NMR Structures in the Cloud Validation & Improvement
|
|
|
- Augustine Simmons
- 5 years ago
- Views:
Transcription
1 NMR Structures in the Cloud Validation & Improvement Centre for Molecular & Biomolecular Informatics Jurgen F. Doreleijers, Geerten W. Vuister, Gert Vriend
2 Outline of the talk Introduction CING: a structure validation framework NRG-CING: validation on public structures Overview statistics Leucine dynamics Proline chemical shift validation NMR_REDO: improving public structures (prelim.)
3 Outline of the talk Introduction CING: a structure validation framework NRG-CING: validation on public NMR data
4 Structure validation Dynein Light Chain 2A (DLC2A) 1Y4O 1TGQ (retracted)
5 Structure validation Criteria Characteristic 1TGQ (Refined) Agreement with experimental data PROCHECK validation results a WHAT IF structure Z-scores b RMS violation 1Y4O distance restraints (Å) Violations.0.5 Å 1Y4O distance restraints RMS violation 1TGQ sim restraints (Å) Violations.0.5 Å 1TGQ sim restraints RMS violation 1Y4O dihedral restraints (8) Violations.58 1Y4O dihedral restraints Most favored regions Additionally allowed regions Generously allowed regions Disallowed regions Packing quality Ramachandran plot appearance v 1 /v 2 rotamer normality Backbone conformation
6 Structure validation Criteria Characteristic 1TGQ (Refined) Agreement with experimental data PROCHECK validation results a WHAT IF structure Z-scores b RMS violation 1Y4O distance restraints (Å) Violations.0.5 Å 1Y4O distance restraints RMS violation 1TGQ sim restraints (Å) Violations.0.5 Å 1TGQ sim restraints RMS violation 1Y4O dihedral restraints (8) Violations.58 1Y4O dihedral restraints Most favored regions Additionally allowed regions Generously allowed regions Disallowed regions Packing quality Ramachandran plot appearance v 1 /v 2 rotamer normality Backbone conformation This structure is most likely ok!
7 Outline of the talk Introduction CING: a structure validation framework NRG-CING: validation on public NMR data
8 CING: Common Interface for NMR structure Generation User friendly interface to WHAT IF, PROCHECK, Aqua, SHIFTX, Wattos, DSSP... results and reports. Residue oriented Validation and data together Hyperlinked HTML Color-coded (red, orange, green) (ROG-score) Automated export to multiple formats API to experimental data, the structure ensemble, analysis and validation results NMR aware Doreleijers et al., J.Biomol. NMR, accepted!
9 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables
10 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables
11 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables Navigation
12 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables Annotation Navigation
13 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables Annotation Navigation Structural results Talos+ dihedral restraints
14 CING: HTML output All information is linked: structural data, restraints, peaks, chemical shifts, validation data Web 2.0 (Java): search, sort tables Annotation Navigation Restraints Structural results Talos+ dihedral restraints
15 CING: checks Correction of minor errors; e.g. nomenclature. Validation of resonance assignments. Validation of experimental restraints. Validation of stereochemical quality. Validation of structural quality. Analysis of structural results.
16 CING: ROG color coding ROG Color coding: Contains several parameters: backbone and sidechain green: good red: bad orange: potential problems
17 CING: ROG color coding 16% 16% 57% 27% 30% 54% 1Y4O 1TGQ (retracted)
18 Residue-specific Procheck_NMR G-factor G-factor Y4O
19 Residue-specific Procheck_NMR G-factor G-factor Y4O 1TGQ
20 CING: back-calculated chemical shifts shiftx: Q = RMS(δ shiftx - δ measured )/RMS(δ measured ) Qbb Y4O 1TGQ (retracted)
21 CING: checks Correction of minor errors; e.g. nomenclature. Validation of resonance assignments. Validation of experimental restraints. Validation of stereochemical quality. Validation of structural quality. Whatif Procheck_NMR CING Analysis of structural results.
