Genetic Heterogeneity

Binomial Mixture Model-based Association Tests under Genetic Heterogeneity Binomial Mixture Model-based Association Tests under Genetic Heterogeneity Hui Zhou, Wei Pan Division of Biostatistics, School of Public Health, University of Minnesota, Minneapolis, MN 55455 April 30,

More information

CSci 8980: Advanced Topics in Graphical Models Analysis of Genetic Variation

CSci 8980: Advanced Topics in Graphical Models Analysis of Genetic Variation CSci 8980: Advanced Topics in Graphical Models Analysis of Genetic Variation Instructor: Arindam Banerjee November 26, 2007 Genetic Polymorphism Single nucleotide polymorphism (SNP) Genetic Polymorphism

More information

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5

Association Testing with Quantitative Traits: Common and Rare Variants. Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 Association Testing with Quantitative Traits: Common and Rare Variants Timothy Thornton and Katie Kerr Summer Institute in Statistical Genetics 2014 Module 10 Lecture 5 1 / 41 Introduction to Quantitative

More information

Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination)

Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) 12/5/14 Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) Linkage Disequilibrium Genealogical Interpretation of LD Association Mapping 1 Linkage and Recombination v linkage equilibrium ²

More information

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012 Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture16: Population structure and logistic regression I Jason Mezey jgm45@cornell.edu April 11, 2017 (T) 8:40-9:55 Announcements I April

More information

USING LINEAR PREDICTORS TO IMPUTE ALLELE FREQUENCIES FROM SUMMARY OR POOLED GENOTYPE DATA. By Xiaoquan Wen and Matthew Stephens University of Chicago

USING LINEAR PREDICTORS TO IMPUTE ALLELE FREQUENCIES FROM SUMMARY OR POOLED GENOTYPE DATA. By Xiaoquan Wen and Matthew Stephens University of Chicago Submitted to the Annals of Applied Statistics USING LINEAR PREDICTORS TO IMPUTE ALLELE FREQUENCIES FROM SUMMARY OR POOLED GENOTYPE DATA By Xiaoquan Wen and Matthew Stephens University of Chicago Recently-developed

More information

Learning ancestral genetic processes using nonparametric Bayesian models

Learning ancestral genetic processes using nonparametric Bayesian models Learning ancestral genetic processes using nonparametric Bayesian models Kyung-Ah Sohn October 31, 2011 Committee Members: Eric P. Xing, Chair Zoubin Ghahramani Russell Schwartz Kathryn Roeder Matthew

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Principal components analysis (PCA) of all samples analyzed in the discovery phase. Colors represent the phenotype of study populations. a) The first sample

More information

Model-Free Knockoffs: High-Dimensional Variable Selection that Controls the False Discovery Rate

Model-Free Knockoffs: High-Dimensional Variable Selection that Controls the False Discovery Rate Model-Free Knockoffs: High-Dimensional Variable Selection that Controls the False Discovery Rate Lucas Janson, Stanford Department of Statistics WADAPT Workshop, NIPS, December 2016 Collaborators: Emmanuel

More information

On the limiting distribution of the likelihood ratio test in nucleotide mapping of complex disease

On the limiting distribution of the likelihood ratio test in nucleotide mapping of complex disease On the limiting distribution of the likelihood ratio test in nucleotide mapping of complex disease Yuehua Cui 1 and Dong-Yun Kim 2 1 Department of Statistics and Probability, Michigan State University,

More information

1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:

1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES: .5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the

More information

CONTENTS. P A R T I Genomes 1. P A R T II Gene Transcription and Regulation 109

CONTENTS. P A R T I Genomes 1. P A R T II Gene Transcription and Regulation 109 CONTENTS ix Preface xv Acknowledgments xxi Editors and contributors xxiv A computational micro primer xxvi P A R T I Genomes 1 1 Identifying the genetic basis of disease 3 Vineet Bafna 2 Pattern identification

More information

Differen'al Privacy with Bounded Priors: Reconciling U+lity and Privacy in Genome- Wide Associa+on Studies

Differen'al Privacy with Bounded Priors: Reconciling U+lity and Privacy in Genome- Wide Associa+on Studies Differen'al Privacy with Bounded Priors: Reconciling U+lity and Privacy in Genome- Wide Associa+on Studies Florian Tramèr, Zhicong Huang, Erman Ayday, Jean- Pierre Hubaux ACM CCS 205 Denver, Colorado,

More information

Computational Approaches to Statistical Genetics

Computational Approaches to Statistical Genetics Computational Approaches to Statistical Genetics GWAS I: Concepts and Probability Theory Christoph Lippert Dr. Oliver Stegle Prof. Dr. Karsten Borgwardt Max-Planck-Institutes Tübingen, Germany Tübingen

More information

COMBI - Combining high-dimensional classification and multiple hypotheses testing for the analysis of big data in genetics

COMBI - Combining high-dimensional classification and multiple hypotheses testing for the analysis of big data in genetics COMBI - Combining high-dimensional classification and multiple hypotheses testing for the analysis of big data in genetics Thorsten Dickhaus University of Bremen Institute for Statistics AG DANK Herbsttagung

More information

An Integrated Approach for the Assessment of Chromosomal Abnormalities

An Integrated Approach for the Assessment of Chromosomal Abnormalities An Integrated Approach for the Assessment of Chromosomal Abnormalities Department of Biostatistics Johns Hopkins Bloomberg School of Public Health June 26, 2007 Karyotypes Karyotypes General Cytogenetics

More information

Lecture 2: Genetic Association Testing with Quantitative Traits. Summer Institute in Statistical Genetics 2017

Lecture 2: Genetic Association Testing with Quantitative Traits. Summer Institute in Statistical Genetics 2017 Lecture 2: Genetic Association Testing with Quantitative Traits Instructors: Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2017 1 / 29 Introduction to Quantitative Trait Mapping

More information

An Integrated Approach for the Assessment of Chromosomal Abnormalities

An Integrated Approach for the Assessment of Chromosomal Abnormalities An Integrated Approach for the Assessment of Chromosomal Abnormalities Department of Biostatistics Johns Hopkins Bloomberg School of Public Health June 6, 2007 Karyotypes Mitosis and Meiosis Meiosis Meiosis

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Schematic comparison of linking attacks and detection of a genome in a mixture of attacks. (a) Each box in the figure represents a dataset in the form of a matrix. Multiple boxes

More information

2. Map genetic distance between markers

2. Map genetic distance between markers Chapter 5. Linkage Analysis Linkage is an important tool for the mapping of genetic loci and a method for mapping disease loci. With the availability of numerous DNA markers throughout the human genome,

More information

Calculation of IBD probabilities

Calculation of IBD probabilities Calculation of IBD probabilities David Evans and Stacey Cherny University of Oxford Wellcome Trust Centre for Human Genetics This Session IBD vs IBS Why is IBD important? Calculating IBD probabilities

More information

Robust Detection and Identification of Sparse Segments in Ultra-High Dimensional Data Analysis

Robust Detection and Identification of Sparse Segments in Ultra-High Dimensional Data Analysis Robust Detection and Identification of Sparse Segments in Ultra-High Dimensional Data Analysis Hongzhe Li hongzhe@upenn.edu, http://statgene.med.upenn.edu University of Pennsylvania Perelman School of

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Number of cases and proxy cases required to detect association at designs.

Nature Genetics: doi: /ng Supplementary Figure 1. Number of cases and proxy cases required to detect association at designs. Supplementary Figure 1 Number of cases and proxy cases required to detect association at designs. = 5 10 8 for case control and proxy case control The ratio of controls to cases (or proxy cases) is 1.

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:

More information

Régression en grande dimension et épistasie par blocs pour les études d association

Régression en grande dimension et épistasie par blocs pour les études d association Régression en grande dimension et épistasie par blocs pour les études d association V. Stanislas, C. Dalmasso, C. Ambroise Laboratoire de Mathématiques et Modélisation d Évry "Statistique et Génome" 1

More information

Heritability estimation in modern genetics and connections to some new results for quadratic forms in statistics

Heritability estimation in modern genetics and connections to some new results for quadratic forms in statistics Heritability estimation in modern genetics and connections to some new results for quadratic forms in statistics Lee H. Dicker Rutgers University and Amazon, NYC Based on joint work with Ruijun Ma (Rutgers),

More information

Using a CUDA-Accelerated PGAS Model on a GPU Cluster for Bioinformatics

Using a CUDA-Accelerated PGAS Model on a GPU Cluster for Bioinformatics Using a CUDA-Accelerated PGAS Model on a GPU Cluster for Bioinformatics Jorge González-Domínguez Parallel and Distributed Architectures Group Johannes Gutenberg University of Mainz, Germany j.gonzalez@uni-mainz.de

More information

Backward Genotype-Trait Association. in Case-Control Designs

Backward Genotype-Trait Association. in Case-Control Designs Backward Genotype-Trait Association (BGTA)-Based Dissection of Complex Traits in Case-Control Designs Tian Zheng, Hui Wang and Shaw-Hwa Lo Department of Statistics, Columbia University, New York, New York,

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture 18: Introduction to covariates, the QQ plot, and population structure II + minimal GWAS steps Jason Mezey jgm45@cornell.edu April

More information

Supporting Information

Supporting Information Supporting Information Hammer et al. 10.1073/pnas.1109300108 SI Materials and Methods Two-Population Model. Estimating demographic parameters. For each pair of sub-saharan African populations we consider

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.501.01 Lecture11: Quantitative Genomics II Jason Mezey jgm45@cornell.edu March 7, 019 (Th) 10:10-11:5 Announcements Homework #5 will be posted by

More information

Linear Regression (1/1/17)

Linear Regression (1/1/17) STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression

More information

Statistical Methods in Mapping Complex Diseases

Statistical Methods in Mapping Complex Diseases University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Summer 8-12-2011 Statistical Methods in Mapping Complex Diseases Jing He University of Pennsylvania, jinghe@mail.med.upenn.edu

More information

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying

More information

Fei Lu. Post doctoral Associate Cornell University

Fei Lu. Post doctoral Associate Cornell University Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.

More information

Accounting for read depth in the analysis of genotyping-by-sequencing data

Accounting for read depth in the analysis of genotyping-by-sequencing data Accounting for read depth in the analysis of genotyping-by-sequencing data Ken Dodds, John McEwan, Timothy Bilton, Rudi Brauning, Rayna Anderson, Tracey Van Stijn, Theodor Kristjánsson, Shannon Clarke

More information

SAT in Bioinformatics: Making the Case with Haplotype Inference

SAT in Bioinformatics: Making the Case with Haplotype Inference SAT in Bioinformatics: Making the Case with Haplotype Inference Inês Lynce 1 and João Marques-Silva 2 1 IST/INESC-ID, Technical University of Lisbon, Portugal ines@sat.inesc-id.pt 2 School of Electronics

More information

NIH Public Access Author Manuscript Stat Sin. Author manuscript; available in PMC 2013 August 15.

NIH Public Access Author Manuscript Stat Sin. Author manuscript; available in PMC 2013 August 15. NIH Public Access Author Manuscript Published in final edited form as: Stat Sin. 2012 ; 22: 1041 1074. ON MODEL SELECTION STRATEGIES TO IDENTIFY GENES UNDERLYING BINARY TRAITS USING GENOME-WIDE ASSOCIATION

More information

HERITABILITY ESTIMATION USING A REGULARIZED REGRESSION APPROACH (HERRA)

HERITABILITY ESTIMATION USING A REGULARIZED REGRESSION APPROACH (HERRA) BIRS 016 1 HERITABILITY ESTIMATION USING A REGULARIZED REGRESSION APPROACH (HERRA) Malka Gorfine, Tel Aviv University, Israel Joint work with Li Hsu, FHCRC, Seattle, USA BIRS 016 The concept of heritability

More information

Phasing via the Expectation Maximization (EM) Algorithm

Phasing via the Expectation Maximization (EM) Algorithm Computing Haplotype Frequencies and Haplotype Phasing via the Expectation Maximization (EM) Algorithm Department of Computer Science Brown University, Providence sorin@cs.brown.edu September 14, 2010 Outline

More information

Humans have two copies of each chromosome. Inherited from mother and father. Genotyping technologies do not maintain the phase

Humans have two copies of each chromosome. Inherited from mother and father. Genotyping technologies do not maintain the phase Humans have two copies of each chromosome Inherited from mother and father. Genotyping technologies do not maintain the phase Genotyping technologies do not maintain the phase Recall that proximal SNPs

More information

Lecture WS Evolutionary Genetics Part I 1

Lecture WS Evolutionary Genetics Part I 1 Quantitative genetics Quantitative genetics is the study of the inheritance of quantitative/continuous phenotypic traits, like human height and body size, grain colour in winter wheat or beak depth in

More information

Linkage and Linkage Disequilibrium

Linkage and Linkage Disequilibrium Linkage and Linkage Disequilibrium Summer Institute in Statistical Genetics 2014 Module 10 Topic 3 Linkage in a simple genetic cross Linkage In the early 1900 s Bateson and Punnet conducted genetic studies

More information

Frequency Spectra and Inference in Population Genetics

Frequency Spectra and Inference in Population Genetics Frequency Spectra and Inference in Population Genetics Although coalescent models have come to play a central role in population genetics, there are some situations where genealogies may not lead to efficient

More information

Lab 12. Linkage Disequilibrium. November 28, 2012

Lab 12. Linkage Disequilibrium. November 28, 2012 Lab 12. Linkage Disequilibrium November 28, 2012 Goals 1. Es

More information

Learning gene regulatory networks Statistical methods for haplotype inference Part I

Learning gene regulatory networks Statistical methods for haplotype inference Part I Learning gene regulatory networks Statistical methods for haplotype inference Part I Input: Measurement of mrn levels of all genes from microarray or rna sequencing Samples (e.g. 200 patients with lung

More information

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB

Quantitative Genomics and Genetics BTRY 4830/6830; PBSB Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture 20: Epistasis and Alternative Tests in GWAS Jason Mezey jgm45@cornell.edu April 16, 2016 (Th) 8:40-9:55 None Announcements Summary

More information

The Generalized Higher Criticism for Testing SNP-sets in Genetic Association Studies

The Generalized Higher Criticism for Testing SNP-sets in Genetic Association Studies The Generalized Higher Criticism for Testing SNP-sets in Genetic Association Studies Ian Barnett, Rajarshi Mukherjee & Xihong Lin Harvard University ibarnett@hsph.harvard.edu June 24, 2014 Ian Barnett

More information

Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing

Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing Analysis of Y-STR Profiles in Mixed DNA using Next Generation Sequencing So Yeun Kwon, Hwan Young Lee, and Kyoung-Jin Shin Department of Forensic Medicine, Yonsei University College of Medicine, Seoul,

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#7:(Mar-23-2010) Genome Wide Association Studies 1 The law of causality... is a relic of a bygone age, surviving, like the monarchy,

More information

Complexity and Approximation of the Minimum Recombination Haplotype Configuration Problem

Complexity and Approximation of the Minimum Recombination Haplotype Configuration Problem Complexity and Approximation of the Minimum Recombination Haplotype Configuration Problem Lan Liu 1, Xi Chen 3, Jing Xiao 3, and Tao Jiang 1,2 1 Department of Computer Science and Engineering, University

More information

Cover Page. The handle holds various files of this Leiden University dissertation

Cover Page. The handle   holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/35195 holds various files of this Leiden University dissertation Author: Balliu, Brunilda Title: Statistical methods for genetic association studies with

More information

Calculation of IBD probabilities

Calculation of IBD probabilities Calculation of IBD probabilities David Evans University of Bristol This Session Identity by Descent (IBD) vs Identity by state (IBS) Why is IBD important? Calculating IBD probabilities Lander-Green Algorithm

More information

Optimal Methods for Using Posterior Probabilities in Association Testing

Optimal Methods for Using Posterior Probabilities in Association Testing Digital Collections @ Dordt Faculty Work: Comprehensive List 5-2013 Optimal Methods for Using Posterior Probabilities in Association Testing Keli Liu Harvard University Alexander Luedtke University of

More information

Feature Selection via Block-Regularized Regression

Feature Selection via Block-Regularized Regression Feature Selection via Block-Regularized Regression Seyoung Kim School of Computer Science Carnegie Mellon University Pittsburgh, PA 3 Eric Xing School of Computer Science Carnegie Mellon University Pittsburgh,

More information

GWAS for Compound Heterozygous Traits: Phenotypic Distance and Integer Linear Programming Dan Gusfield, Rasmus Nielsen.

GWAS for Compound Heterozygous Traits: Phenotypic Distance and Integer Linear Programming Dan Gusfield, Rasmus Nielsen. GWAS for Compound Heterozygous Traits: Phenotypic Distance and Integer Linear Programming Dan Gusfield, Rasmus Nielsen December 11, 2016 GWAS In Genome Wide Association Studies (GWAS) we try to locate

More information

A novel fuzzy set based multifactor dimensionality reduction method for detecting gene-gene interaction

A novel fuzzy set based multifactor dimensionality reduction method for detecting gene-gene interaction A novel fuzzy set based multifactor dimensionality reduction method for detecting gene-gene interaction Sangseob Leem, Hye-Young Jung, Sungyoung Lee and Taesung Park Bioinformatics and Biostatistics lab

More information

Enabling Accurate Analysis of Private Network Data

Enabling Accurate Analysis of Private Network Data Enabling Accurate Analysis of Private Network Data Michael Hay Joint work with Gerome Miklau, David Jensen, Chao Li, Don Towsley University of Massachusetts, Amherst Vibhor Rastogi, Dan Suciu University

More information

Auditing Information Leakage for Distance Metrics

Auditing Information Leakage for Distance Metrics In 3 rd IEEE Conference on Privacy, Security, Risk and Trust, Boston, October 2011 Auditing Information Leakage for Distance Metrics Yikan Chen University of Virginia yc2r@virginia.edu David Evans University

More information

EM algorithm. Rather than jumping into the details of the particular EM algorithm, we ll look at a simpler example to get the idea of how it works

EM algorithm. Rather than jumping into the details of the particular EM algorithm, we ll look at a simpler example to get the idea of how it works EM algorithm The example in the book for doing the EM algorithm is rather difficult, and was not available in software at the time that the authors wrote the book, but they implemented a SAS macro to implement

More information

BTRY 4830/6830: Quantitative Genomics and Genetics Fall 2014

BTRY 4830/6830: Quantitative Genomics and Genetics Fall 2014 BTRY 4830/6830: Quantitative Genomics and Genetics Fall 2014 Homework 4 (version 3) - posted October 3 Assigned October 2; Due 11:59PM October 9 Problem 1 (Easy) a. For the genetic regression model: Y

More information

SNP Association Studies with Case-Parent Trios

SNP Association Studies with Case-Parent Trios SNP Association Studies with Case-Parent Trios Department of Biostatistics Johns Hopkins Bloomberg School of Public Health September 3, 2009 Population-based Association Studies Balding (2006). Nature

More information

opulation genetics undamentals for SNP datasets

opulation genetics undamentals for SNP datasets opulation genetics undamentals for SNP datasets with crocodiles) Sam Banks Charles Darwin University sam.banks@cdu.edu.au I ve got a SNP genotype dataset, now what? Do my data meet the requirements of

More information

Population Genetics II (Selection + Haplotype analyses)

Population Genetics II (Selection + Haplotype analyses) 26 th Oct 2015 Poulation Genetics II (Selection + Halotye analyses) Gurinder Singh Mickey twal Center for Quantitative iology Natural Selection Model (Molecular Evolution) llele frequency Embryos Selection

More information

MBeacon: Privacy-Preserving Beacons for DNA Methylation Data

MBeacon: Privacy-Preserving Beacons for DNA Methylation Data MBeacon: Privacy-Preserving Beacons for DNA Methylation Data Inken Hagestedt, Yang Zhang, Mathias Humbert, Pascal Berrang, Haixu Tang, XiaoFeng Wang, Michael Backes CISPA Helmholtz Center for Information

More information

Association studies and regression

Association studies and regression Association studies and regression CM226: Machine Learning for Bioinformatics. Fall 2016 Sriram Sankararaman Acknowledgments: Fei Sha, Ameet Talwalkar Association studies and regression 1 / 104 Administration

More information

1. Understand the methods for analyzing population structure in genomes

1. Understand the methods for analyzing population structure in genomes MSCBIO 2070/02-710: Computational Genomics, Spring 2016 HW3: Population Genetics Due: 24:00 EST, April 4, 2016 by autolab Your goals in this assignment are to 1. Understand the methods for analyzing population

More information

Supplementary Information for: Detection and interpretation of shared genetic influences on 42 human traits

Supplementary Information for: Detection and interpretation of shared genetic influences on 42 human traits Supplementary Information for: Detection and interpretation of shared genetic influences on 42 human traits Joseph K. Pickrell 1,2,, Tomaz Berisa 1, Jimmy Z. Liu 1, Laure Segurel 3, Joyce Y. Tung 4, David

More information

For 5% confidence χ 2 with 1 degree of freedom should exceed 3.841, so there is clear evidence for disequilibrium between S and M.

For 5% confidence χ 2 with 1 degree of freedom should exceed 3.841, so there is clear evidence for disequilibrium between S and M. STAT 550 Howework 6 Anton Amirov 1. This question relates to the same study you saw in Homework-4, by Dr. Arno Motulsky and coworkers, and published in Thompson et al. (1988; Am.J.Hum.Genet, 42, 113-124).

More information

Efficient designs of gene environment interaction studies: implications of Hardy Weinberg equilibrium and gene environment independence

Efficient designs of gene environment interaction studies: implications of Hardy Weinberg equilibrium and gene environment independence Special Issue Paper Received 7 January 20, Accepted 28 September 20 Published online 24 February 202 in Wiley Online Library (wileyonlinelibrary.com) DOI: 0.002/sim.4460 Efficient designs of gene environment

More information

Inference From Genome-Wide Association Studies Using a Novel Markov Model

Inference From Genome-Wide Association Studies Using a Novel Markov Model Genetic Epidemiology (2008) Inference From Genome-Wide Association Studies Using a Novel Markov Model Fay J. Hosking, 1 Jonathan A. C. Sterne, 2 George Davey Smith, 2 and Peter J. Green 1 1 Department

More information

Powerful multi-locus tests for genetic association in the presence of gene-gene and gene-environment interactions

Powerful multi-locus tests for genetic association in the presence of gene-gene and gene-environment interactions Powerful multi-locus tests for genetic association in the presence of gene-gene and gene-environment interactions Nilanjan Chatterjee, Zeynep Kalaylioglu 2, Roxana Moslehi, Ulrike Peters 3, Sholom Wacholder

More information

Lecture 1: Case-Control Association Testing. Summer Institute in Statistical Genetics 2015

Lecture 1: Case-Control Association Testing. Summer Institute in Statistical Genetics 2015 Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2015 1 / 1 Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits.

More information

Some models of genomic selection

Some models of genomic selection Munich, December 2013 What is the talk about? Barley! Steptoe x Morex barley mapping population Steptoe x Morex barley mapping population genotyping from Close at al., 2009 and phenotyping from cite http://wheat.pw.usda.gov/ggpages/sxm/

More information

New imputation strategies optimized for crop plants: FILLIN (Fast, Inbred Line Library ImputatioN) FSFHap (Full Sib Family Haplotype)

New imputation strategies optimized for crop plants: FILLIN (Fast, Inbred Line Library ImputatioN) FSFHap (Full Sib Family Haplotype) New imputation strategies optimized for crop plants: FILLIN (Fast, Inbred Line Library ImputatioN) FSFHap (Full Sib Family Haplotype) Kelly Swarts PAG Allele Mining 1/11/2014 Imputation is the projection

More information

Genetic Drift in Human Evolution

Genetic Drift in Human Evolution Genetic Drift in Human Evolution (Part 2 of 2) 1 Ecology and Evolutionary Biology Center for Computational Molecular Biology Brown University Outline Introduction to genetic drift Modeling genetic drift

More information

Theoretical and computational aspects of association tests: application in case-control genome-wide association studies.

Theoretical and computational aspects of association tests: application in case-control genome-wide association studies. Theoretical and computational aspects of association tests: application in case-control genome-wide association studies Mathieu Emily November 18, 2014 Caen mathieu.emily@agrocampus-ouest.fr - Agrocampus

More information

An Efficient and Accurate Graph-Based Approach to Detect Population Substructure

An Efficient and Accurate Graph-Based Approach to Detect Population Substructure An Efficient and Accurate Graph-Based Approach to Detect Population Substructure Srinath Sridhar, Satish Rao and Eran Halperin Abstract. Currently, large-scale projects are underway to perform whole genome

More information

Statistical Power of Model Selection Strategies for Genome-Wide Association Studies

Statistical Power of Model Selection Strategies for Genome-Wide Association Studies Statistical Power of Model Selection Strategies for Genome-Wide Association Studies Zheyang Wu 1, Hongyu Zhao 1,2 * 1 Department of Epidemiology and Public Health, Yale University School of Medicine, New

More information

The supplementary document of LLR: A latent low-rank approach to colocalizing genetic risk variants in multiple GWAS

The supplementary document of LLR: A latent low-rank approach to colocalizing genetic risk variants in multiple GWAS The supplementary document of LLR: A latent low-rank approach to colocalizing genetic risk variants in multiple GWAS Jin Liu 1, Xiang Wan 2, Chaolong Wang 3, Chao Yang 4, Xiaowei Zhou 5, and Can Yang 6

More information

1 Preliminary Variance component test in GLM Mediation Analysis... 3

1 Preliminary Variance component test in GLM Mediation Analysis... 3 Honglang Wang Depart. of Stat. & Prob. wangho16@msu.edu Omics Data Integration Statistical Genetics/Genomics Journal Club Summary and discussion of Joint Analysis of SNP and Gene Expression Data in Genetic

More information

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS

CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Hung Huang and Dr. Chengkai Li at UT Arlington Mingon Kang, Ph.D. Computer Science, Kennesaw State University Problems

More information

Case-Control Association Testing. Case-Control Association Testing

Case-Control Association Testing. Case-Control Association Testing Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies

More information

A differential equation model for functional mapping of a virus-cell dynamic system

A differential equation model for functional mapping of a virus-cell dynamic system J. Math. Biol. DOI 10.1007/s00285-009-0288-1 Mathematical Biology A differential equation model for functional mapping of a virus-cell dynamic system Jiangtao Luo William W. Hager Rongling Wu Received:

More information

A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding

A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Professur Pflanzenzüchtung Professur Pflanzenzüchtung A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Jens Léon 4. November 2014, Oulu Workshop

More information