Population Genetics II (Selection + Haplotype analyses)
|
|
- Gregory Evans
- 5 years ago
- Views:
Transcription
1 26 th Oct 2015 Poulation Genetics II (Selection + Halotye analyses) Gurinder Singh Mickey twal Center for Quantitative iology
2 Natural Selection Model (Molecular Evolution) llele frequency Embryos Selection dults llele frequency One generation
3 Examle of natural selection in mice Day 5 after fertilization of egg 53+/+ 53-/- 53-/- +LIF injection Imlantation sites Hu et al (2007) Genotye of C57L/6J mice Male Female LIF injection Imlantation sites (verage±se) Number of recovered blastocysts (verage±se) +/+ +/ ± /- -/ ± ± /- -/- + 7± ±0.6 3 n
4 Hardy Weinberg Law Consider 2 alleles (,a) with frequency llele frequency of = llele frequency of a = q = 1- Randomly-mating large diloid oulation with no mutation, migration, selection and drift Genotye a aa Hardy- Weinberg Frequency 2 2q q 2
5 Fitness Genotye a aa Newborn frequency 2 2q q 2 Fitness w w a w aa Relative fitness Frequency after selection w w = 1 w w a 2 s q 1 2 w 1 hs 2 q 1 w w waa = 1 hs = 1 s w s = selection coefficient (relative viability of over aa) h = heterozygous effect w = mean relative fitness
6 Mean Relative Fitness of Poulation 2 mean fitness = w = w + 2qw + a q 2 w aa mean relative fitness = w = w w w 2 = 1 2qhs q s w "1 Genetic Load = L = 1- w 0 " L "1
7 Heterozygous advantage h=0 dominant, a recessive h=1 recessive, a dominant 0<h<1 incomlete dominance h<0 overdominance h>1 underdominance h determines the equilibrium allele frequency s determines how fast the equilibrium is achieved
8 Fundamental Theorem of Natural Selection R. Fisher, 1958 Change of mean fitness is roortional to additive genetic variance w' w = qs 2w 2 w ' =fitness in next generation
9 Tyes of selection Directional selection (0<h<1) causes to go to 1 conventional Darwinian natural selection alancing selection (h<0) cause to go to some equilibrium value e e.g. heterozygous variant of H gene confers resistance to malaria athogen (Plasmodium falciarum) Disrutive selection (h>1) if < e then goes to 0 if > e then goes to 1
10 Examle of human directional selection P C Sabeti et al. Science 2006;312: The FY * O allele in the romotor gene of Duffy antigen gene, which confers resistance to Plasmodium vivax malaria, is revalent and even fixed in many frican oulations
11 What about drift? Very imortant in small oulations. Deends on relative ratios of s and 1/2N e.g. allele has a selective advantage over allele a with selection coefficient s w w aa = 1 s In an initial oulation entirely consisting of aa genotyes, robability of new mutant fixing In an initial oulation entirely consisting of genotyes, robability of new mutant a fixing = 1 1 e e e e s = 2Ns s 2Ns 1 1 > 0 Therefore, even deleterious alleles can fixate in a small oulation!
12 Detecting Natural Selection in the Human Genome e.g. McDonald- Kreitman test e.g. Tajima D test P C Sabeti et al. Science 2006;312: Choice of selection test deends on the time scale of evolution
13 HPLOTYPE STUDIES
14 Halotye Ø Sequence of contiguous SNP alleles on a chromatid Ø Hard to determine directly across whole genome Ø Usually only the genotyes are rovided, giving ambiguous halotyes Ø Halotyes usually inferred ( hased ) by statistical comutation Ø Newer exerimental methods can directly hase halotyes, but are costly
15 Tyical Results of Genotye ssays SNPS Cell Lines / Patients 6023 T/T G/G / C/C / / C/C G/G C/C G/G 6031 T/T G/G / C/C / / C/G G/G C/C G/G 6032 C/C / C/C T/T C/C C/C C/G / G/G / 6033 C/T /G /C C/T /C /C C/G /G C/G /G 6034 T/T G/G / C/C / / C/G G/G C/C G/G 6046 T/T G/G / C/C / / C/G G/G C/C G/G 6047 C/T /G /C C/T /C /C C/C /G C/G /G 6048 C/T /G /C C/T /C /C C/G /G C/G /G 6053 C/C / / T/T C/C C/C C/G / G/G / 6054 T/T G/G / C/C / / C/G G/G C/C G/G 6055 C/T /G /C failed /C /C C/G /G C/G /G 6056 C/T /G /C C/T /C /C C/G /G C/G /G 6057 C/T /G /C C/T /C /C C/G /G C/G /G 6060 C/T /G /C C/T /C /C failed /G C/G /G 6061 C/C / C/C T/T C/C C/C C/G / G/G / 6067 T/T G/G / C/C / / C/C G/G C/C G/G
16 Linkage Disequilibrium Ø Linkage Disequilibrium (LD) = correlation of nucleotide alleles at different loci across the oulation l On average, there is strong LD between nearby alleles on the same chromosome Ø Linkage Equilibrium = random association (indeendence) of alleles at different loci across the oulation Ø LD reflects many factors of oulation history Ø LD ermits us to use roxy SNPs as diagnostic biomarkers for disease-causing mutations
17 Poulation history and SNP correlations Present day chromosomes Mutations occurring at various times of oulation history Neutral mutation Disease mutation resent time ast
18 New halotyes generated by mutations and C Locus 1 Locus 2 T ncestral chromosome with two loci shown C T T Mutation at locus 1 C C T T G Mutation at locus 2 on ancestral chromosome
19 intra-chromosomal recombination efore recombination C C T T G Halotye 1 Halotye 2 Halotye 3 fter recombination C C T T G G recombination between halotyes 2 and 3 generates a new halotye from existing mutations
20 Quantifying linkage disequilibrium Ø From the oulation halotye frequencies we can calculate the correlations between SNPs. Ø Commonly used LD summaries l D l Lewontin s D l r 2
21 Halotye frequencies Halotye with 2 SNPs /a /b LOCUS 2 llele llele b Totals llele b LOCUS 1 llele a a ab a Totals b 1.0
22 Linkage Equilibrium definition ) )(1 (1 ) (1 ) (1 b a ab a a b b = = = = Random association of alleles Exected for SNPs at distant loci
23 Linkage Disequilibrium definition ) )(1 (1 ) (1 ) (1 b a ab a a b b Non-random association of alleles Exected for SNPs at nearby loci
24 LD measure : D Deviation from linkage equilibrium D = Thus it can be shown that all 4 of the 2-SNP halotye frequencies can be exressed in terms of D, and only. i.e., a b ab = + D = (1 ) D = (1 ) D = (1 )(1 ) + D Note also, D = ab b a
25 LD measure : Lewontin s D Normalized version of D: D ' = D D max where D max is given by D = max min[ min[ b,, a a b ] ] if D>0 if D<0 D ranges between -1 and 1 directly related to recombination fraction D=0 if linkage equilibrium D =1 if only 2 or 3 halotyes are resent out of the ossible 4 D uwardly biased in small samles
26 LD measure : r 2 Square of the correlation coefficient r 2 = D a 2 b ranges between 0 and 1 useful in association maing r 2 =0 if linkage equilibrium r 2 =1 if only 2 halotyes are resent roortional to mutual information between 2 loci when D small
27 Factors affecting Linkage Disequilibrium Increases LD Ø Finite Samling (Drift) Ø Demograhic bottleneck Ø Selection Ø Emigration Decreases LD Ø Immigration Ø Recombination decreases number (or variability) of halotyes increases number (or variability) of halotyes
28 How does LD decay over time? Ø Recombination reduces correlation between SNPs Halotye frequencies at time t P a a b b P b P a P ab
29 Decay of linkage disequilibrium in large oulation Ø The frequency of in the new generation (time t+1) will deend on the frequencies of, a, and b in the old generation (time t) and also the recombination rate, c t+ 1 = = = (1 (1 t c) c) t t cd t + + c c t ( t t D ) t Therefore, D t+ 1 = D t (1 c) D t+ n = D t (1 c) n D t ex( cn) (at large times)
30 Different oulations exhibit characteristic LD decay across the genome Caucasian frican-merican sian Yoruban Mean D' , , ,000 Distance (b) Gabriel et al, 2002
31 Finite oulation size : Recombination-Drift Equilibrium Ø Rate of decay of LD by recombination is cancelled out by rate of increase of LD by drift r 2! N e cd N e = effective oulation size (~10,000 for humans) c = recombination rate (er base-air) d = distance across genome (base-airs) 1 N e = 1 T! # " N 1 N 2 N T $ & % Note that N e will be dominated by the times when oulation sizes are reduced (oulation bottleneck)
Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination)
12/5/14 Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) Linkage Disequilibrium Genealogical Interpretation of LD Association Mapping 1 Linkage and Recombination v linkage equilibrium ²
More informationSolutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin
Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin CHAPTER 1 1.2 The expected homozygosity, given allele
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationMCVEAN (2002) showed that predictions for r 2,a
oyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.108.092270 Note The Influence of Gene onversion on Linkage Diseuilibrium Around a Selective Swee Danielle A. Jones 1 and John Wakeley
More informationNeutral Theory of Molecular Evolution
Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation
More informationIntroduction to Linkage Disequilibrium
Introduction to September 10, 2014 Suppose we have two genes on a single chromosome gene A and gene B such that each gene has only two alleles Aalleles : A 1 and A 2 Balleles : B 1 and B 2 Suppose we have
More informationProblems for 3505 (2011)
Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 009 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationPopulation Genetics. with implications for Linkage Disequilibrium. Chiara Sabatti, Human Genetics 6357a Gonda
1 Population Genetics with implications for Linkage Disequilibrium Chiara Sabatti, Human Genetics 6357a Gonda csabatti@mednet.ucla.edu 2 Hardy-Weinberg Hypotheses: infinite populations; no inbreeding;
More informationLecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationMechanisms of Evolution Microevolution. Key Concepts. Population Genetics
Mechanisms of Evolution Microevolution Population Genetics Key Concepts 23.1: Population genetics provides a foundation for studying evolution 23.2: Mutation and sexual recombination produce the variation
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationNatural Selection. DNA encodes information that interacts with the environment to influence phenotype
Natural Selection DN encodes information that interacts with the environment to influence phenotype mong The Traits That Can Be Influenced By Genetically Determined Responses to the Environment re: 1.
More informationBIOL Evolution. Lecture 9
BIOL 432 - Evolution Lecture 9 J Krause et al. Nature 000, 1-4 (2010) doi:10.1038/nature08976 Selection http://www.youtube.com/watch?v=a38k mj0amhc&feature=playlist&p=61e033 F110013706&index=0&playnext=1
More informationEXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?
Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population
More informationTutorial on Theoretical Population Genetics
Tutorial on Theoretical Population Genetics Joe Felsenstein Department of Genome Sciences and Department of Biology University of Washington, Seattle Tutorial on Theoretical Population Genetics p.1/40
More informationA. Correct! Genetically a female is XX, and has 22 pairs of autosomes.
MCAT Biology - Problem Drill 08: Meiosis and Genetic Variability Question No. 1 of 10 1. A human female has pairs of autosomes and her sex chromosomes are. Question #01 (A) 22, XX. (B) 23, X. (C) 23, XX.
More informationACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying
More informationMicroevolution 2 mutation & migration
Microevolution 2 mutation & migration Assumptions of Hardy-Weinberg equilibrium 1. Mating is random 2. Population size is infinite (i.e., no genetic drift) 3. No migration 4. No mutation 5. No selection
More informationFor 5% confidence χ 2 with 1 degree of freedom should exceed 3.841, so there is clear evidence for disequilibrium between S and M.
STAT 550 Howework 6 Anton Amirov 1. This question relates to the same study you saw in Homework-4, by Dr. Arno Motulsky and coworkers, and published in Thompson et al. (1988; Am.J.Hum.Genet, 42, 113-124).
More informationList the five conditions that can disturb genetic equilibrium in a population.(10)
List the five conditions that can disturb genetic equilibrium in a population.(10) The five conditions are non-random mating, small population size, immigration or emigration, mutations, and natural selection.
More information(Write your name on every page. One point will be deducted for every page without your name!)
POPULATION GENETICS AND MICROEVOLUTIONARY THEORY FINAL EXAMINATION (Write your name on every page. One point will be deducted for every page without your name!) 1. Briefly define (5 points each): a) Average
More informationAP Biology Evolution Review Slides
AP Biology Evolution Review Slides How would one go about studying the evolution of a tetrapod limb from a fish s fin? Compare limb/fin structure of existing related species of fish to tetrapods Figure
More informationEvolutionary Genetics Midterm 2008
Student # Signature The Rules: (1) Before you start, make sure you ve got all six pages of the exam, and write your name legibly on each page. P1: /10 P2: /10 P3: /12 P4: /18 P5: /23 P6: /12 TOT: /85 (2)
More informationPerplexing Observations. Today: Thinking About Darwinian Evolution. We owe much of our understanding of EVOLUTION to CHARLES DARWIN.
Today: Thinking About Darwinian Evolution Part 1: Darwin s Theory Perplexing Observations Mystery of the Black Death?? What is evolution?? And what is this finch doing?!? We owe much of our understanding
More informationEvolution of Populations. Chapter 17
Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New
More information19. Genetic Drift. The biological context. There are four basic consequences of genetic drift:
9. Genetic Drift Genetic drift is the alteration of gene frequencies due to sampling variation from one generation to the next. It operates to some degree in all finite populations, but can be significant
More informationClassical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
More informationGenetic variation of polygenic characters and the evolution of genetic degeneracy
Genetic variation of olygenic characters and the evolution of genetic degeneracy S. A. FRANK Deartment of Ecology and Evolutionary Biology, University of California, Irvine, CA, USA Keywords: mutation;
More informationPopulation Genetics: a tutorial
: a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development
More informationDarwinian Selection. Chapter 7 Selection I 12/5/14. v evolution vs. natural selection? v evolution. v natural selection
Chapter 7 Selection I Selection in Haploids Selection in Diploids Mutation-Selection Balance Darwinian Selection v evolution vs. natural selection? v evolution ² descent with modification ² change in allele
More informationCase-Control Association Testing. Case-Control Association Testing
Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 013 Population genetics Outline of lectures 3-6 1. We ant to kno hat theory says about the reproduction of genotypes in a population. This results
More information7. Tests for selection
Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info
More informationUNIT 8 BIOLOGY: Meiosis and Heredity Page 148
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular
More informationGenetical theory of natural selection
Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in
More informationQuestion: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?
October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:
More information1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:
.5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the
More informationNOTES CH 17 Evolution of. Populations
NOTES CH 17 Evolution of Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Populations 17.1 Genes & Variation Darwin
More informationAllele Frequency Estimation
Allele Frequency Estimation Examle: ABO blood tyes ABO genetic locus exhibits three alleles: A, B, and O Four henotyes: A, B, AB, and O Genotye A/A A/O A/B B/B B/O O/O Phenotye A A AB B B O Data: Observed
More informationMicroevolution Changing Allele Frequencies
Microevolution Changing Allele Frequencies Evolution Evolution is defined as a change in the inherited characteristics of biological populations over successive generations. Microevolution involves the
More informationIntroduction to Natural Selection. Ryan Hernandez Tim O Connor
Introduction to Natural Selection Ryan Hernandez Tim O Connor 1 Goals Learn about the population genetics of natural selection How to write a simple simulation with natural selection 2 Basic Biology genome
More informationLECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50
LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if
More informationBustamante et al., Supplementary Nature Manuscript # 1 out of 9 Information #
Bustamante et al., Supplementary Nature Manuscript # 1 out of 9 Details of PRF Methodology In the Poisson Random Field PRF) model, it is assumed that non-synonymous mutations at a given gene are either
More informationURN MODELS: the Ewens Sampling Lemma
Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 3, 2014 1 2 3 4 Mutation Mutation: typical values for parameters Equilibrium Probability of fixation 5 6 Ewens Sampling
More informationLecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency
Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Outline Genetics of complex
More informationIntroduction to Advanced Population Genetics
Introduction to Advanced Population Genetics Learning Objectives Describe the basic model of human evolutionary history Describe the key evolutionary forces How demography can influence the site frequency
More informationFunctional divergence 1: FFTNS and Shifting balance theory
Functional divergence 1: FFTNS and Shifting balance theory There is no conflict between neutralists and selectionists on the role of natural selection: Natural selection is the only explanation for adaptation
More informationParts 2. Modeling chromosome segregation
Genome 371, Autumn 2018 Quiz Section 2 Meiosis Goals: To increase your familiarity with the molecular control of meiosis, outcomes of meiosis, and the important role of crossing over in generating genetic
More informationLinkage and Linkage Disequilibrium
Linkage and Linkage Disequilibrium Summer Institute in Statistical Genetics 2014 Module 10 Topic 3 Linkage in a simple genetic cross Linkage In the early 1900 s Bateson and Punnet conducted genetic studies
More informationBig Idea #1: The process of evolution drives the diversity and unity of life
BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility
More informationGenetics and Natural Selection
Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.
More informationMutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution
Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.
More informationTHEORETICAL EVOLUTIONARY GENETICS JOSEPH FELSENSTEIN
THEORETICAL EVOLUTIONARY GENETICS JOSEPH FELSENSTEIN Theoretical Evolutionary Genetics GENOME 562 Joseph Felsenstein Department of Genome Sciences University of Washington Box 357730 Seattle, Washington
More informationp(d g A,g B )p(g B ), g B
Supplementary Note Marginal effects for two-locus models Here we derive the marginal effect size of the three models given in Figure 1 of the main text. For each model we assume the two loci (A and B)
More informationEvidence of Evolution
Evidence of Evolution Biogeography The Age of Earth and Fossils Ancient artiodactyl Modern whale Ancestors of Whales Ambulocetus could both swim in shallow water and walk on land. Rodhocetus probably spent
More informationF SR = (H R H S)/H R. Frequency of A Frequency of a Population Population
Hierarchical structure, F-statistics, Wahlund effect, Inbreeding, Inbreeding coefficient Genetic difference: the difference of allele frequencies among the subpopulations Hierarchical population structure
More informationLife Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
More informationHow robust are the predictions of the W-F Model?
How robust are the predictions of the W-F Model? As simplistic as the Wright-Fisher model may be, it accurately describes the behavior of many other models incorporating additional complexity. Many population
More informationD. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
More informationSelection and Population Genetics
Selection and Population Genetics Evolution by natural selection can occur when three conditions are satisfied: Variation within populations - individuals have different traits (phenotypes). height and
More informationChapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species
Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify
More informationLearning gene regulatory networks Statistical methods for haplotype inference Part I
Learning gene regulatory networks Statistical methods for haplotype inference Part I Input: Measurement of mrn levels of all genes from microarray or rna sequencing Samples (e.g. 200 patients with lung
More informationWhen one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationLecture 14 Chapter 11 Biology 5865 Conservation Biology. Problems of Small Populations Population Viability Analysis
Lecture 14 Chapter 11 Biology 5865 Conservation Biology Problems of Small Populations Population Viability Analysis Minimum Viable Population (MVP) Schaffer (1981) MVP- A minimum viable population for
More informationEffective population size and patterns of molecular evolution and variation
FunDamental concepts in genetics Effective population size and patterns of molecular evolution and variation Brian Charlesworth Abstract The effective size of a population,, determines the rate of change
More informationQ1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate.
OEB 242 Exam Practice Problems Answer Key Q1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate. First, recall
More informationParts 2. Modeling chromosome segregation
Genome 371, Autumn 2017 Quiz Section 2 Meiosis Goals: To increase your familiarity with the molecular control of meiosis, outcomes of meiosis, and the important role of crossing over in generating genetic
More informationTests for Two Proportions in a Stratified Design (Cochran/Mantel-Haenszel Test)
Chater 225 Tests for Two Proortions in a Stratified Design (Cochran/Mantel-Haenszel Test) Introduction In a stratified design, the subects are selected from two or more strata which are formed from imortant
More informationInbreeding depression due to stabilizing selection on a quantitative character. Emmanuelle Porcher & Russell Lande
Inbreeding depression due to stabilizing selection on a quantitative character Emmanuelle Porcher & Russell Lande Inbreeding depression Reduction in fitness of inbred vs. outbred individuals Outcrossed
More informationLong-Term Response and Selection limits
Long-Term Response and Selection limits Bruce Walsh lecture notes Uppsala EQG 2012 course version 5 Feb 2012 Detailed reading: online chapters 23, 24 Idealized Long-term Response in a Large Population
More informationApplication Evolution: Part 1.1 Basics of Coevolution Dynamics
Application Evolution: Part 1.1 Basics of Coevolution Dynamics S. chilense S. peruvianum Summer Semester 2013 Prof Aurélien Tellier FG Populationsgenetik Color code Color code: Red = Important result or
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationIntroduction to Probability and Statistics
Introduction to Probability and Statistics Chater 8 Ammar M. Sarhan, asarhan@mathstat.dal.ca Deartment of Mathematics and Statistics, Dalhousie University Fall Semester 28 Chater 8 Tests of Hyotheses Based
More informationFriday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo
Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization
More informationUNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology
UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance
More informationChapter 13 Meiosis and Sexual Reproduction
Biology 110 Sec. 11 J. Greg Doheny Chapter 13 Meiosis and Sexual Reproduction Quiz Questions: 1. What word do you use to describe a chromosome or gene allele that we inherit from our Mother? From our Father?
More informationSegregation versus mitotic recombination APPENDIX
APPENDIX Waiting time until the first successful mutation The first time lag, T 1, is the waiting time until the first successful mutant appears, creating an Aa individual within a population composed
More informationThe Wright-Fisher Model and Genetic Drift
The Wright-Fisher Model and Genetic Drift January 22, 2015 1 1 Hardy-Weinberg Equilibrium Our goal is to understand the dynamics of allele and genotype frequencies in an infinite, randomlymating population
More informationSTAT 536: Migration. Karin S. Dorman. October 3, Department of Statistics Iowa State University
STAT 536: Migration Karin S. Dorman Department of Statistics Iowa State University October 3, 2006 Migration Introduction Migration is the movement of individuals between populations. Until now we have
More informationThe Mechanisms of Evolution
The Mechanisms of Evolution Figure.1 Darwin and the Voyage of the Beagle (Part 1) 2/8/2006 Dr. Michod Intro Biology 182 (PP 3) 4 The Mechanisms of Evolution Charles Darwin s Theory of Evolution Genetic
More information(Genome-wide) association analysis
(Genome-wide) association analysis 1 Key concepts Mapping QTL by association relies on linkage disequilibrium in the population; LD can be caused by close linkage between a QTL and marker (= good) or by
More information4. Populationsgenetik
4. Populationsgenetik Populations are never uniform, but individuals differ genetically and phenotypically. Population genetics is concerned with the study of the genetic composition of populations and
More informationChapter 17: Population Genetics and Speciation
Chapter 17: Population Genetics and Speciation Section 1: Genetic Variation Population Genetics: Normal Distribution: a line graph showing the general trends in a set of data of which most values are near
More informationIs there any difference between adaptation fueled by standing genetic variation and adaptation fueled by new (de novo) mutations?
Visualizing evolution as it happens Spatiotemporal microbial evolution on antibiotic landscapes Michael Baym, Tami D. Lieberman,*, Eric D. Kelsic, Remy Chait, Rotem Gross, Idan Yelin, Roy Kishony Science
More informationD. Gordon, M.A. Levenstien, S.J. Finch, J. Ott. Pacific Symposium on Biocomputing 8: (2003)
Errors and Linkage Disequilibrium Interact Multilicatively Wen Comuting Samle Sizes for Genetic Case-Control Association Studies D. Gordon, M.A. Levenstien, S.J. Finc, J. Ott Pacific Symosium on Biocomuting
More informationLinking levels of selection with genetic modifiers
Linking levels of selection with genetic modifiers Sally Otto Department of Zoology & Biodiversity Research Centre University of British Columbia @sarperotto @sse_evolution @sse.evolution Sally Otto Department
More informationIntroductory seminar on mathematical population genetics
Exercises Sheets Introductory seminar on mathematical population genetics WS 20/202 Kristan Schneider, Ada Akerman Ex Assume a single locus with alleles A and A 2 Denote the frequencies of the three (unordered
More information1. Understand the methods for analyzing population structure in genomes
MSCBIO 2070/02-710: Computational Genomics, Spring 2016 HW3: Population Genetics Due: 24:00 EST, April 4, 2016 by autolab Your goals in this assignment are to 1. Understand the methods for analyzing population
More informationLecture 2. Basic Population and Quantitative Genetics
Lecture Basic Population and Quantitative Genetics Bruce Walsh. Aug 003. Nordic Summer Course Allele and Genotype Frequencies The frequency p i for allele A i is just the frequency of A i A i homozygotes
More information8. Genetic Diversity
8. Genetic Diversity Many ways to measure the diversity of a population: For any measure of diversity, we expect an estimate to be: when only one kind of object is present; low when >1 kind of objects
More informationProportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power
Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion
More informationASSOCIATION ANALYSES of the MAS-QTL DATA SET using GRAMMAR, PRINCIPAL COMPONENTS and BAYESIAN NETWORK METHODOLOGIES
OSL ASSOCATO AALYSS of the MAS-QTL DATA ST using GAMMA, PCPAL COMPOTS and BAYSA TWOK MTODOLOGS Burak Karacaören, Tomi Silander, José M. Álvarez- Castro, Chris S. aley, Dirk Jan de Koning OSL STTT and (D)SVS,
More informationLesson 2 Evolution of population (microevolution)
Lesson 2 Evolution of population (microevolution) 1. A gene pool consists of a. all the aleles exposed to natural selection. b. the total of all alleles present in a population. c. the entire genome of
More informationAUTHORIZATION TO LEND AND REPRODUCE THE THESIS. Date Jong Wha Joanne Joo, Author
AUTHORIZATION TO LEND AND REPRODUCE THE THESIS As the sole author of this thesis, I authorize Brown University to lend it to other institutions or individuals for the purpose of scholarly research. Date
More informationPOPULATIONS. p t+1 = p t (1-u) + q t (v) p t+1 = p t (1-u) + (1-p t ) (v) Phenotypic Evolution: Process HOW DOES MUTATION CHANGE ALLELE FREQUENCIES?
Phenotypic Evolution: Process MUTATION SELECTION + POPULATIONS +/ MIGRATION DRIFT HOW DOES MUTATION CHANGE ALLELE FREQUENCIES? Assume: a single autosomal locus with 2 alleles. Frequency (A) = p Frequency
More informationThe E-M Algorithm in Genetics. Biostatistics 666 Lecture 8
The E-M Algorithm in Genetics Biostatistics 666 Lecture 8 Maximum Likelihood Estimation of Allele Frequencies Find parameter estimates which make observed data most likely General approach, as long as
More informationProcesses of Evolution
Processes of Evolution Microevolution Processes of Microevolution How Species Arise Macroevolution Microevolution Population: localized group of individuals belonging to the same species with the potential
More information