22 WHATIF 8.0 backbone normality check Has become rather useless!
23 CING: dihedral overview plots Per residue Ramachandran/Janin/Cb4N-Cb4C
24 CING: dihedral overview plots Per residue Ramachandran/Janin/Cb4N-Cb4C
25 CING residue-specific overview plots Ramandran, Janin, C4b Z-scores
26 CING residue-specific overview plots CV/Rmsd s
27 CING residue-specific overview plots Molecule page
28 Outline of the talk Introduction CING: a structure validation framework NRG-CING: validation on public structures Overview statistics Leucine dynamics Proline chemical shift validation NMR_REDO: improving public structures (prelim.)
29 NRG-CING Converted NRG NMR restraints, structures and chemical shifts. Import as CCPN projects 9,569 entries (>95% of NMR entries) Doreleijers et al., J.Biomol. NMR, 2009 Doreleijers et al. NAR,
30 NRG preamble
31 NRG-CING: results Frequency Protein size (# residues)
32 NRG-CING: results Average: 92 Frequency Protein size (# residues)
33 NRG-CING: results Frequency # of models
34 NRG-CING: results Most often occurring: 20 Frequency # of models
35 NRG-CING: results Distance restraints Frequency Average # distance restraints per residue
36 NRG-CING: results Distance restraints 15 restraints per residue Frequency Average # distance restraints per residue
37 NRG-CING: results Distance restraints Frequency Completeness per residue
38 NRG-CING: results Distance restraints ~50% completion Frequency Completeness per residue
39 NRG-CING: results Dihedral restraints Frequency Average # dihedral restraints per residue
40 NRG-CING: results Dihedral restraints 1.1 restraints per residue Frequency Average # dihedral restraints per residue
41 NRG-CING: results Dihedral restraints Frequency # Dihedral restraints per residue
42 NRG-CING: results Dihedral restraints 2 restraints per residue Talos? Frequency # Dihedral restraints per residue
43 NRG-CING: results RDC restraints Frequency Average # RDC restraints per residue
44 NRG-CING: results RDC restraints 1.2 restraints per residue Frequency Average # RDC restraints per residue
45 NRG-CING: results Quality Frequency Per residue WHATIF QualityCheck
46 NMR Quality Ramachandran structure Z-score Year of deposition
47 NRG-CING: results fine green (%) problematic red (%)
48 NRG-CING: results fine green (%) 60 Vuister et al, problematic 1HKT 18% 20 1HKT 19% 63% red (%)
49 NRG-CING: results ROG green (%) Procheck most favorite (%)
50 NRG-CING: results ROG green (%) Procheck most favorite (%)
51 Leucine averaging NCX1-CBD2 Leu589 ensemble CD2 CD1 X-ray
52 CBD2 χ 2 gauche - (-60 ) χ 2 gauche + (60 ) χ 2 trans (180 )
53 Relative occurrence Effects of dynamics χ 2 gauche - (-60 ) Resolution (Å) χ 2 gauche + (60 ) χ 2 trans (180 )
54 Effects of dynamics CING Janin plot 3 JC α C δ1 (Hz) 3 JC α C δ2 (Hz) Leu Leu Leu (-60,180) Leu Leu Leu (180, 60) Leu
55 Effects of dynamics 3 JC α C δ1 (Hz) 3 JC α C δ2 (Hz) Leu CING Janin plot C δ2 C α H ϒ Leu Leu Leu H β3 C δ1 H β2 (-60,180) Leu Leu (180, 60) Leu
56 Effects of dynamics 3 JC α C δ1 (Hz) 3 JC α C δ2 (Hz) Leu CING Janin plot C δ2 C α H ϒ Leu Leu Leu H β3 C δ1 H β2 (-60,180) Leu Leu (180, 60) Leu C α H ϒ C δ1 H β3 C δ2 H β2
57 Effects of dynamics 3 JC α C δ1 (Hz) 3 JC α C δ2 (Hz) Leu CING Janin plot C δ2 C α H ϒ Leu Leu Leu H β3 C δ1 H β2 (-60,180) Leu Leu (180, 60) Leu C α H ϒ C δ1 H β3 C δ2 H β2
58 Effects of dynamics CING Janin plot Leu: Δδ = δc δ1 -C δ2 Δδ = [+0.5,+6] ppm (n=26) Δδ = [-3.5,-2] ppm (n=5) (-60,180) Leu589 Δδ = -0.5 ppm (180, 60) (Nice analysis published by Dr. Frans Mulder et al.)
59 Effects of dynamics NRG-CING Leucine conformations
60 Effects of dynamics NRG-CING Leucine conformations
61 Effects of dynamics NRG-CING Leucine conformations 8.3%
62 Effects of dynamics Deleted Combined
63 Proline chemical shifts Schubert et al. J Biomol NMR (2002) vol. 24 (2) p.
64 Proline chemical shifts 33 cis & 1,000 trans Pro (no paramagnetic) CSD = Cβ-Cγ In NRG-CING we have 228 cis and 7,949 trans Pro in 3,435 PDB entries with Cβ/Cγ from BMRB From their text: 100% certainty trans [0.0, 4.8] cis [9.15,14.4] In CING conflicts of these ranges are marked as bad.
65 Proline inconsistency CSD <-> conformation pdb c num name name name csd k6z A 14 cpro CB CG xdx B 61 cpro CB CG jaj A 119 cpro CB CG 3 2edx A 22 cpro CB CG ng7 B 17 cpro CB CG yuu B 47 cpro CB CG oy2 A 105 cpro CB CG op4 A 94 cpro CB CG 4.61 cis-pro 8 occurrences trans-pro >100 occurrences pdb c num name name name csd i4k A 71 PRO CB CG zdv A 29 PRO CB CG 36 1zdx A 29 PRO CB CG 36 2kca A 97 PRO CB CG kca A 121 PRO CB CG kca A 89 PRO CB CG kca A 74 PRO CB CG w9r A 35 PRO CB CG kno A 128 PRO CB CG hyj A 52 PRO CB CG ckr A 466 PRO CB CG hsc A 466 PRO CB CG wki A 78 PRO CB CG z9v A 58 PRO CB CG jmf A 524 PRO CB CG khp A 58 PRO CB CG k8s B 57 PRO CB CG gyt A 41 PRO CB CG gdt A 56 PRO CB CG h80 A 46 PRO CB CG jn4 A 58 PRO CB CG jnp A 221 PRO CB CG fvn A 120 PRO CB CG so9 A 117 PRO CB CG sp0 A 117 PRO CB CG iio A 64 PRO CB CG js5 B 34 PRO CB CG gzp A 93 PRO CB CG ija A 33 PRO CB CG h3j A 49 PRO CB CG jov A 49 PRO CB CG 11 2jz4 A 222 PRO CB CG jvo A 38 PRO CB CG u3n A 96 PRO CB CG rzw A 98 PRO CB CG gg1 A 337 PRO CB CG q59 A 37 PRO CB CG akp A 78 PRO CB CG 10.7
66 Folded/Aliased a trans state.
67 Definite outlier a trans state.
68 Outline of the talk Introduction CING: a structure validation framework NRG-CING: validation on public structures Overview statistics Leucine dynamics Proline chemical shift validation NMR_REDO: improving public structures (prelim.)
69 NMR_REDO Improving NMR structures in PDB Extension of our previous projects DRESS (2004) & RECOORD (2005) on 100 & 545 entries Include 413 dimer, 1235 complex, and 384 ligand-containing entries for a total of 5,519 entries with experimental data Exclude nucleic acid and HADDOCK entries Including chemical shift, RDC, symmetry data
70 Sara Cloud Managment Console (Web 2.0) Topos NMR VC vcing Slave VC vcing Slave vcing VC vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread VC vcing Master X vcing Slave vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread vcing SlaveThread
71 NMR_REDO many programs WHAT_CHECK PROCHECK_NMR QUEEN YASARA XPLOR-NIH Wattos Aqua etc...
72 NMR_REDO Clouds available Sara 608 cores (OpenNebula 3) Bitbrains 256 cores WeNMR (INFN, Italy), CONDOR (U.S.A), in-house,... TEST50 done for denied proposal
73 NMR_REDO Setup Remediated CCPN projects from NRG-CING Tight CING Python shell around Xplor-NIH Easy validation between runs Relational database for fast analyses
74 NMR_REDO TEST50 preliminary results Random set of 50 monomeric proteins with distance restraints 200 models annealed 50 models water refined 25 models selected
75 NMR_REDO
76 Conclusions VMs are setup fast with diverse software VMs are available and can be mixed between clouds Validation reports for 9,000+ NMR PDB entries NMR_REDO calculations will be done by Ph.D. student Wouter Touw with help from Profs. Vuister & Vriend
77 CREDITS
Tools for Validation of NMR-Structures
Tools for Validation NMR-Structures Geerten W. Vuister Department Biochemistry, University Leicester Geerten W. Vuister http://proteins.dyndns.org/validation Protein Biophysics, IMM, Radboud University
Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.
HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Feb 17, 2018 01:16 am GMT PDB ID : 1IFT Title : RICIN A-CHAIN (RECOMBINANT) Authors : Weston, S.A.; Tucker, A.D.; Thatcher, D.R.; Derbyshire, D.J.; Pauptit,
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
Useful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
PROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
Secondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
NMR structure determination of a peptide using the ARIA webportal
NMR observables that contain structural information: NMR structure determination of a peptide using the ARIA webportal Atom distances (Nuclear Overhauser Effect) Secondary structure, interaction Chemical
Structural Basis of Multivalent Binding to Wheat Germ Agglutinin
Structural Basis of Multivalent Binding to Wheat Germ Agglutinin David Schwefel, Caroline Maierhofer, Johannes G. Beck, Sonja Seeberger, Kay Diederichs, Heiko M. Möller,*, Wolfram Welte,*, and Valentin
NMR-Structure determination with the program CNS
NMR-Structure determination with the program CNS Blockkurs 2013 Exercise 11.10.2013, room Mango? 1 NMR-Structure determination - Overview Amino acid sequence Topology file nef_seq.mtf loop cns_mtf_atom.id
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy
7.91 Amy Keating Solving structures using X-ray crystallography & NMR spectroscopy How are X-ray crystal structures determined? 1. Grow crystals - structure determination by X-ray crystallography relies
Summary of Experimental Protein Structure Determination. Key Elements
Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion
Introduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
Protein structure analysis. Risto Laakso 10th January 2005
Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM
Chemical Shift Restraints Tools and Methods. Andrea Cavalli
Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods
HTCondor and macromolecular structure validation
HTCondor and macromolecular structure validation Vincent Chen John Markley/Eldon Ulrich, NMRFAM/BMRB, UW@Madison David & Jane Richardson, Duke University Macromolecules David S. Goodsell 1999 Two questions
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 13, 2018 04:03 pm GMT PDB ID : 5NMJ Title : Chicken GRIFIN (crystallisation ph: 6.5) Authors : Ruiz, F.M.; Romero, A. Deposited on : 2017-04-06 Resolution
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 06:13 pm GMT PDB ID : 5G5C Title : Structure of the Pyrococcus furiosus Esterase Pf2001 with space group C2221 Authors : Varejao, N.; Reverter,
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 28, 2019 11:10 AM EST PDB ID : 6A5H Title : The structure of [4+2] and [6+4] cyclase in the biosynthetic pathway of unidentified natural product Authors
Course Notes: Topics in Computational. Structural Biology.
Course Notes: Topics in Computational Structural Biology. Bruce R. Donald June, 2010 Copyright c 2012 Contents 11 Computational Protein Design 1 11.1 Introduction.........................................
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 17, 2019 09:42 AM EST PDB ID : 6D3Z Title : Protease SFTI complex Authors : Law, R.H.P.; Wu, G. Deposited on : 2018-04-17 Resolution : 2.00 Å(reported)
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 10:24 pm GMT PDB ID : 1A30 Title : HIV-1 PROTEASE COMPLEXED WITH A TRIPEPTIDE INHIBITOR Authors : Louis, J.M.; Dyda, F.; Nashed, N.T.; Kimmel,
Structure determination through NMR
Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 14, 2018 02:00 pm GMT PDB ID : 3RRQ Title : Crystal structure of the extracellular domain of human PD-1 Authors : Lazar-Molnar, E.; Ramagopal, U.A.; Nathenson,
Full wwpdb NMR Structure Validation Report i
Full wwpdb NMR Structure Validation Report i Feb 17, 2018 06:22 am GMT PDB ID : 141D Title : SOLUTION STRUCTURE OF A CONSERVED DNA SEQUENCE FROM THE HIV-1 GENOME: RESTRAINED MOLECULAR DYNAMICS SIMU- LATION
Report of protein analysis
Report of protein analysis By the WHAT IF program 2010-09-19 1 Introduction what check is the name of the validation option in what if. It doesn t matter whether you use the what check program or the what
Report of protein analysis
Report of protein analysis By the WHAT IF program 2010-09-19 1 Introduction what check is the name of the validation option in what if. It doesn t matter whether you use the what check program or the what
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 10, 2018 01:44 am GMT PDB ID : 1MWP Title : N-TERMINAL DOMAIN OF THE AMYLOID PRECURSOR PROTEIN Authors : Rossjohn, J.; Cappai, R.; Feil, S.C.; Henry,
Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU
Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO! Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Jan 14, 2019 11:10 AM EST PDB ID : 6GYW Title : Crystal structure of DacA from Staphylococcus aureus Authors : Tosi, T.; Freemont, P.S.; Grundling, A. Deposited
wwpdb X-ray Structure Validation Summary Report
wwpdb X-ray Structure Validation Summary Report io Jan 31, 2016 06:45 PM GMT PDB ID : 1CBS Title : CRYSTAL STRUCTURE OF CELLULAR RETINOIC-ACID-BINDING PROTEINS I AND II IN COMPLEX WITH ALL-TRANS-RETINOIC
Guided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
Full wwpdb X-ray Structure Validation Report i
Full wwpdb X-ray Structure Validation Report i Mar 8, 2018 08:34 pm GMT PDB ID : 1RUT Title : Complex of LMO4 LIM domains 1 and 2 with the ldb1 LID domain Authors : Deane, J.E.; Ryan, D.P.; Maher, M.J.;
Modeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
Supporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
1.b What are current best practices for selecting an initial target ligand atomic model(s) for structure refinement from X-ray diffraction data?!
1.b What are current best practices for selecting an initial target ligand atomic model(s) for structure refinement from X-ray diffraction data?! Visual analysis: Identification of ligand density from
Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana
www.bioinformation.net Hypothesis Volume 6(3) Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana Karim Kherraz*, Khaled Kherraz, Abdelkrim Kameli Biology department, Ecole Normale
Computational Protein Design
11 Computational Protein Design This chapter introduces the automated protein design and experimental validation of a novel designed sequence, as described in Dahiyat and Mayo [1]. 11.1 Introduction Given
Molecular Modeling Lecture 11 side chain modeling rotamers rotamer explorer buried cavities.
Molecular Modeling 218 Lecture 11 side chain modeling rotamers rotamer explorer buried cavities. Sidechain Rotamers Discrete approximation of the continuous space of backbone angles. Sidechain conformations
Molecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
Protein Structures: Experiments and Modeling. Patrice Koehl
Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
Full wwpdb/emdatabank EM Map/Model Validation Report i
Full wwpdb/emdatabank EM Map/Model Validation Report i Sep 25, 2018 07:01 PM EDT PDB ID : 6C0V EMDB ID: : EMD-7325 Title : Molecular structure of human P-glycoprotein in the ATP-bound, outwardfacing conformation
Experimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
X-ray Crystallography I. James Fraser Macromolecluar Interactions BP204
X-ray Crystallography I James Fraser Macromolecluar Interactions BP204 Key take-aways 1. X-ray crystallography results from an ensemble of Billions and Billions of molecules in the crystal 2. Models in
Macromolecular Crystallography Part II
Molecular Biology Course 2009 Macromolecular Crystallography Part II Tim Grüne University of Göttingen Dept. of Structural Chemistry November 2009 http://shelx.uni-ac.gwdg.de tg@shelx.uni-ac.gwdg.de From
Prediction and refinement of NMR structures from sparse experimental data
Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk
Supporting Information
Supporting Information German Edition: DOI: Sampling of Glycan-Bound Conformers by the Anti-HIV Lectin Oscillatoria agardhii agglutinin in the Absence of Sugar** Marta G. Carneiro, Leonardus M. I. Koharudin,
Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
Ramachandran Plot. 4ysz Phi (degrees) Plot statistics
B Ramachandran Plot ~b b 135 b ~b ~l l Psi (degrees) 5-5 a A ~a L - -135 SER HIS (F) 59 (G) SER (B) ~b b LYS ASP ASP 315 13 13 (A) (F) (B) LYS ALA ALA 315 173 (E) 173 (E)(A) ~p p ~b - -135 - -5 5 135 (degrees)
Determination of the structure and dynamics of proteins using NMR chemical shifts (CS) and CS enhanced protein data bank (CS-PDB)
Determination of the structure and dynamics of proteins using NMR chemical shifts (CS) and CS enhanced protein data bank (CS-PDB) Biao Fu The Vendruscolo group, Uni. Of Cambridge Intensive Training Course,
Protein Structure Refinement Using 13 C α Chemical. Shift Tensors. Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M.
Protein Structure Refinement Using 13 C α Chemical Shift Tensors Benjamin J. Wylie, Charles D. Schwieters, Eric Oldfield and Chad M. Rienstra * Department of Chemistry, University of Illinois at Urbana-Champaign,
A new generation of crystallographic validation tools for the Protein Data Bank
A new generation of crystallographic validation tools for the Protein Data Bank Randy J. Read 1,*, Paul D. Adams 2, W. Bryan Arendall III 3, Axel T. Brunger 4, Paul Emsley 5, Robbie P. Joosten 6,7, Gerard
STRUCTURE BASED CHEMICAL SHIFT PREDICTION USING RANDOM FORESTS NON-LINEAR REGRESSION
STRUCTURE BASED CHEMICAL SHIFT PREDICTION USING RANDOM FORESTS NON-LINEAR REGRESSION K. ARUN Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA 15213 E-mail: arunk@andrew.cmu.edu
Protein NMR Structures Refined with Rosetta Have Higher Accuracy Relative to Corresponding X ray Crystal Structures
pubs.acs.org/jacs Protein NMR Structures Refined with Rosetta Have Higher Accuracy Relative to Corresponding X ray Crystal Structures Binchen Mao, Roberto Tejero,, David Baker, and Gaetano T. Montelione*,
Supplemental Information
Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao
Physiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
HSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat
Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry
Protein Modeling. Generating, Evaluating and Refining Protein Homology Models
Protein Modeling Generating, Evaluating and Refining Protein Homology Models Troy Wymore and Kristen Messinger Biomedical Initiatives Group Pittsburgh Supercomputing Center Homology Modeling of Proteins
1. Protein Data Bank (PDB) 1. Protein Data Bank (PDB)
Protein structure databases; visualization; and classifications 1. Introduction to Protein Data Bank (PDB) 2. Free graphic software for 3D structure visualization 3. Hierarchical classification of protein
Practical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
Visualization of Macromolecular Structures
Visualization of Macromolecular Structures Present by: Qihang Li orig. author: O Donoghue, et al. Structural biology is rapidly accumulating a wealth of detailed information. Over 60,000 high-resolution
Molecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007
Molecular Modeling Prediction of Protein 3D Structure from Sequence Vimalkumar Velayudhan Jain Institute of Vocational and Advanced Studies May 21, 2007 Vimalkumar Velayudhan Molecular Modeling 1/23 Outline
Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues
Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback
STAP Refinement of the NMR database: a database of 2405 refined solution NMR structures
Published online 18 November 2011 D525 D530 doi:10.1093/nar/gkr1021 STAP Refinement of the NMR database: a database of 2405 refined solution NMR structures Joshua SungWoo Yang 1,2, Ji-han Kim 1, Sangho
A topology-constrained distance network algorithm for protein structure determination from NOESY data
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network
Overview. The peptide bond. Page 1
Overview Secondary structure: the conformation of the peptide backbone The peptide bond, steric implications Steric hindrance and sterically allowed conformations. Ramachandran diagrams Side chain conformations
Introduction to Spark
1 As you become familiar or continue to explore the Cresset technology and software applications, we encourage you to look through the user manual. This is accessible from the Help menu. However, don t
Advanced Certificate in Principles in Protein Structure. You will be given a start time with your exam instructions
BIRKBECK COLLEGE (University of London) Advanced Certificate in Principles in Protein Structure MSc Structural Molecular Biology Date: Thursday, 1st September 2011 Time: 3 hours You will be given a start
SUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
IgE binds asymmetrically to its B cell receptor CD23
Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
Protein Structure Determination from Pseudocontact Shifts Using ROSETTA
Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic
Interpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
NMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
Better Bond Angles in the Protein Data Bank
Better Bond Angles in the Protein Data Bank C.J. Robinson and D.B. Skillicorn School of Computing Queen s University {robinson,skill}@cs.queensu.ca Abstract The Protein Data Bank (PDB) contains, at least
April, The energy functions include:
REDUX A collection of Python scripts for torsion angle Monte Carlo protein molecular simulations and analysis The program is based on unified residue peptide model and is designed for more efficient exploration
SimShiftDB; local conformational restraints derived from chemical shift similarity searches on a large synthetic database
J Biomol NMR (2009) 43:179 185 DOI 10.1007/s10858-009-9301-7 ARTICLE SimShiftDB; local conformational restraints derived from chemical shift similarity searches on a large synthetic database Simon W. Ginzinger
Tools for Cryo-EM Map Fitting. Paul Emsley MRC Laboratory of Molecular Biology
Tools for Cryo-EM Map Fitting Paul Emsley MRC Laboratory of Molecular Biology April 2017 Cryo-EM model-building typically need to move more atoms that one does for crystallography the maps are lower resolution
Protein Structure Prediction and Display
Protein Structure Prediction and Display Goal Take primary structure (sequence) and, using rules derived from known structures, predict the secondary structure that is most likely to be adopted by each
Introduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
Modelling Macromolecules with Coot
Modelling Macromolecules with Coot Overview Real Space Refinement A Sample of Tools Tools for Cryo-EM Tools for Ligands [Carbohydrates] Paul Emsley MRC Laboratory of Molecular Biology Acknowldegments,
Assignment 2 Atomic-Level Molecular Modeling
Assignment 2 Atomic-Level Molecular Modeling CS/BIOE/CME/BIOPHYS/BIOMEDIN 279 Due: November 3, 2016 at 3:00 PM The goal of this assignment is to understand the biological and computational aspects of macromolecular
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Computational aspects of structure determination by NMR
Computational aspects of structure determination by NMR Alexandre Bonvin Utrecht University EMBO course Il Ciocco 2002 With contributions from - Michael Nilges and Jens Linge (Institut Pasteur, Paris)
Chem. 27 Section 1 Conformational Analysis Week of Feb. 6, TF: Walter E. Kowtoniuk Mallinckrodt 303 Liu Laboratory
Chem. 27 Section 1 Conformational Analysis TF: Walter E. Kowtoniuk wekowton@fas.harvard.edu Mallinckrodt 303 Liu Laboratory ffice hours are: Monday and Wednesday 3:00-4:00pm in Mallinckrodt 303 Course
G L. Achieving high quality protein-ligand X-ray structures for drug design. Oliver Smart Global Phasing Ltd
Achieving high quality protein-ligand X-ray structures for drug design Oliver Smart Global Phasing Ltd G L Structural Basis of Pharmacology: Deeper Understanding of Drug Discovery through Crystallography
CSD. Unlock value from crystal structure information in the CSD
CSD CSD-System Unlock value from crystal structure information in the CSD The Cambridge Structural Database (CSD) is the world s most comprehensive and up-todate knowledge base of crystal structure data,
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
Homology Modeling I. Growth of the Protein Data Bank PDB. Basel, September 30, EMBnet course: Introduction to Protein Structure Bioinformatics
Swiss Institute of Bioinformatics EMBnet course: Introduction to Protein Structure Bioinformatics Homology Modeling I Basel, September 30, 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute
NMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
Ultra-high resolution structures in validation
Ultra-high resolution structures in validation (and not only...) Mariusz Jaskolski Department of Crystallography,, A. Mickiewicz University Center for Biocrystallographic Research, Polish Academy of Sciences,
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg