Phylogenetic analysis of Chloraeinae (Orchidaceae) based on plastid and nuclear DNA sequences

Transcription

1 Botanical Journal of the Linnean Society, 2012, 168, With 6 figures Phylogenetic analysis of Chloraeinae (Orchidaceae) based on plastid and nuclear DNA sequences MAURICIO A. CISTERNAS 1,3 *, GERARDO A. SALAZAR 2, GABRIELA VERDUGO 1, PATRICIO NOVOA 3, XIMENA CALDERÓN 4 and MARÍA A. NEGRITTO 5 1 Escuela de Agronomía, Pontificia Universidad Católica de Valparaíso, calle San Francisco s/n, La Palma, Quillota, Chile 2 Departamento de Botánica, Instituto de Biología, Universidad Nacional Autónoma de México, Apartado Postal , 04510, México DF, México 3 Jardín Botánico Nacional, camino El Olivar 305, El Salto, Viña del Mar, Chile 4 Instituto de Ciencias e Investigación, Universidad Arturo Prat, Ejército 443, Puerto Montt, Chile 5 Departamento de Botánica, Facultad de Ciencias naturales y oceanográficas, Universidad de Concepción, casilla 160-c, Concepción, Chile Received 22 November 2010; revised 8 September 2011; accepted for publication 20 October 2011 The phylogenetic relationships of subtribe Chloraeinae, a group of terrestrial orchids endemic to southern South America, have not been satisfactorily investigated. A previous molecular phylogenetic analysis based on plastid DNA supported the monophyly of Chloraeinae and Gavilea, but showed that Chloraea is non-monophyletic and that the sole species of Bipinnula analysed is sister to Geoblasta. However, that analysis included only 18 of the 73 species belonging to this subtribe. Here, the phylogenetic relationships of Chloraeinae were assessed by analysing aproximately 7500 bp of nucleotide sequences from nuclear ribosomal internal transcribed spacer (ITS) and plastid DNA (rbcl, matk, trnl-trnf, rpob-trnc) for 42 species representing all four currently accepted genera of Chloraeinae and appropriate outgroups. Nuclear and plastid data were analysed separately and in combination using two different methods, namely parsimony and Bayesian inference. Our analyses support the monophyly of Chloraeinae and their inclusion in an expanded concept of Cranichideae, but none of the genera of Chloraeinae that includes more than one species is monophyletic. Gavilea and Bipinnula are paraphyletic, with Chloraea chica nested in Gavilea and Geoblasta penicillata in Bipinnula. As currently delimited, Chloraea is polyphyletic. The taxonomic changes proposed recently are for the most part not justifiable on phylogenetic grounds, except for recognition of the monotypic genus Correorchis. The lack of resolution for the relationships among species of core Chloraea suggests a relatively recent diversification of this group. The current generic classification is in need or revision, but additional study is advisable before carrying out further taxonomic changes The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, ADDITIONAL KEYWORDS: Bipinnula Chloraea Gavilea Geoblasta molecular phylogeny South America. INTRODUCTION As delimited in the most recent classification system of Orchidaceae (Chase et al., 2003; Pridgeon et al., 2003), subtribe Chloraeinae comprises four genera of orchids endemic to South America: Bipinnula Comm. *Corresponding author. mcisternasb@yahoo.com ex Juss., Chloraea, Gavilea Poepp. and Geoblasta Barb.Rodr. Chloraea is the largest genus, with c. 48 species located in three disjunct areas (Hauman, 1922; Correa, 1969: (1) a northern group that includes 16 species from Bolivia, Peru and northern Argentina; (2) an eastern group with two species from eastern Argentina, Brazil and Uruguay; and (3) a western group with c. 30 species from Chile and Argentina. 258

2 PHYLOGENY OF CHLORAEINAE have fleshy roots that are fasciculate or sometimes spaced along a rhizome (Fig. 1), and their leaves form a basal rosette or, uncommonly, are spirally arranged along the stem. The inflorescence is terminal, producing one to many spirally disposed flowers subtended by prominent bracts. The flowers are resupinate, with free sepals and petals with or without conspicuous longitudinal or reticulate veining. The apices of the lateral sepal can be fleshy, membranous or provided with wart-like outgrowths; they often bear osmophores and sometimes have a fimbriate pectinate Figure 1. Roots of Chloraeinae. A, Chloraea chica. B, Gavilea araucana. C, Chloraea crispa. D, Bipinnula fimbriata. Bipinnula occurs in two disjunct areas; one of these comprises southern Brazil, Uruguay and eastern Argentina (six species) and the other is Chile (five species). Gavilea encompasses species found in Chile and Argentina (including the Juan Fernandez and Falkland Islands) and Geoblasta is monospecific and restricted to southern Brazil, Uruguay and eastern Argentina (Correa, 1956, 1969; Izaguirre, 1973; Correa & Sánchez, 2003; Novoa et al., 2006). Species of Chloraeinae are terrestrial, only rarely being found living epiphytically or on rocks. Plants 259

3 260 M. A. CISTERNAS ET AL. extension, as in most species of Bipinnula (Fig. 2). The labellum is free, sessile or clawed, dissimilar or similar to the other perianth parts in size, shape and colouration; the lip blade is membranaceous or fleshy, entire or three-lobed, smooth or more commonly adorned with warts, calluses or crests. The column ranges from short to elongated, straight to arcuate, wingless or narrowly winged and with or without a pair of nectaries between the column and the labellum. Swollen nectaries are found in most Gavilea spp. and nectariferous channels are found in Chloraea and some Bipinnula spp. The anther is terminal, erect or slightly incumbent, bilocular and produces four powdery pollinia in two pairs (Correa, 1956, 1969; Izaguirre, 1973; Dressler, 1993; Correa & Sánchez, 2003; Novoa et al., 2006). Pollen is arranged in tetrads (Ackerman & Williams, 1981). The stigma is ventral, concave and entire. The rostellum is ovate or triangular and blunt and it does not have a distinct viscidium, but a viscarium (Dressler, 1993) or diffuse viscidium sensu Rasmussen (1982) is present (cf. Szlachetko & Rutkowski, 2000; Fig. 3). The genera of Chloraeinae are separated by various floral traits, but it should be noted that probably none of these traits is constant or unique to a genus, except for the insect-like labellum of the monotypic Geoblasta, which is related to its specialized pollination mechanism involving pseudocopulation by scoliid wasps (Ciotek et al., 2006). In Bipinnula, the apices of the lateral sepals are usually fimbriate pectinate, except in B. apinnula Gosewijn, in which they are entire. Gavilea usually has an abbreviated column and swollen nectaries, whereas Chloraea is distinguished by a combination of characters or by the absence of a particular character. For instance, the labellum in Chloraea has nectariferous channels, but these are shared with multi-flowered Bipinnula spp. and an elongate column allows for its separation from most Gavilea spp. but not from Geoblasta or Bipinnula. Often the floral characters have been used inconsistently, as in the key to the genera of Chloraeinae in Correa (2003), in which Gavilea is separated from Chloraea, among others, by the geniculate ovary. Nevertheless, the generic description of Gavilea in the same work indicates that the ovary is straight or geniculate. Historically, the systematic position of Chloraeinae has been controversial. Most authors have included them in various versions of tribe Diurideae because of similarities in overall flower organization, column structure, exine morphology, pollen organization and the presence of an erect anther attached to the column apex via a short filament, as in many Australian genera of Diurideae (Brieger, ; Dressler, 1981, 1993; Ackerman & Williams, 1981; Rasmussen, 1982, 1985). Brieger ( ), based on pollen organization and the presence of a viscidium, divided Chloraeinae into two groups: Aviscidia, including the South American genera Bipinnula, Chloraea, Gavilea and Geoblasta, and Viscidifera, that included Megastylis Schltr., Rimacola Rupp (both Diurideae according to Chase et al., 2003 and references cited therein) and Pachyplectron Schltr. (now considered a member of Goodyerinae, tribe Cranichideae; Chase et al., 2003; Salazar et al., 2003). Burns-Balogh & Funk (1986) included the genera of Chloraeinae in tribe Geoblasteae, subfamily Neottioideae, based on the possession of broad staminodes fused to the sides of the column (= column wings), soft, mealy pollinia, elongated column, reduced rostellum and solid to semi-solid viscidium. However, most of these characters are widely distributed in different combinations in Cranichideae and Diurideae sensu Pridgeon et al. (2003) and genuine viscidia appear to be absent from Chloraeinae s.s. (see above). Szlachetko & Rutkowski (2000) followed a similar scheme to that of Burns-Balogh & Funk (1986), placing Geoblasteae in subfamily Thelymitroideae (Szlachetko, 1991), a synonym of Orchidoideae. Chloraeinae have also been linked to the diurids because the southern South American genus Codonorchis, traditionally placed among Chloraeinae, produces root tubers (the so-called root-stem tuberoids ) similar to those of various Australian genera of Diurideae (see Pridgeon & Chase, 1995). Dressler (1993) suggested that the absence of tuberoids in Bipinnula, Chloraea, Gavilea and Geoblasta may represent a secondary loss. However, phylogenetic analyses based on plastid (Kores et al., 2001) and nuclear DNA (Clements et al., 2002) have shown that Codonorchis is not closely related to Chloraeinae s.s., having been instead placed in a tribe on its own, Codonorchideae (Cribb & Kores, 2000) or even as a distinct subfamily, Codonorchidoideae (Jones et al., 2002). On the one hand, recent phylogenetic analyses based on DNA sequences (Kores et al., 1997, 2000, 2001; Cameron et al., 1999; Clements et al., 2002; Salazar et al., 2003) and embryological studies (Clements, 1999) have shown that Chloraeinae are more closely related to members of tribe Cranichideae sensu Dressler (1993) than to Diurideae, supporting the inclusion of Chloraeinae in an expanded concept of Cranichideae (Clements et al., 2002; Chase et al., 2003; Salazar et al., 2003) or, alternatively, their recognition as a tribe on their own, namely Chloraeeae (as in Pridgeon et al., 2003). However, those studies have included only a few representatives of Chloraea and Gavilea. On the other hand, several taxonomic changes in Chloraeinae have been proposed recently, but none of these was backed up by phylogenetic evidence (Szlachetko & Margońska, 2001; Szlachetko & Tukałło, 2008).

4 PHYLOGENY OF CHLORAEINAE 261 Figure 2. Representative species of Chloraeinae. A, Chloraea alpina. B, C. prodigiosa. C, C. disoides. D, C. cylindrostachya. E, C. gaudichaudii. F, C. lamellata. G, C. magellanica. H, C. barbata. I, C. speciosa. J, C. philippii. K, C. nudilabia. L, Gavilea araucana. M, G. venosa. N, Chloraea chica. O, Bipinnula fimbriata. P, Gavilea odoratissima. Q, G. australis. R, Geoblasta penicillata. S, Bipinnula apinnula.

5 262 M. A. CISTERNAS ET AL. Chemisquy & Morrone (2010) conducted the first phylogenetic analysis of Choraeinae, in which they included 22 specimens of 18 species representing the four currently recognized genera (ten Chloraea spp., six Gavilea spp. and one species each of Bipinnula and Geoblasta). They used nucleotide sequences of three plastid DNA regions, the gene rpoc1, the atpbrbcl intergenic spacer and part of the trnk intron (including the matk pseudogene). Their study supported the monophyly of Chloraeinae s.s. and of Gavilea, but showed that Chloraea is nonmonophyletic and that the sole species of Bipinnula analysed is sister to Geoblasta. However, their limited taxonomic sampling prevented them from drawing conclusions on generic limits and relationships, and a broader sample of species and molecular characters would contribute to a better understanding of the phylogenetic relationships in the subtribe. In the present study, the phylogenetic relationships in Chloraeinae are assessed by analysing more inclusive samples of both taxa and characters than previous analyses. The data analysed here include five plastid DNA regions [gene rbcl, pseudogene matk with part of the trnk intron in which it is embedded, rpob-trnc and trnl-trnf intergenic spacers (IGS) plus the internal transcribed region of nuclear ribo- somal DNA (nrits)]. These genomic regions have been used successfully for phylogenetic reconstruction at various taxonomic levels in several groups of Orchidaceae (e.g. Kores et al., 1997, 2000, 2001; van den Berg et al., 2000, 2005; Gravendeel et al., 2001; Salazar et al., 2003, 2009; Álvarez-Molina & Cameron, 2009; Chiron et al., 2009; Monteiro et al., 2010). Our aim is to gain insights into the phylogenetic relationships within Chloraeinae s.s. by evaluating subtribal and generic monophyly and to discussing the merits of recently proposed taxonomic changes. MATERIAL AND METHODS TAXONOMIC SAMPLING Exemplars of 42 species of Chloraeinae representing the four genera recognized by Pridgeon et al. (2003) were analysed for this study. Representatives of other subtribes of Cranichideae sensu Chase et al. (2003) and of Diurideae, Codonorchideae and Orchideae, were included as outgroups following previous molecular phylogenetic analyses (Kores et al., 1997, 2000, 2001; Clements et al., 2002; Salazar et al., 2003, 2009). A list of the taxa analysed with voucher Figure 3. Gynostemium structure of Chloraeinae, side (left) and front views (right). A, B, Gavilea venosa. C, D, Chloraea crispa. E, F, C. galeata. G, H, C. multiflora.

6 PHYLOGENY OF CHLORAEINAE 263 information and GenBank accessions is provided in Table 1. The aligned matrix is available on request from the first author (M.A.C.). DNA EXTRACTION, AMPLIFICATION AND SEQUENCING Total DNA was mainly extracted from fresh or silica gel-dried tissue, but herbarium material was used in some instances. DNA extraction was carried out with the 2 cetyl trimethylammonium bromide (CTAB) procedure of Doyle & Doyle (1987), modified by the addition of 2% (w/v) of polyvinylpirrolidone (PVP) to the extraction buffer. Amplification of the target DNA regions was performed using a commercial kit (Taq PCRCore Kit; Qiagen, Hilden, Germany) following the manufacturers protocols. The primers used are indicated in Table 2. PCR profiles for rbcl and the matk-trnk, trnl-trnf and nrits regions were as in Salazar et al. (2003). For the rpob-trnc IGS, an initial pre-melt (94 C for 2 min) was followed by cycles of 94 C for 30 s, 53 C for 40 s and 72 C for 40 s, concluding with a final extension at 72 C for 7 min. All PCR products were cleaned with QIAquick silica columns (Qiagen) and used in cycle sequencing reactions with the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA polymerase, version 3.1 (Applied Biosystems Inc., Warrington, UK). Cycle sequencing products were cleaned with Centri- Sep sephadex columns (Princeton Separations, Inc., Adelphia, NJ, USA) and sequenced in a 3100 Genetic Analyzer (Applied Biosystems). Both forward and reverse sequence DNA strands were assembled and edited with the software Sequencher 4.8 (GeneCodes, Ann Arbor, MI, USA). SEQUENCE ALIGNMENT AND INDEL CODING Sequences of the length-conserved rbcl gene were aligned unambiguously by visual inspection, but the sequences of the nrits, trnl-trnf, rpob-trnc and matk-trnk regions, which show length variation, were aligned using the E-INS-i iterative strategy (Katoh et al., 2005) of the online submission version of the program MAFFT version 6 (Katoh, Asimenos & toh, 2009), with minor subsequent manual adjustment. One, five, five, three and three sequences were partially or completely missing from the rbcl, matktrnk, trnl-trnf, nrits, and rpob-trnc data sets, respectively; together, the missing data amount to c 4% of the data cells in the aligned matrix. PHYLOGENETIC ANALYSES Previous phylogenetic analyses of Cranichideae based on plastid and nuclear DNA used here have shown that the different regions produce similar patterns of relationship and that, when they are analysed in combination, both resolution and internal clade support are maximized (e.g. Salazar et al., 2003, 2009). Here, we conducted parsimony analyses of three data matrices: (1) nrits; (2) all plastid regions; and (3) all the data combined. The analyses were carried out using the program PAUP* version 4.0b10 for Macintosh (Swofford, 2002) and each consisted of a heuristic search with 1000 replicates of random sequence addition with tree bisection reconnection (TBR) branch swapping and the MULTREES option activated, saving up to 20 most parsimonious trees (MPTs) from each replicate. All characters were considered as unordered and equally weighted (Fitch, 1971). Individual gap positions were treated as missing data. Internal support for clades was assessed by non-parametric bootstraping (Felsenstein, 1985), performing 500 bootstrap replicates, each with 20 replicates of random sequence addition and TBR branch swapping, saving up to 20 trees per replicate. Clades obtaining a bootstrap percentage (BP) 50 were considered as unsupported, 51 70% as weakly supported, 71 85% as moderately supported, and % as strongly supported. In all analyses, Ophrys apifera Huds. (Orchideae) was used as prime outgroup (Barriel & Tassy, 1998). Additionally, we conducted a model-based phylogenetic analysis of the combined matrix using Bayesian Markov chain Monte Carlo (MCMC) inference, as implemented in the program MrBayes version (Ronquist, Huelsenbeck & Van der Mark, 2005), to generate an independent phylogenetic hypothesis for contrast with the parsimony trees. The best-fitting models of sequence evolution were determined separately for rbcl, matk, trnk intron (excluding matk), trnl intron, trnl-trnf IGS, rpob-trnc IGS and nrits using Modeltest 3.7 (Posada & Crandall, 1998). In all cases, a six-parameter model with among-site rate heterogeneity modelled according to a gamma distribution was selected, and for rbcl, matk and nrits there was also a proportion of invariant sites. The appropriate character partitions were stipulated in MrBayes and all model parameters were unlinked among the partitions, such that each group of characters was allowed to have its own set of parameters (Ronquist et al., 2005). Two simultaneous analyses were run for generations using the default conditions of MrBayes for the Markov chains. The trees were sampled every hundredth generation and the first generations (2500 trees) of each run were discarded as burn-in. Inferences about relationships and posterior probabilities of clades (PP) were based on a majority-rule summary tree constructed by pooling the remaining trees. Posterior prob

7 264 M. A. CISTERNAS ET AL. Table 1. Taxa studied, voucher information and GenBank accessions GenBank accession Taxon Voucher rpob-trnc rbcl trnl-trnf matk nrits Tribe Codonorchideae P.J.Cribb Codonorchis lessonii (Brongn.) Tribe Cranichideae Endl. Subtribe Achlydosinae M.A.Clem. & D.L.Jones Achlydosa glandulosa (Schltr.) M.A.Clem. & D.L.Jones Subtribe Chloraeinae Rchb.f. Bipinnula apinnula Gosewijn South America, Kores & Molvray 332, OKL Chile, Ryan 002, K (spirit) New Caledonia, Clements D-285, CANB Chile, Cisternas 110, Chile, Knees 4438, K Bipinnula fimbriata Chile, Cisternas 111, (Phil.) Johnst. Bipinnula montana Uruguay, Cisternas Arechav. 112, Bipinnula volkmanni Chile, Rodríguez & Kraenzl. Marticorena 2259, Chloraea alpina Poepp. Chile, Saavedra & Pauchard 296, Chloraea barbata Chile, Cisternas 106, Chloraea bicallosa Phil. Chile, Cisternas 113, ex Kraenzl. Chloraea bidentata Chile, Cisternas 109, (Poepp.) M.N.Correa Chloraea bletioides Chile, Cisternas 104, Chloraea chica Speg. & Chile, Tellier & Kraenzl. Márquez 5328, Chloraea chrysantha Chile, Novoa s.n., Poepp. Chloraea crispa Chile (cultivated specimen), Cisternas 103, Chloraea cristata Chile, Novoa 177, Chloraea cuneata Chile, Espejo s.n., Chloraea Chile, Cisternas 123, cylindrostachya Poepp. FR AJ AJ AJ AF FR AJ AJ AJ AJ FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR Pending FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR832118

8 PHYLOGENY OF CHLORAEINAE 265 Table 1. Continued GenBank accession Taxon Voucher rpob-trnc rbcl trnl-trnf matk nrits Chloraea disoides Chloraea gaudichaudii Brongn. Chloraea gavilu Chloraea grandiflora Poepp. Chloraea heteroglossa Reichb. f. Chloraea incisa Poepp. Chloraea lamellata Chloraea lechleri ex Kraenzl. Chloraea longipetala Chloraea magellanica Hook.f. Chloraea membranacea Chloraea multiflora Chloraea nudilabia Poepp. Chloraea philippii Reichb. f. Chloraea prodigiosa Reichb. f. Chloraea reticulata Schltr. Chloraea speciosa Poepp. Chloraea virescens (Willd.) Chloraea volkmanni Phil. ex Kraenzl. Gavilea araucana (Phil.) M.N.Correa Gavilea australis (Skottsberg) M.N.Correa Gavilea glandulifera (Poepp.) M.N.Correa Gavilea leucantha Poepp. et Endl. Chile, Cisternas 122, Chile, Cisternas 120, Chile (cultivated specimen), Cisternas 102, Chile, Espejo 21, Chile (cultivated specimen), Cisternas 105, Chile (cultivated specimen), Cisternas s.n., Chile, Cisternas 116, Chile, Cisternas 107, Chile, Cisternas 115, Chile, Ryan 1, K (spirit) Chile, Cisternas 108, (photograph and dissected flower) Chile, Novoa 126, Chile, Cisternas 114, Chile, Cisternas 119, Chile (cultivated specimen), Cisternas 101, Peru, Weigend , NY Chile, Cisternas 121, Chile, Cisternas 117, Chile, Cisternas 118, Chile, Cisternas 124, Chile, Cisternas 125, Chile, Cisternas 126, Chile, Novoa 259, FR FR FR FR FR FR FR pending FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR AJ AJ AJ AJ FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FJ FJ FJ FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR pending FR FR FR FR FR FR FR FR FR FR FR FR832130

9 266 M. A. CISTERNAS ET AL. Table 1. Continued Taxon Voucher GenBank accession rpob-trnc rbcl trnl-trnf matk nrits Gavilea lutea (Pers.) M.N.Correa Chile, Ryan 3, K (spirit) Gavilea odoratissima Chile, Cisternas 127, Poepp. Gavilea venosa (Lam.) Chile, Novoa 81, Garay & Ormd. Geoblasta penicillata Argentina, Benitez s.n., (Rchb. f.) Hoehne ex CORD M.N.Correa Subtribe Cranichidinae Aa colombiana Schltr. Colombia, Aldana 2, ANDES Cranichis engelii Ecuador, Schott s.n., K Rchb.f. (spirit) Galeoglossum tubulosum () Salazar & Soto Arenas Gomphichis caucana Schltr. Ponthieva racemosa (Walt.) C. Mohr Porphyrostachys pilifera Rchb.f. Prescottia plantaginea Pterichis habenarioides Schltr. Stenoptera ecuadorana Dodson & C.Vargas Subtribe Galeottiellinae Salazar & M.W.Chase Galeottiella sarcoglossa (A.Rich. & Galeotti) Schltr. Subtribe Goodyerinae Klotzsch Ludisia discolor (Ker-Gawl.) A.Rich. Pachyplectron arifolium Schltr. Subtribe Manniellinae Schltr. Manniella cypripedioides Salazar, T.Franke, Zapfack & Benkeen Mexico, Salazar 6054, MEXU Colombia, Díaz 159, ANDES Mexico, Salazar 6049, MEXU Peru, Whalley s.n., K (photograph) Brazil, Salazar 6350, K (spirit) Colombia, Aldana 12, COL Ecuador, Salazar 6357, K (spirit) Mexico, Jiménez 2334, AMO Tropical Asia (cultivated specimen), Salazar 6354, K (spirit) New Caledonia, Chase 529, K Cameroon, Salazar & al. 6323, YA FR AJ AJ AJ AJ FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR FR AM AM AM AM FR AM AM AM AM FR AJ AJ AJ AJ FR AM AM AM AM FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ539516

10 PHYLOGENY OF CHLORAEINAE 267 Table 1. Continued Taxon Voucher GenBank accession rpob-trnc rbcl trnl-trnf matk nrits Subtribe Pterostylidinae Pfitz. Pterostylis curta R.Br. Australia, Chase 572, K Subtribe Spiranthinae Cyclopogon epiphyticus Ecuador, Salazar 6355, (Dodson) Dodson K Dichromanthus cinnabarinus (La Llave & Lex.) Garay Mesadenus lucayanus (Britton) Schltr. Sarcoglottis acaulis (J.E.Sm.) Schltr. Spiranthes cernua (L.) Rich. Stenorrhynchos glicensteinii Christenson Tribe Diurideae Endl. Subtribe Acianthinae () Schltr. Acianthus caudatus R.Br. Acianthus exsertus R.Br. Subtribe Caladeniinae Pfitzer Microtis parviflora R.Br. Mexico, Linares 4469, MEXU Mexico, Salazar 6043, MEXU Trinidad, Salazar 6356, K (spirit) USA, Nickrent 4188, MEXU Mexico, Salazar 6090, MEXU FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ FR AJ AJ AJ AJ n.a. AF Australia, Chase 565, K Australia, Chase 553, K Australia, MA21, CANB Subtribe Diuridinae Diuris sulphurea R.Br. Australia, Chase 554, K Subtribe Cryptostylidinae Schltr. Cryptostylis subulata (Labill.) Rchb.f. Australia, Chase 332, K FR AF AJ AJ FR AF AJ AJ DQ FR AJ AJ AJ AJ FR AF AJ AJ AF Tribe Orchideae Subtribe Orchidinae Dressler & Dodson Ophrys apifera Huds. UK, Chase 536, K FR AJ AJ AJ AJ nrits, nuclear ribosomal internal transcribed spacer.

11 268 M. A. CISTERNAS ET AL. Table 2. Primers used for PCR and/or sequencing Primer name Primer sequence of 5 to 3 Reference ITS region ITS 5 GGAAGTAAAAGTCGTAACAAGG White et al ITS 4 TCCTCCGCTTATTGATATGC White et al trnl-trnf region c CGAAATCGGTAGACGCTA Taberlet et al d GGGGATAGAGGGACTTGAAC Taberlet et al e GGTTCAAGTCCCTCTATCCC Taberlet et al f ATTTGAACTGGTGACACGAG Taberlet et al rbcl 1F ATGGCAGAATTACAA(A/G)GA Kores et al R CTTCACAAGCAGCAGCTAGTTC Kores et al F GCGTTGGAGAGATCGTTTCT Muasya et al R TCGCATGTACCYGCAGTTGC Muasya et al matk-trnk region -19F CGTTCTGACCATATTGCACTATG Molvray, Kores & Chase R AACTAGTCGGATGGAGTAG Steele & Vilgalys F GACTTTC(G/T)TGTGCTAGAACT Molvray et al R GAAGRAACATCTTTKATCCA Molvray et al rpob-trnc IGS rpob CKA CAA AAY CCY TCR AAT TG Shaw et al trnc CAC CCR GAT TYG AAC TGG GG Shaw et al abilities (PP) 0.95 were considered as strong support, as moderate support and < 90 as weak support. RESULTS PARSIMONY ANALYSES The nrits analysis consisted of 775 aligned positions, of which 397 (51%) were potentially parsimonyinformative. The analysis found 254 shortest trees with a length of 2111 steps, consistency index excluding uninformative characters (CI) = 0.42 and retention index (RI) = Figure 4A shows one of the trees and Figure 4B the strict consensus of the 254 trees, on which the bootstrap percentages are indicated. Monophyly of Chloraeinae obtained strong support, as did its sister-group relationship to other Cranichideae. Within Chloraeinae, C. cylindrostachya Poepp. and C. reticulata Schltr. diverge successively, the latter being sister to the remaider of the subtribe, which consists of a polytomy consisting of a clade with C. chica Kraenzl. & Speg. sister to a monophyletic Gavilea, a paraphyletic Bipinnula with Geoblasta penicillata (Rchb.f.) Hoehne embedded, C. membranacea and a clade encompassing all other Chloraea spp. (BP < 50). Among these, three main clades obtained low to high support. The first consists of C. gaudichaudii Brongn., C. speciosa Poepp., C. grandiflora Poepp. and C. magellanica Hook.f. (BP 100), the second includes C. alpina Poepp., C. nudilabia Poepp. and C. bicallosa Phil. ex Kraenzl., and the third group encompasses C. gavilu to C. volkmanni Phil. ex Kraenzl (BP 100). The last group, in turn, includes two clades: C. gavilu to C. longipetala (BP 95) and C. incisa Poepp. to C. volkmanni (Fig. 4B). The combined plastid regions included 6700 characters, 1057 (16%) of them potentially informative to parsimony. Analysis recovered MPTs with a length of 4436 steps, CI = 0.49 and RI = One of the shortest trees and the strict consensus of the trees (with bootstrap values added) are shown in Figure 5. Overall relationships and patterns of support are similar to those of the nrits analysis except that, within Chloraeinae, relationships are less resolved. Nevertheless, the successive divergence of C. cylindrostachya and C. reticulata and a clade including the rest of the subtribe recovered in the nrits analysis were also strongly supported in the plastid analysis. Moreover, some less-inclusive clades found in the nrits analysis were also supported by plastid DNA, including Bipinnula (with Geoblasta embedded; BP 78), Gavilea minus G. australis (Skottsb.) M.N.Correa (BP 97), a clade composed of C. gaudichaudii, C. speciosa, C. grandiflora and C. magellanica (BP 100) and a group consisting of C. bicallosa and C. nudilabia, but with C. cuneata (not included in the nrits analysis) instead of C. alpina. The last species, C. membranacea and the

12 PHYLOGENY OF CHLORAEINAE 269 Figure 4. Phylogenetic relationships of Chloraeinae from the parsimony analysis of nuclear ribosomal internal transcribed spacer (nrits) sequences. A, one of the 254 most parsimonious trees (MPTs) with branch lengths drawn proportional to the number of changes. B, strict consensus of the 254 MPTs (numbers above branches are bootstrap proportions, not shown when < 50%).

13 270 M. A. CISTERNAS ET AL. Figure 5. Phylogenetic relationships of Chloraeinae from the parsimony analysis of combined plastid sequences. A, one of the most parsimonious trees (MPTs) with branch lengths drawn proportional to the number of changes. B, strict consensus of the MPTs (numbers above branches are bootstrap proportions, not shown when < 50%).

14 PHYLOGENY OF CHLORAEINAE 271 remaining species of Chloraea were part of a large polytomy with the above-mentioned clades (Fig. 5B). The combined data set of nuclear and plastid DNA sequences comprised 7475 aligned nucleotide positions, of which 1454 (19%) were potentially parsimony informative. The heuristic search recovered MPTs with a length of 6600 steps, CI = 0.46 and RI = The strict consensus of the trees is shown in Figure 6A. Cranichideae sensu Chase et al. (2003) are strongly supported as monophyletic (BP 100) and they encompass two major clades, Chloraeinae (BP 100) and the rest of Cranichideae (BP 70). As in the nrits analysis, none of the genera of Chloraeinae (excluding monospecific Geoblasta) is monophyletic. Instead, Chloraea consists of a grade in which C. cylindrostachya and then C. reticulata diverge first; the latter is sister to the rest of the subtribe (BP 100). In the strict consensus, the remainder of Chloraeinae (BP 98) form a polytomy consisting of C. membranacea and four strongly supported, major clades (marked with numbers 1 4 in Fig. 6): (1) [C. grandiflora (C. gaudichaudii (C. speciosa C. magellanica))] (BP 100); (2) paraphyletic Bipinnula, including Geoblasta (BP 97); (3) paraphyletic Gavilea, with C. chica nested (BP 99); and (4) core Chloraea clade including C. bicallosa to C. volkmanni (BP 94). The Gavilea/Geoblasta and Bipinnula/C. chica clades are sister to each other with weak support (BP 70). BAYESIAN ANALYSIS The Bayesian summary tree is shown in Figure 6B. The overall relationships recovered by the Bayesian analysis are similar to the strict consensus of the parsimony analysis but slightly more resolved. A notable exception is the association of C. membranacea to the core Chloraea clade, which is strongly supported (PP 0.98). Likewise, the sister-group relationship between the Bipinnula/Geoblasta clade and the Gavilea/C. chica clades received strong support in this analysis (PP 1.00). No instances of strongly supported, contradicting clades between the parsimony and Bayesian analyses occurred (Fig. 6). DISCUSSION PHYLOGENETIC POSITION OF CHLORAEINAE This study represents the first attempt to reconstruct phylogenetic relationships in Chloraeinae by including all four genera and > 50% of their component species with representatives of all the other subtribes currently recognized in Cranichideae, plus several of Diurideae. Monophyly of Chloraeinae sensu Pridgeon et al. (2003) is strongly supported, and our results are consistent with previous findings by Kores et al. (1997, 2000, 2001), Clements (1999), Clements et al. (2002) and Salazar et al. (2003) in showing that Chloraeinae could be accommodated in an expanded concept of Cranichideae. There are a few putatively synapormophic morphological characters supporting the inclusion of Chloraeinae in Cranichideae, such as the possession of fleshy roots either clustered or scattered along a rhizome, leaves usually arranged in a basal rosette and a spiranthoid embryo pattern (Clements, 1999). Cranichideae s.l., including Chloraeinae, is sister to Diurideae, as noted previously in several molecular phylogenetic studies (Cameron et al., 1999; Kores et al., 2000, 2001). The various features of floral morphology, column structure, exine morphology and pollen organization shared by Chloraeinae and some representatives of Diurideae probably represent symplesiomorphies of the whole Diuridae/ Cranichideae clade, and thus they do not support a particularly close relationship between Chloraeinae and various combinations of Diurideae, as believed by some taxonomists (e.g. Brieger, ; Dressler, 1993; Szlachetko & Tukałło, 2008). PHYLOGENETIC RELATIONSHIPS WITHIN CHLORAEINAE The present study shows that none of the genera of Chloraeinae that includes more than one species, i.e. Bipinnula, Chloraea and Gavilea, is monophyletic. Bipinnula and Gavilea are both embedded in Chloraea, the monospecific Geoblasta is nested in a paraphyletic Bipinnula and C. chica is embedded in Gavilea (Fig. 6). This situation would probably explain the absence of morphological diagnostic characters for Chloraea (see earlier). Chloraea cylindrostachya and C. reticulata are successive sisters to the rest of the subtribe. A similar result was obtained by Chemisquy & Morrone (2010), whose analysis recovered C. cylindrostachya and C. praecincta Speg. & Kraenzl. (not sampled by us but belonging to the same geographical group as C. reticulata) as successive sisters of all the other Chloraeinae. Chloraea cylindrostachya belongs in the western group and has a wide latitudinal distribution in Chile and Argentina, ranging from 32 S to 51 S and occurring at intermediate elevations ( m) in the Andean and Coastal Chilean cordilleras. Therefore, together with C. chica, this is one of the species of Chloraea having the largest distribution range. Chloraea cylindrostachya shows some distinctive features, such as a leafy stem, a completely fleshy labellum and a hood or galea formed by the dorsal sepal and the petals (Correa, 1969; Novoa et al., 2006; Elórtegui & Novoa, 2009). Chloraea cylindrostachya and C. leptopetala Reiche (not included in

15 272 M. A. CISTERNAS ET AL. Figure 6. Phylogenetic relationships of Chloraeinae inferred from combined analysis of plastid and nuclear ribosomal internal transcribed spacer (nrits) sequences. A, strict consensus of the most parsimonious trees (MPTs) found by the parsimony analysis (numbers above branches are bootstrap proportions, not shown when < 50%). B, Bayesian summary tree (numbers above branches are posterior probabilities). The main clades discussed in the text are indicated by numbers 1 4.

16 PHYLOGENY OF CHLORAEINAE 273 our analyses) are the only species of the western group that show these features. The presence of cauline leaves and flowers with reticulate veining is shared with the northern Chloraea spp. of northwestern Argentina, Bolivia and Peru (Correa, 1969). Chloraea reticulata belongs to this last group, and the presence of cauline leaves could represent a simplesiomorphy in Chloraeinae. Szlachetko & Tukałło (2008) proposed the new monotypic genus, Correorchis Szlach., for Chloraea cylindrostachya, which might seem justifiable on phylogenetic grounds. However, C. reticulata and C. praecincta also diverge in our phylogenetic trees and in those of Chemisquy & Morrone (2010), respectively, prior to the main radiation of Chloraeinae. If the same criterion applied in recognizing Correorchis were applied to these species, additional monospecific genera would be required to reflect their phylogenetic position. Nevertheless, we urge taxonomists to refrain from rushing to propose further taxonomic changes until a clearer picture of the phylogenetic relationships near the base of the Chloraeinae tree is obtained. The remaining members of Chloraeinae form a strongly supported clade, which in turn consists of four strongly supported monophyletic groups (1 4 in Fig. 6). Clade 1, which includes C. grandiflora, C. gaudichaudii and (C. speciosa C. magellanica) is easily identifiable by the reticulate veining of the floral segments, presence of a hood formed by the dorsal sepal and the petals and entire labellum adorned with clavate calli and with fleshy apex. All these species are structurally similar, except in that the labellum of C. grandiflora is densely covered by fleshy warts (Correa, 1969). Szlachetko & Tukałło (2008) transferred C. grandiflora to Ulantha Hook., as U. grandiflora (Poepp.) Szlach., apparently overlooking the fact that the prior combination Ulantha grandiflora Hook. (type of the genus) implies that his new combination created a later homonym. They also placed in Ulantha the species here treated as Bipinnula apinnula, which, in view of our results, turns Ulantha polyphyletic (see discussion later regarding the phylogenetic position of B. apinnula). Clades 2 and 3 were recovered as sisters to each other and this relationship obtained low bootstrap support (BP 70) but a high posterior probability (PP 1.00). Clade 2 is composed of the four Bipinnula spp. analysed, among which the monotypic genus Geoblasta is nested. Gosewijn (1993) recognized three sections in Bipinnula, all which are represented in our taxonomic sample. Bipinnula fimbriata (Poepp.) I.M.Johnst. (section Multiflorae Gosewijn) is sister to a clade that in turn includes two subclades. The first of these consists of G. penicillata and B. montana Arechav. (section Bipinnula) and the second includes B. apinnula and B. volkmanni Kraenzl. (section Trilobatae Gosewijn). All these groups obtained strong support. Our results fully corroborate the hypothesis put forward by Gosewijn (1993) regarding a close phylogenetic relationship between B. apinnula and B. volkmanni. In contrast, Szlachetko & Tukałło (2008) removed B. apinnula from Bipinnula to place it in polyphyletic Ulantha (see earlier). Likewise, Szlachetko & Margońska (2001), based on intuitive assessments of floral characters, speculated that Bipinnula is polyphyletic and consists of two apparently unrelated groups. They then proposed the new genus Jouyella Szlach. to accommodate the species previously included in Gosewijn s (1993) section Multiflorae, considering the basal, rosulate leaves that are present at flowering, the multi-flowered inflorescence, arching, shortly pedicellate flowers, the thin labellum covered by numerous clavate thickening and the thin sepals as sufficient differences to recognize two genera. However, their genus Jouyella is identical in circumscription to Gosewijn s section Multiflorae, which is the closest relative of the other members of Bipinnula (plus Geoblasta penicillata). Therefore, we do not see the advantage of inflating nomenclature with further genera for which monophyly has not been formally tested and we consider Jouyella as a synonym of Bipinnula. From a geographical standpoint, Bipinnula comprises three disjunct groups, which are correlated with both the sections proposed by Gosewijn (1993) and our molecular results. The first group corresponds to section Multiflorae (see above for morphological details). It is composed of species endemic to Chile and mainly restricted to coastal areas and lowland valleys in northern and central Chile. The second group matches section Trilobatae and includes two species endemic to the Andes of south-central Chile between 35 S and 37 S and is restricted to intermediate elevations ( m; Novoa et al., 2006). Both species share a few-flowered inflorescence (character intermediate between sections Bipinnula and Multiflorae) and a trilobate labellum fully covered by colourful appendages and warts. The last group, section Bipinnula, consists of one-flowered species (see later for details) from the Río de la Plata coastal region in eastern Argentina, Uruguay and southern Brazil (Izaguirre, 1973). As already mentioned, our analyses recover Bipinnula as paraphyletic, but monophyly would be achieved by transferring Geoblasta penicillata to Bipinnula. In our analysis, this species is sister to B. montana from Uruguay, which occurs in the same part of South America, although it not nearly as widespread, as G. penicillata. Correa (1968) reinstated the monospecific genus Geoblasta, distinguishing it from Chloraea based on characters of the labellum and column and suggested that Geoblasta is

17 274 M. A. CISTERNAS ET AL. more closely related to Bipinnula than to Chloraea, which is in agreement with our results. The species of Bipinnula section Bipinnula share several features with G. penicillata, including the absence of nectariferous channels, wingless column, one-flowered inflorescence, insect-like labellum (in most of the species) and similar geographical distribution. The phylogenetic position of G. penicillata has to be reassessed when more single-flowered Bipinnula spp. become available for molecular study. Clade 3 encompasses all the sampled species of Gavilea, with C. chica nested among them and the pair C. chica/g. australis obtained strong support in our combined parsimony and Bayesian analyses (BP 99, PP 1.00) (Fig. 6). Thus, contrary to Chemisquy & Morrone (2010), our results do not support the monophyly of Gavilea, although this discrepancy might have resulted from differences in the taxonomic sampling between the two studies. In our analyses, C. chica is consistently placed as the sister of G. australis, a species not included in the analysis of Chemisquy & Morrone (2010). Although the placement of C. chica in the Gavilea clade might seem unexpected at a first glance, C. chica is able of propagating itself vegetatively by producing new plants from creeping rhizomes (Fig. 1A). This feature is also found at least in G. araucana (Phil.) M.N.Correa (Fig. 1B) and is otherwise unknown in Chloraeinae. The species pair C. chica/g. australis is in turn sister to the rest of Gavilea. All other Chloraea spp. are grouped in clade 4 and, in our Bayesian analysis, C. membranacea is the sister of all the others (Fig. 6). Chloraea membranacea is a member of the eastern group, together with C. bella Hauman (not sampled for this study). This group occurs in southern Brazil and adjacent Argentina, differing from other Chloraea in the straight column wings broader near the column apex and the stigma longer than two-thirds of the column length. The remaining species includes the type species of Chloraea, C. virescens (Willd.), and therefore it might be referred to as core Chloraea. This group is characterized by the membranaceous flowers, longitudinal veining (except C. prodigiosa Rchb.f.) in sepals and petals and entire to three-lobed labellum usually adorned with several keels or longitudinal rows of laminar or thickened excrescences. The species of this clade display a high degree of morphological variation, and species delimitation within this lineage is particularly problematic (Correa, 1969). Two major subclades were recovered within this group. The first subclade includes the Chilean endemic species C. bicallosa, C. cuneata and C. nudilabia (Novoa et al., 2006). These species have basal leaves that do not form a rosette and are narrow with acute apex and sometimes spathulate. The species of this subclade are frequently found living in forests of Araucaria araucana (Molina) C.Koch and species of Nothofagus Blume, which are restricted to intermediate elevations ( m) in the southern Andean and Coastal Chilean cordilleras. Furthermore, C. nudilabia is characterized by the presence of a type C peloria (Mondragón-Palomino & Theißen, 2009), i.e. having a labellum similar in shape, size and colouration to rest of the floral segments, giving the flowers a similar appearance to that of the Australasian diurid genus Thelymitra T.Forst. & G.Forst. Mondragón-Palomino & Theißen (2009) pointed out the possibility of independent occurrences of rare actinomorphic-like species within zygomorphic groups of subfamily Orchidoideae. It is likely that autogamy and cleistogamy, frequent in groups with these flower characteristics, have contributed to the development of stable prospecies (Rudall & Bateman, 2003). However, pollination data are available for only a few Chloraea spp. and the species studied so far are all self-compatible and allogamous (Humaña, Cisternas & Valdivia, 2008). According to our results, none of those allogamous species (C. bletioides, C. chrysantha Poepp., C. crispa and C. galeata ) is closely related to C. nudilabia. The second subclade of core Chloraea includes, for the most part, species endemic to Chile, and they are restricted to coastal or lowland valleys (Novoa et al., 2006). Genetic differences between the species in this group are extremely low, this resulting in a lack of supported resolution for the relationships among species of core Chloraea, and is suggestive of a relatively recent diversification of this lineage of Chloraea in western South America. The greatest concentration and diversity of Chloraea and Gavilea occur in the Andean cordillera (Correa & Sánchez, 2003), and Andean orogeny may have played a role in promoting vicariant speciation events that resulted in the disparity in species diversity of this group between the eastern and western sides of the Andes. Our analyses clearly show that, as currently delimited, Chloraea is polyphyletic and the generic limits in the whole subtribe Chloraeinae are in urgent need of revision. Recently, several changes in the circumscription of the genera have been proposed, notably by Szlachetko and co-workers (Szlachetko & Margońska, 2001; Szlachetko & Tukałło, 2008). These authors resurrected Bieneria Rchb.f and Ulantha, and created the new genera Jouyella, Chileorchis Szlach. and Correorchis, in addition to making various transfers of species between genera. However, as noted earlier, Ulantha is polyphyletic, Jouyella is arguably superfluous, as its content is identical to section Multiflorae of Bipinnula and what remains of both Bipinnula and Chloraea if those genera are accepted are nonmonophyletic assemblages of species. We have not

18 PHYLOGENY OF CHLORAEINAE 275 been able to test the monophyly and phylogenetic position of Bieneria because no species assigned to that genus by Szlachetko & Tukałło (2008) have been available for molecular study. Several of their generic concepts have been based on unreliable characters, such as the degree of lobulation and ornamentation of the labellum (e.g. Ulantha sensu Szlachetko & Tukałło, 2008), and it is worth noting that the delimitation of Chloraeinae of Szlachetko and co-workers (Szlachetko, 1995; Szlachetko & Rutkowski, 2000; Szlachetko & Tukałło, 2008) represents a grossly polyphyletic mixture of genera that, according to several phylogenetic studies, are dispersed among at least three distinct tribes, namely Codonorchideae, Cranichideae and Diurideae (e.g. Kores et al., 2001; Clements et al., 2002). Our study does not support the circumscriptions of Chloraea proposed either by Correa (1969), Correa & Sánchez (2003) or Szlachetko & Tukałło (2008; see earlier). Various sections have been proposed within Chloraea based on combinations of characters, such as number of flowers per inflorescence, presence/ absence and shape of calli, crests and warts on the labellum and type of veining of the floral segments (e.g. Kraenzlin, 1904; Reiche, 1910), but none of those sections turns out to be monophyletic. Regarding the geographical groups proposed by Hauman (1922) and Correa (1969), it is clear that the western group does not correspond to clades recovered in our analyses. For instance, C. cylindrostachya, a member of the western group, is sister to the rest of Chloraeinae, and thus it is not associated with other members of that group, such as C. disoides and C. philippii Rchb.f. Only one species of the eastern and northern groups was analysed here (C. membranacea and C. reticulata, respectively), so we are unable at this time to draw conclusions concerning whether the species included in these groups by previous authors are closely related to one another or not, but overall our results indicate that there is no clear correlation between the clades and the geographical groups. The present study has increased considerably the sample of both species and characters analysed previously (Chemisquy & Morrone, 2010). However, inclusion in future analyses of further Chloraea spp., especially from Peru and northern Argentina, and of Bipinnula spp. from Uruguay and Argentina, will help to improve our understanding of the phylogenetic relationships and the taxonomic limits in Chloraeinae. ACKNOWLEDGEMENTS The authors thank Laura Márquez Valdelamar (Laboratorio de Biología Molecular, Instituto de Biología, Universidad Nacional Autónoma de México) for assistance with DNA sequencing; Santiago Benitez- Vieyra andandrea Cocucci (Universidad Nacional de Córdoba, Argentina) and Orfeo Crosa (Universidad de la República de Uruguay) for plant material and field assistance; and the PUCV-U and FONDEF D06I1079 projects for providing financial support. REFERENCES Ackerman JD, Williams NH Pollen morphology of the Chloraeinae (Orchidaceae: Diurideae) and related subtribes. American Journal of Botany 68: Álvarez-Molina A, Cameron KM Molecular phylogenetics of Prescottiinae s.l. and their close allies (Orchidaceae, Cranichideae) inferred from plastid and nuclear ribosomal DNA sequences. American Journal of Botany 96: Barriel V, Tassy P Rooting with multiple outgroups: consensus versus parsimony. Cladistics 14: van den Berg C, Goldman DH, Freudenstein JV, Pridgeon AM, Cameron KM, Chase MW An overview of the phylogenetic relationships within Epidendroideae inferred from multiple DNA regions and recircumscription of Epidendreae and Arethuseae (Orchidaceae). American Journal of Botany 92: van den Berg C, Higgins WE, Dressler RL, Whitten WM, Soto MA, Culham A, Chase MW A phylogenetic analysis of Laeliinae (Orchidaceae) based on sequence data from nuclear transcribed spacers (ITS) of nuclear ribosomal DNA. Lindleyana 15: Brieger FG Unterfamilie: Neottioideae. In: Brieger FG, Maatsch R, Senghas K, Schlechter R, eds. Die Orchideen. Berlin: Paul Parey, Burns-Balogh P, Funk V A phylogenetic analysis of the Orchidaceae. Smithsonian Contributions to Botany 61. Washington, DC: Smithsonian Institution. Cameron KM, Whitten WM, Kores PJ, Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman DH A phylogenetics analysis of the Orchidaceae: evidence from rbcl nucleotide sequences. American Journal of Botany 86: Chase MW, Cameron KM, Barret RL, Freudenstein JV DNA data and Orchidaceae systematics: a new phylogenetic classifications. In: Dixon KW, Kell SP, Barret RL, Cribb PJ, eds. Orchid conservation. Kota Kinabalu: Natural History Publications (Borneo), Chemisquy MA, Morrone O Phylogenetic analysis of the subtribe Chloraeinae (Orchidaceae): a preliminary approach based on three chloroplast markers. Australian Journal of Botany 23: Chiron G, Oliveira RP, Santos TM, Bellvert F, Bertrand C, Van den Berg C Phylogeny and evolution of Baptistonia (Orchidaceae, Oncidiinae) based on molecular analyses, morphology and floral oil evidences. Plant Systematics and Evolution 281: Ciotek L, Giorgis P, Benitez-Vieyra S, Cocucci AA First confirmed case of pseudocopulation in terrestrial orchids of South America: pollination of Geoblasta pennicillata (Orchidaceae) by Campsomeris bistrimacula (Hymenoptera, Scoliidae). Flora 201: