THE PRIMITIVE EPIDENDROIDEAE (ORCHIDACEAE): PHYLOGENY, CHARACTER EVOLUTION AND THE SYSTEMATICS OF PSILOCHILUS (TRIPHOREAE) A Dissertation

Transcription

1 THE PRIMITIVE EPIDENDROIDEAE (ORCHIDACEAE): PHYLOGENY, CHARACTER EVOLUTION AND THE SYSTEMATICS OF PSILOCHILUS (TRIPHOREAE) A Dissertation Presented in Partial Fulfillment of the Requirements for The Degree Doctor of Philosophy in the Graduate School of the Ohio State University By Erik Paul Rothacker, M.Sc. ***** The Ohio State University 2007 Doctoral Dissertation Committee: Approved by Dr. John V. Freudenstein, Adviser Dr. John Wenzel Dr. Andrea Wolfe Adviser Evolution, Ecology and Organismal Biology Graduate Program

2 COPYRIGHT ERIK PAUL ROTHACKER 2007

3 ABSTRACT Considering the significance of the basal Epidendroideae in understanding patterns of morphological evolution within the subfamily, it is surprising that no fully resolved hypothesis of historical relationships has been presented for these orchids. This is the first study to improve both taxon and character sampling. The phylogenetic study of the basal Epidendroideae consisted of two components, molecular and morphological. A molecular phylogeny using three loci representing each of the plant genomes including gap characters is presented for the basal Epidendroideae. Here we find Neottieae sister to Palmorchis at the base of the Epidendroideae, followed by Triphoreae. Tropidieae and Sobralieae form a clade, however the relationship between these, Nervilieae and the advanced Epidendroids has not been resolved. A morphological matrix of 40 taxa and 30 characters was constructed and a phylogenetic analysis was performed. The results support many of the traditional views of tribal composition, but do not fully resolve relationships among many of the tribes. A robust hypothesis of relationships is presented based on the results of a total evidence analysis using three molecular loci, gap characters and morphology. Palmorchis is placed at the base of the tree, sister to Neottieae, followed successively by Triphoreae sister to Epipogium, then Sobralieae. Tropidieae form a clade with the advanced Epidendroideae, ii

4 and this sister to Nervilieae and Gastrodieae. Diceratostele gabonensis groups within this clade. These results support a primitive condition of plicate leaves with absent or reduced leaves evolving a minimum of five times. An objective of this study was to investigate anther evolution. Among the basal members we find anthers that are erect or exhibit varying degrees of incumbency. It is clear that the erect anthers of some orchids evolved independently from those observed in the Orchidoideae, and the primitive condition among the basal Epidendroideae is suberect/subincumbent. Epidendroid incumbency is achieved via combinations of bending in different regions of the anther, with the primitive condition being in the column region and to a lesser extent, the basal region of the anther. The primitive condition for pollinia is free monads with tetrads evolving twice, and sectile pollinia four times. Some authors have suggested that the type III stigma of Cephalanthera, possessing other primitive features, was evidence that it was intermediate between Neottieae and advanced Epidendroideae. Given its position in the Neottieae, this condition in Cephalanthera is a case of convergence. Based on the results of other studies using nonorchids, it was expected that we would find higher rates of nucleotide substitutions and divergence rates in taxa that lack chlorophyll when compared to green relatives. This study confirms this for both nuclear ITS and mitochondrial nad1 for which there were significant numbers of achlorophyllous taxa represented. These taxa had lower transition:transversion ratios (TI:TV) than chlorophyllous taxa in the same clade and generally lower than other taxa. As part of the study of the basal Epidendroideae, a monograph of the orchid genus Psilochilus (Triphoreae) was prepared in order to better understand the natural variation within the genus. Based on this work, there are seven species recognized, of which one is iii

5 a newly described species, Psilochilus ecuadoriensis, from lowlands of western Ecuador. A molecular phylogenetic study of the genus, representing five of the seven species, was performed using the plastid trnl-f intergenic spacer. Psilochilus physurifolius is at the base of the genus. A grouping is formed between Psilochilus modestus and P. macrophyllus and a clade of P. mollis and P. ecuadoriensis. Conditions of the labellum and vegetative leaf characters were mapped onto the strict consensus of the parsimony analysis including gaps. In the Triphoreae the primitive condition is to have clasping or apetiolate ovate leaves and a labellum with acute lateral lobes and three calli. Psilochilus has two calli and a petiolate leaf, with apetiolate leaves evolving again in P. macrophyllus; elliptic leaves evolved in P. physurifolius. The lateral lobes of the labellum are acute in most of the taxa with rounded or blunted lateral lobes evolving in the clade of P. mollis and P. ecuadoriensis. The clade of Psilochilus modestus and P. macrophyllus is distinguished from the clade of P. mollis and P. ecuadoriensis by a labellum with acute lateral lobes and ovate leaves. This is the first significant study of the basal Epidendroideae in which both taxon and locus sampling were increased. It had been previously suggested by other authors that the diversity of the Epidendroideae might be the result of a rapid evolutionary radiation, as indicated by the short branch lengths and low support obtained. The implication was that a hypothesis of relationships among the basal tribes of the Epidendroideae might not be possible to obtain. These results prove that the epidendroid problem is not intractable, and while still showing low support, there is considerable structure to the topology obtained. iv

6 Dedicated to my loving wife, Birgit, who has stood by me from the beginning, gave me encouragement and support, worried for me when I did not, and deserves this as much as me. To my son, Nathan, who is my muse and my inspiration for enjoying the little things, and to my parents, who fostered a love of nature and learning. v

7 ACKNOWLEDGMENTS I wish to thank my adviser, Dr. John V. Freudenstein for the intellectual support, guidance and love of orchids, which gave me the encouragement to pursue this. Moreover his patience, and endless hours of draft corrections were greatly appreciated, and have helped to make this document the best that it could be. I would also like to thank my committee members, Dr. John Wenzel and Dr. Andrea Wolfe for their support and constructive criticism, and the members of the Phylogenetic Discussion Group for stimulating debate and a forum for the working out intellectual and philosophical issues. In addition, there are a number people that have helped in so many ways. Thanks to my colleague and friend Lou Jost for his help in Ecuador and his efforts in finding populations of Psilochilus; I am glad that he finally took his eyes from the trees and took time to look down at the ground. I greatly appreciate the assistance of Sr. Andres Maduro for his hospitality and assistance in working in Panama and Vladimir Melgarejo and Eric Olmos for field assistance, the staff of the Smithsonian Tropical Research Institute for making Barro Colorado islands long steps and big tree available to me. Thanks to: Dr. Mark Chase, Dr. Meg Daly, Dr. Robert Dressler, Dr. Emerson R. Pansarin, Dr. Mark vi

8 Whitten and lab, and Dr. Mesfin Tedesse, all of whom have provided material and intellectual support, without which this may not have been possible; and finally, my lab partners and colleagues, Dr. Shawn Krosnick, Jeff Morrawetz, and Craig Barrett for coffee, moral support and discussion. I would also like to acknowledge funding from the Janice Carson Beatley Fund for funding research travel to Panama and Ecuador. vii

9 VITA December 10, Born, Charleston, South Carolina, USA M.Sc. Biology, Department of Biology, DePaul University, Chicago IL B.Sc. Department of Biology, DePaul University, Chicago IL present.. Graduate Teaching associate, The Ohio State University Graduate Teaching Associate, DePaul University, Chicago, IL Intern, Field Museum of Natural History, Chicago, IL. PUBLICATIONS 1. Rothacker Triphoreae. Pp in Pridgeon, A. M., P. J. Cribb, M. W. Chase and F. N. Rasmussen (eds.), Genera Orchidacearum. Oxford Univ. Press, Oxford. 2. Rothacker Stable isotopic and morphometric characterization of Peregrine migration with an emphasis on determining the importance of particular habitat types. June MSc. Thesis. DePaul University, Chicago, IL. 3. Kharas, Karras, Michna, Grajzer, Karins, Kontzias, Rothacker, McManigal, Dian, and Watson Novel Copolymers of Trisubstituted Ethylenes with Styrene Halophenyl-1,1-dicyanoethylenes, J. Macromol. Sci., A38, viii

10 4. Kharas, Karras, Michna, Grajzar, Karins, Rothacker, McManigal, and Watson Novel copolymers of halogen ring substituted 2-Phenyl-1,1-Dicyanoethylenes and styrene. Polymer Preprints. Vol. 40:1. FIELDS OF STUDY Major Field: Evolution, Ecology and Organismal Biology ix

11 TABLE OF CONTENTS Page Abstract Dedication... Acknowledgments... Vita... ii v vi vii List of Tables xiv List of Figures.. xvi Chapters: 1. Systematic history and current hypotheses of relationships among the basal Epidendroideae. 1 The Basal Epidendroids in Current Classifications 3 A Brief History of Epidendroid Classification... 5 Tribal treatments... 7 Neottieae... 7 Tropideae 8 Sobralieae... 8 Triphoreae.. 9 Gastrodieae Nervilieae 11 Outstanding taxa Current Classifications 14 Cladistic Morphological Hypotheses x

12 Molecular Hypotheses Towards a phylogenetic hypothesis of the basal Epidendroideae (Orchidaceae) inferred from 3 loci and 3 genomes 21 Introduction Purpose of this study.. 22 Materials and methods.. 24 Materials- Taxon sampling Methods -DNA extraction and purification Amplification and sequencing Alignment Outgroup choice. 28 Gap coding. 28 Parsimony Maximum likelihood Branch support.. 29 Results ITS partition trnl-f partition. 32 nadb-c partition. 34 Parsimony combined analysis Maximum likelihood combined analysis Discussion. 40 Conflicting signals using different optimality criteria 41 Topology 43 Tribal composition. 48 The loss of chlorophyll The utility of nad1b-c Conclusions 61 xi

13 3. A phylogenetic hypothesis of basal Epidendroideae from morphology and molecular data: a total evidence approach. 86 Introduction 86 Materials and methods 89 Results 94 Discussion Conclusion A Monograph of the Orchid Genus Psilochilus (Triphoreae, Epidendroideae) Introduction Materials and methods Taxonomy. 165 Psilochilus 165 Artificial Key to the species of Psilochilus P. carinatus P. dusenianus 170 P. ecuadoriensis 171 P. macrophyllus 173 P. modestus P. mollis 183 P. physurifolius 186 Specimens examined with uncertain placement Uncertain names Phylogeny of Psilochilus (Triphoreae, Epidendroideae) using the plastid trnl-f intergenic spacer Introduction Materials and methods. 216 Results Discussion. 222 Conclusions. 227 xii

14 Appendix A: Nuclear, Chloroplast, Mitochondrial DNA Sequences And Gap Matrices Used In Chapter Appendix B: Nuclear, Chloroplast, Mitochondrial DNA Sequences And Gap Matrices Including 30 Morphological Characters Used In Chapter Appendix C: DNA Alignments For The Chloroplast trnl-f Intergenic Spacers Regions And Gap Matrices Used In Chapter Appendix D: Table Of Accessions Used In The Molecular Analyses Of Chapters 2, 3 And Literature cited xiii

15 LIST OF TABLES TABLE PAGE 1.1 Historical treatment of the genera of the primitive Epidendroideae used in this study ITS sequence information including sequence length, % gaps and transition / transversion ratios Sequence characteristics for nad1b-c including length variation, % gaps, transition/ transversion ratios Morphological matrix consisting of 30 characters coded for 40 taxa. 136 A.1 Primitive Epidendroideae analysis. ITS molecular matrix A.2 Primitive Epidendroideae analysis. trnl-f +gaps molecular matrix A.3 Primitive Epidendroideae analysis. nad1 +gaps molecular matrix. 267 A.4 Primitive Epidendroideae analysis. Combined molecular matrix for ITS (281 characters already excluded), trnl-f +gaps, nad1 +gaps xiv

16 B.1 Primitive Epidendroideae combined Total Evidence analysis. 368 C.1 Alignment of the trnl-f sequences data including gap characters coded using simple gaps methods D.1 List of Accessions used in the molecular analyses. 431 xv

17 LIST OF FIGURES FIGURE PAGE 1.1 Tree presented for the Epidendroideae redrawn from the summary tree of Chase et al. (2003) Strict consensus tree returned from an analysis of the nuclear ITS locus calculated from 3 MPTs of length 2307 (CI=0.412, RI=0.649) Phylogram of 1 of 3 most parsimonious trees. Numbers indicate character changes along the branch Strict consensus tree for trnl-f including gaps coded using simple gap method Adams consensus for the portion of the trnl-f strict consensus for which there was a lack of resolution Strict consensus tree for nad1, returned from 640 most parsimonious trees of length 3236 (CI=0.735, RI=0.536) Portion of the nad1 Adams consensus tree; * indicates node not obtained in strict consensus xvi

18 2.7 Strict consensus tree returned from the parsimony analysis of the combined data from three loci: trnlf, trnlf gaps, ITS, and nad1, nad1 gap The strict consensus calculated from 6 MPTs of length 5570 (CI=0.663, RI=0.546) returned from the combined analysis excluding Gastrodia procera & Triphora amazonica, but including all partial sequences of Wullschlaegelia, Epipogium and Gastrodia species Topology from the Maximum likelihood combined analysis of the three data partitions, ITS, nad1, and trnl-f Maximum Likelihood topology returned from the combined analysis excluding Gastrodia procera and Triphora amazonica, but including all partial sequences of Wullschlaegelia, Epipogium and Gastrodia species A) Epilyna hirtzii (Sobralieae), B) Didymoplexis pallens bud just prior to opening showing granular pollinia, C) Palmorchis trilobulata, D) Gastrodia procera with distinctly sectile pollinia, inset showing stigmatic surface cells The columns of the Triphoreae Column morphology of Diceratostele gabonensis (ER44) showing an erect anther with distinct staminoda and concave stigma xvii

19 3.4 Diagram of a longitudinal cross section of typical orchid column illustrating an epidendroid incumbent anther and delineating the three zones of bending as described and illustrated in Freudenstein et al. (2002) Strict consensus tree of 4 MPTs (L= 123, CI= 0.333, RI= 0.657) returned from the analysis of the parsimony analysis of the morphological matrix Portion of the Adams consensus tree returned from the morphological analysis of 4 MPTs obtained from the analysis of the morphological matrix with character distributions mapped A portion of 1of 4 MPTs derived from the analysis of the morphological matrix Single most parsimonious tree obtained from the successively weighted analysis of 30 morphological characters The single most parsimonious tree of 4196 steps (CI= 0.712, RI= 0.461) returned from the parsimony analysis of the total evidence matrix including all Gastrodia species except Gastrodia procera Single MPT obtained using total evidence with unambiguious changes mapped onto branches xviii

20 3.12 Distribution of leaf morphology mapped onto the single MPT obtained from total evidence analysis of 4858 characters from ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters Distribution of sporogenous and basal zone anther bending onto the single MPT obtained from total evidence analysis of 4858 characters from ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters Distribution of column zone bending mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters Distribution of monads /tetrads and sectile pollinia mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters Distribution of caudicles mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters Distribution of stipe and stigmatic cell shape mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c +gaps, trnl-f +gaps and 30 morphological characters Distribution of pollinium number mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c +gaps, trnl-f +gaps and 30 morphological characters A generalized distribution map of Psilochilus xix

21 4.2 Dissection light microscope images of Psilochilus macrophyllus seeds Species level variation in lablellum morphology for the genus Psilochilus Distribution map of Psilochilus carinatus Distribution map of Psilochilus dusenianus Illustration of Psilochilus ecuadoriensis ined. drawn from LJ Psilochilus ecuadoriensis sp. nov. showing flower Distribution map of Psilochilus ecuadoriensis Distribution map of Psilochilus macrophyllus Psilochilus modestus A. flower B. in habitat Distribution map of Psilochilus modestus Variation in the labelum of Psilochilus mollis Distribution map of Psilochilus mollis Variation in the flower color observed in Psilochilus mollis Distribution of Psilochilus physurifolius Illustration of Psilochilus LJ xx

22 5.1 Strict consensus of 5MPTs of the matrix of nucleotide sequences Strict consensus topology of 7 MPTs returned from the analysis of nucleotide sequence data and gaps coded Topology of the maximum likelihood analysis with the likelihood score of ln L= Labellum characters mapped on to simplified parsimony strict consensus tree Vegetative characters mapped on to simplified parsimony strict consensus tree xxi

23 CHAPTER 1 SYSTEMATIC HISTORY AND CURRENT HYPOTHESES OF RELATIONSHIPS AMONG THE BASAL EPIDENDROIDEAE INTRODUCTION The Orchidaceae is one of the largest flowering plant families with as many as thousand species. The Epidendroideae contains as much as 80% of the diversity within the family (Dressler 1990, 1993; Chase et al. 2003). The Epidendroideae are a major component of orchid diversity, and may represent the fundamental evolutionary radiation of the family. A clearer understanding of the phylogenetic relationships as well as the natural variation within the subfamily is essential for understanding orchid evolution in general. However, in many phylogenetic analyses of orchids, and specifically those looking at epidendroids, resolution of tribal level relationships among the basal epidendroids is poor (Cameron et al. 1999; Chase et al. 2003) owing to combinations of plesiomorphic and apomorphic traits and insufficient uncontested synapomorphies 1

24 making it difficult to resolve nested sets of relationships (Rasmussen 2000). Ironically, it is among these basal taxa that there is the greatest need for a strong phylogenetic hypothesis of relationships given their significance in understanding patterns of evolution in the Epidendroideae. In nearly all of the molecular phylogenetic studies of the Orchidaceae, taxa from the tribes Palmorchideae, Neottieae, Sobralieae, Tropidieae, Nervilieae, Gastrodieae, Xerorchideae (Pridgeon et al. 2005) and Triphoreae (Table 1.1, sensu Dressler 1993,) have been observed forming a basal polytomy within the Epidendroideae. It has been hypothesized that the Epidendroideae underwent a rapid radiation (Cameron et al. 1999, Chase et al. 2003), probably associated with specialization in pollination syndromes. As a consequence these taxa are a mosaic of primitive and derived traits, morphologically and molecularly, with a few autapomorphies, and fewer synapomorphies. Additionally, there are many achlorophyllous taxa. The loss of chlorophyll often results in a convergence in floral morphology associated with a loss of specialized pollination syndromes and increased autogamy, as well as numerous convergences in the reductions of anatomical and morphological features such as the loss of leaves and associated structures (Molvray et al. 2000). At the genomic level, many authors have suggested that organellar functional constraints are reduced in plants lacking chlorophyll. As such many loci used in plant molecular phylogenetics often exhibit accelerated nucleotide substitution rates and an increased occurrence of indel events relative to closely related chlorophyllous or green taxa (Duff and Nickrent 1994, Nickrent and Star 1994, Nickrent and Duff 1996, and Nickrent et al. 1998). 2

25 THE BASAL EPIDENDROIDS IN CURRENT CLASSIFICATIONS- The most recent widely accepted family classification was that of Dressler (1993), and while there are more recent molecular studies primarily focusing on the phylogenetic relationships, the taxonomy of Dressler (1993) provides the taxonomic foundation of all subsequent treatments and will be used here as the basis for discussion of the basal epidendroid groups (Table 1.1). In Dressler s (1993) classification, the subfamily Spiranthoideae includes three tribes: Diceratosteleae (Diceratostele), Tropidieae (Corymborkis and Tropidia), and Cranichideae. The Spiranthoideae were characterized as possessing a terminal viscidium, a trait that is absent in Diceratostele. Both Diceratostele and Tropidieae are also characterized as having woody stems, a trait absent in the remainder of the subfamily. Both Diceratostele and Tropidieae possess a spiranthoid type column in that the anther is erect, or nearly so, and subequal to the rostellum, supporting its inclusion in this Spiranthoideae. However, numerous molecular and morphological studies support an epidendroid affinity for both Tropidieae and Diceratostele (Cameron et al. 1999, Freudenstein and Rasmussen 1999), therefore it has been argued, for Tropidieae based on morphology, that this is a convergent trait. With the exception of the column, neither Diceratostele nor Tropidieae has flowers resembling any of the spiranthoid orchids. Because Triphoreae, Neottieae, Gastrodieae, Nervilieae and Palmorchis have monandrous anthers and soft pollinia, Dressler placed them among the primitive Epidendroideae. Neottieae (Neottia, Limodorum, Aphyllorchis, Cephalanthera, Epipactis and Listera) and Triphoreae (Triphora, Psilochilus, and Monophyllorchis) were difficult 3

26 to place, given so few morphological and anatomical similarities with the other taxa. Triphoreae resembles Neottieae in the form of the anther and Cephalanthera most closely agrees with Triphoreae in the structure of the column; both Triphora (and to a lesser extent Psilochilus) and Cephalanthera possess recurved anthers. Dressler also suggests that Triphoreae may be closely related to Palmorchis, as they tend to share the features of gregarious blooming and similarity in floral morphology. It should be pointed out here that gregarious blooming is a characteristic of many terrestrial orchid species order to increase the chances of outcrossing (Dressler 1981). In the narrow sense, Neottieae as it is currently circumscribed is probably a monophyletic group (Dressler 1993, Pridegon 2005, R. Bateman pers. com.). Palmorchis was removed from Sobralieae (Dressler and Dodoson 1960) and given tribal status (Palmorchideae) because of significant morphological differences between it and the other members Sobralieae (Sobralia, Elleanthus, Epilyna, and Sertifera) such as seed type, pollinium number (4 vs. 8), and the lack of a viscidium. More recent classifications (Chase et al. 2003; Table 1.1 and Fig.1.1) suggest that a subfamilial rank is not warranted and have tentatively placed Palmorchis in Neottieae (see section Molecular hypotheses for a more comprehensive discussion). Palmorchis has 4 pollinia that are unique in that they are firmer than those found in many of the basal taxa yet are softer than pollinia from more advanced orchids; given the recent results of molecular studies (Bateman et al unpublished, Cameron et al. 1999, and Chase et al 2003) which support the tentative placement of Palmorchis with Neottieae, however, given morphology it does not seem that this is an appropriate place for it here either. 4

27 Other tribes recognized by Dressler (1993) were Gastrodieae, including Wullschlaegelia, and the monotypic Nervilieae (Nervilia). Gastrodieae have traditionally been the repository for many of those orchids that lack chlorophyll, thus it is possibly a paraphyletic assemblage when you consider that convergences in morphology have been observed in plants with increased achlorophylly (Molvray et al 2000). Dressler also included Vanilleae (Vanilla, Galeola, Erythorchis, Crytosia among others) among these primitive epidendroid orchids; recent molecular research points to a subfamilial status for vanilloid orchids, somewhere near the base of the orchid phylogeny (Kores et al. 1997, Cameron et al.1999). Finally, Sobraliinae (Sobralia, Elleanthus, Sertifera, and Epilyna) were put in the epidendroid 1 phylad of the advanced epidendroids as they were considered to have many derived characters of the more advanced epidendroid orchids by Dressler (1993). Of note is the uncertain placement of the genus Xerorchis, which was left as a primitive monandrous orchid, close to Pogoniinae (now Vanillioideae, sensu Cameron et al. 1999) due to terrestrial habit, persistent leaves, and seed type; however because it had 8 pollina, it could have been more closely related to Arethuseae or Epidendreae sensu Dressler (1993). A BRIEF HISTORY OF EPIDENDROID CLASSIFICATION- The tribes of the basal Epidendroideae have been variously conceptualized depending upon the author, state of knowledge and degree of importance placed upon assorted key characteristics. In all orchid classifications, many monandrous orchids closely allied to Neottia, have been associated on the basis of possessing many primitive characters and have been collectively called the neottioid orchids. These characters include soft mealy pollinia, 5

28 plicate leaves, suberect to subincumbent anthers. Lindley ( ; see Table 1.1 for summary) was the first substantial work to give a full account of all orchid genera known at the time in which he placed the neottioid orchids and the other basal epidendroid orchids (sensu Dressler 1993) into two tribes, Neottieae and Arethuseae with equivalence to the subfamilial rank used today. While both subfamilies had some variant of sectile pollinium, they were distinguished based on dorsal (sub-incumbent) vs. opercular anthers (distinctly incumbent with a detachable pollinia). Bentham (1881) accepted much of Lindley s work with a few exceptions (Table 1.1). Arethuseae was subsumed into Neottieae, which was maintained as a subfamily. Of the more recent classifications, the works of Schlechter ( ) were the most influential from early in the 1900 s. All of the orchids of the basal Epidendroideae, as well as the whole of the Orchidoideae and vanilloid orchids, were put into the subfamily Monandrae, as they possessed single fertile anthers. These subfamilies were then subdivided into tribes. Schlechter placed orchids with mealy or sectile pollinia into subdivision Polychondreae (containing 23 groups or subtribes) and those with more hard or firm waxy pollinia into Kerosphaereae (containing 43 groups), the former containing all the basal epidendroid orchids in this study. Abandoning the higher-level nomenclature of Lindley and others, the names that Schlechter used were based on the classifications of Ernst Pfitzer (1877, not presented here in detail) with modifications to relationships and groupings. By 1926, Schlechter had revised his classification scheme (Table 1.1). While other works were being published concurrently, the work of Schlechter was by far the most influential for the first half of the twentieth century. 6

29 The modern era in orchid classifications began with the work of Dressler and Dodson (1960). Dressler and Dodson accepted some of Schlechter ( ; 1926) and the revisions of this work by Mansfeld (1934, 1937a, 1937b, 1954), but they went back to the nomenclature of Lindley and Bentham (Table 1.1). While Dressler and others continued to publish many orchid classifications at different ranks over the subsequent decades, this work represents one of the most comprehensive and influential classifications of orchids up until that time, and provided a foundation for all future work leading to the culmination of Dressler (1993). TRIBAL TREATMENTS- Neottieae- With the exception of Lindley, who was able to see only a relatively small percentage of the diversity of Neottieae (sensu Dressler 1993), Neottieae as it is currently recognized is much more narrowly defined then that used in many previous classifications. With Lindley s ( ) circumscription of the subfamily Neottieae he included taxa such as Neottia, Listera, and Epipactis, and into the Arethuseae were placed Cephalanthera and Limodorum. Bentham (1881) placed Listera and Neottia into Spiranthieae (Table 1.1), suggested by a terminal erect anther on top of or interiorly inclined behind the rostellum, with pollen affixed to a gland. Bentham (1881) included Aphyllorchis in his Diurideae (Neottieae), on the basis of an erect or inclined anther, an abbreviated rostellum and powdery or granular to semi-solid pollinia. Cephalanthera, Epipactis, and Limodorum were listed in Limodoreae (Neottieae). The conditions for this were an operculate anther, incumbent or suberect, with a short rostellum and powdery and granular pollinia, with dorsal anther dehiscence. In Schlechter ( ) Aphyllorchis was placed in Vanillinae (Polychondreae) with the remaining 7

30 Neottieae treated in two subtribes of the Polychondreae, the Listerinae and Cephalantherinae. In the 1926 classification, Schlechter combined all these taxa under the Polychondreae (Monandrae). Listera and Neottia were placed in Listereae, while into Cepahalanthereae went Aphyllorchis, Cephalanthera, Epipactis, and Limodorum. The work of Dressler and Dodson (1960) accepted some of Schlechter s classification (with revisions). Neottieae were placed into the subfamily Orchidoideae, and divided among the subtribes Limodorinae (Aphyllorchis, Cephalanthera, Epipactis, and Limodorum) and Neottieae (Neottia, and Listera). The later were defined as having a sensitive rostellum (which exudes a viscid substance when stimulated), and cauline leaves spirally arranged (when present). TROPIDIEAE- it is clear from a survey of the literature that the two genera in this tribe have had a long history together based on floral similarity. Lindley ( ) placed Tropidia (Tropidieae) in the subfamily Neottieae based on having loose pollen and an erect anther. Bentham (1881) treated Corymborkis (called Corymbis) and Tropidia at the level of tribe, Corymbideae (Neottieae), given a parallel or erect anther atop the rostellum and granular pollinia. Schlechter ( , 1926) included both Tropidia and Corymborkis (as Corymbis) as members of the Tropidiinae (Polychondreae). Dressler and Dodson (1960) transferred Tropidia and Corymborkis to the Tropidia alliance under the Spiranthoideae. SOBRALIEAE-Lindley ( ) placed Sobralia into the subfamily Arethuseae. Bentham (1881) moved Sobralia and Sertifera into the Vanilleae given a long column, short rostellum, and an incumbent sub-operculate anther possessing lax 8

31 granular pollinia and a rostellum or gland. Based on Schlechter s work ( , 1926), Sobralia, Elleanthus, Epilyna and Sertifera were placed in the Sobraliinae (Polychondreae). Dressler and Dodson (1960) transferred the Sobraliinae (Sobralia, Elleanthus and Sertifera) to Epidendreae (Orchidoideae) with the rank of subtribe. TRIPHOREAE- In Lindley s treatment ( ), Triphora gentianoides and Psilochilus macrophyllus were the only species of this tribe that were discussed, and were placed in Arethuseae as Pogonia gentianoides and P. macrophylla respectively. Until Schlechter, members of this tribe were treated as related to Pogonia (for examples see Reichenbach 1859; Cogniaux 1906; Williams 1970), however Schlechter ( ) used the name Nerviliinae (Polychondreae) for the taxa of Triphoreae, but by 1926, he moved Triphora, Psilochilus and Monophyllorchis to Vanillieae. Dressler and Dodson (1960) included the three genera of this tribe again as belonging to Pogoniinae. Interestingly, Nervilia was also included here, implying a relationship to Triphoreae based on similarity in flower structure. Ames (1922) was the first to suggest that Triphoreae were not members of Pogoniinae, and Baldwin and Speese (1957) subsequently established that Triphoreae have 44 chromosomes while Pogoniinae have only 18, thus further supporting the hypothesis that this relationship is not correct. Using the system of Schlechter, Breiger (1975) segregated Triphora and Nervilia into Nerviliinae but kept Psilochilus and Monophyllorchis in Pogoniinae. The reason for this segregation, Brieger argued, was that there were significance differences in habit, citing the rhizome, which was not sympodial, but rather a stolon from which new growth emerges and an apical inflorescence forms. Triphoreae was originally circumscribed by 9

32 Dressler (1979) in which he segregated these taxa from Pogoniinae on the basis of the fact that the three taxa of Triphoreae lacked a clearly incumbent anther, sinuous epidermal cell walls, and an abcission layer between the ovary and perianth, all characteristics observed in Pogoniinae. In this original description, Dressler included the genera Monophyllorchis, Psilochilus, and Triphora. Dressler stated he believed that this tribe may be most closely related to the Orchidoideae, but pointed out that Monophyllorchis and Psilochilus both have subsidiary cells, which are lacking in the orchidoid orchids, finally suggesting that Triphoreae were most likely related to or sister to Epidendroideae s.s, but did not state what characters he used to make this decision. In a reversal of this opinion Dressler (1981) later treated Triphoreae as an anomalous tribe of the Orchidoideae, arguing that the position of the anthers was not consistent with the epidendroid line of evolution. His position on this was later revised again, and by the 1993 publication he placed the tribe among the primitive orchids with a single fertile anther. GASTRODIEAE- Lindley ( ) treated Epipogium, Stereosandra and Gastrodia as Arethuseae. As with the genus Aphyllorchis (Neottieae), Bentham placed Stereosandra into the Diurideae on the basis of an erect or inclined anther and an abbreviated rostellum sometimes equivalent in length to the anther, and pollinia that were powdery or granular to semi-solid. At the rank of subdivision (subtribe), Schlechter, in his , treatment treated Gastrodieae to include Didymoplexis, Epipogium, Gastrodia, and Auxopus. However by 1926, he revised this so that Gastrodieae only included Gastrodia and Didymoplexis, and the other taxa were moved to Epipogoneae, in 10

33 which he included Stereosandra. In the traditional sense, Gastrodieae has been a repository for those orchids without chlorophyll and having a single anther while lacking additional characters that could suggest other affinities. Dressler and Dodson (1960) placed Silvorchis into the Satryum alliance of the subtribe Coryciinae (Orchideae, Orchidoideae) with question. Into the subtribe Epipogiinae (Orchideae, Orchidoideae) were placed Epipogium and Stereosandra based on a persistent anther and sectile pollinia with basal caudicles; Auxopus, Didymoplexis, Didymoplexiella, Gastrodia, and Uleiorchis were put into the subtribe Gastrodiinae (Epidendreae). NERVILIEAE- For much of its history, Nervilieae was considered either a monogeneric tribe or Nervilia was subsumed into Pogonia or closely allied to it. In Lindley ( ), Nervilia aragoana (as Pogonia aragoana) was placed into the tribe Arethuseae. Pfitzer (1891) placed Nervilia into the subtribe Pogoniinae. Schlechter ( , 1926) used the subtribe Nerviliineae (Gastrodiinae), in which he placed Nervilia, and in 1926, it was moved to Polychondreae. Dressler (1960) treated Nervilia as Pogoniinae with Triphora, Psilochilus and Monophyllorchis. Brieger (1975) segregated Triphora and Nervilia into Nervilinae (see Triphoreae for discussion). Dressler (1990) raised Nervilia to the rank of tribe. Nervilia possesses a corm and similar floral morphology to that of Arethuseae, which appeared to be a natural place for it. OUTSTANDING TAXA- Authors have variously treated the outstanding taxa Diceratostele, Palmorchis and Xerorchis. Palmorchis was originally described by Rodrigues (1877). There are approximately 21 species currently recognized, found in west central South America and Central America into the Isthmus of Tehuantepec, 11

34 between the Mexican states of Oaxaca and Veracruz (Salazar per com.). The only recent treatment was by Schweinfurth and Correll (1940) in which they addressed nomenclature, history of the genus and described the 6 known taxa. Palmorchis has traditionally been difficult to place into a higher taxonomy. These orchids are terrestrial (except P. imuyanensis, a terrestrial/marginal herb of ephemeral wetlands [Dodson and Romero 1993]) having reed-like stems, with broad plicate, spirally arranged or alternating leaves resembling those of palm-seedlings. Each of these characters is plesiomorphic. The flowers are often small, borne on short terminal or lateral inflorescences. Like many terrestrial orchids they exhibit gregarious blooming. In appearance, Palmorchis resembles Sobralia and Elleanthus (Sobralieae) or Diceratostele and at one time or another, Palmorchis was attributed in part or as a whole to Sobralieae, or allied with Diceratostele or Vanilla (Vanilloideae; Ames 1922; Dressler and Dodson 1960; Freudenstein and Rasmussen 1999). With the exception of Vanilla, the other taxa are all very similar in appearance and habit, which may be a plesiomorphic condition. Palmorchis is similar to Vanilla in that each has a hard seed coat, something also seen in Apostasioideae (Dressler 1993), thus suggesting that this trait is also convergently derived. Palmorchis is not vanilloid based vegetative morphology and growth habit, and differs also in a well developed, sculptured seed-coat, and the medial union of the lip with the column; molecular analyses support this conclusion as well (Cameron and Chase 2000). Exactly where it belongs has not been conclusively determined. Palmorchis can be 12

35 distinguished from the Apostasioid orchids on the basis of being monandrous and having an incumbent anther. Dressler and Dodson (1960) moved Palmorchis into Sobraliinae where it was associated with Sobralia until 1993 (Dressler 1993) when it was placed into a monotypic tribe, Palmorchideae, of the Epidendroideae. Diceratostele was originally described by Summerhayes (1938). In this work the author suggested that based on morphology and habit, this genus was most closely related to Palmorchis. This relationship was again argued by Dressler and Dodson (1960) in which Diceratostele, Palmorchis and Xerorchis were put in the Sobraliineae. Diceratostele was considered sister to the rest of Sobralieae by Rasmussen and Rasmussen (1979) but latter placed into the monogeneric Diceratosteleae (Spiranthoideae) by Dressler (1990, 1993). As it is currently understood, Diceratostele is a monspecific genus of the subtribe Diceratostelinae (Triphoreae) based on the results of Cameron et al. (1999). It is found in the old world tropics, in western Africa from Liberia, Ivory Coast, Gabon, Cameroon, and Congo. Dressler (1981) placed Xerorchis in the Sobraliinae given similarity in floral morphology (i.e. entire lip with a single linear callus on the labellum, column with apical wings) because it also had eight (superposed) pollinia. By 1993, Dressler removed it and placed it among a group of monandrous primitive orchids of unknown affinities. He 13

36 suggested that it may be related to Arethuseae or Epidendrae given its eight pollinia, but its terrestrial habit, the presence of persistent leaves, and seed type seem to suggest an affinity to Pogoniinae. Nearly all of these conditions are plesiomorphic, and therefore not of phylogenetic utility. CURRENT CLASSIFICATIONS-Cladistic Morphological hypotheses- Morphological synapomorphies for the epidendroid subfamily include a single incumbent anther (Freudenstein and Rasmussen 1999; Pridgeon et al. 1999), a type III stigma (Dannenbaum et al. 1989), and distinct hard or firm pollinia (except some basal taxa). Dressler (1993), while an influential work, was not cladistic; therefore any phylogenetic relationships presented were more or less speculative. One of the first substantial classifications based on a significant number of morphological characters was that of Burns-Balogh and Funk (1986). While their study was founded in cladistic methodology, it is not clear that their taxonomy was based on that methodology. The basal epidendroid taxa (sensu Dressler 1993) were distributed between the orchidoid and epidendroid orchids of Dressler. The only cladistic morphological study to include any significant numbers of basal Epidendroideae was performed by Freudenstein and Rasmussen (1999). Freudenstein and Rasmussen (1999) failed to resolve basal relationships among the primitive Epidendroideae, obtaining a basal polytomy in the consensus. Epidendroid taxa such as Triphora grouped with orchidoids and Palmorchis with vanilloids (Vanillioideae, 14

37 Cameron and Chase 2000, Cameron et al. 1999). Explanations given for their results were convergence or that many of these basal taxa possess more plesiomorphic character states relative to more advanced epidendroids, but given the data, neither of these explanations is testable. Molecular hypotheses-the number of molecular analyses in systematics has increased in response to the diverse array of methods, the quality and quantity of readily available information, and the speed with which data can be obtained (Soltis and Soltis 1998). While molecular studies are helping to resolve many of the issues of orchid phylogeny, one perennial problem is that they, like morphology, have failed to resolve tribal relationships of the basal Epidendroideae. The most comprehensive molecular study containing a significant sampling of the subfamily used a single plastid locus, rbcl (Cameron et al. 1999). In this study the authors found Nervilieae + Xerorchis to be sister to the whole of Epidendroideae, followed on successive branches by a clade of Triphoreae + Diceratostele, then Tropidieae, Neottieae (+ Palmorchis), and finally Sobralieae (these basal clades sister to the remaining Epidendroideae). However in the strict consensus the nodes collapse and relationships are unresolved. Chase et al. (2003) argued that the lack of resolution among these orchids is due to low sequence divergence, as indicated by the short branch lengths and low branch support. Perhaps this suggests a rapid evolutionary radiation as argued by the authors; nevertheless only one gene was used in this analysis, which assumes that the tree obtained from a single sequence can faithfully reflect the species tree. 15

38 The current molecular phylogenetic hypothesis of the orchids by Chase et al. (2003; Fig.1.1) is based on a summary tree constructed from the results of molecular studies using the plastid (atpb, rbcl, matk, psab, trnl-f intron and spacer), the nuclear (26S rdna), and the mitochondrial genomes. The summary tree shows Neottieae, Sobralieae, Tropidieae, Triphoreae (Triphorinae and Diceratostelinae; see Pridgeon et al. 2005), Nervilieae, and Gastrodieae within the primitive Epidendroideae (Cameron et al. 1999, Chase et al. 2003). Most of the tribal level relationships among the basal Epidendroideae are still unresolved, with the exception of Neottieae (including Palmorchis) which is found at the base of the tree followed by a clade of Sobralieae and Tropidieae, this sister to the rest of the Epidendroideae. Goldman et al. (2001) included Xerorchis in their study of Arethuseae, where it was found unrelated to both this tribe and Sobralieae to which it was also suggested that it was related. In this study, Neottieae (Listera and Epipactis) were at the base of the Epidendroideae, followed successively by Xerorchis and a clade of Sobralieae sister to Tropidieae. As this study was not focusing on the basal Epidendroideae, their sampling of these taxa was limited. On the basis of the work by Cameron et al. (1999), Xerorchis was placed as a member of Nervilieae; also included in this tribe were Nervilia, Silvorchis and Stereosandra (the latter two not included in this study, but see Chase et al. 2003), and Epipogium. Xerorchis shares with Nervilieae in this sense some aspects of floral morphology, but differs from it with respect to the habit; in Pridgeon et al. (2005) it was treated as a monotypic tribe, Xerorchideae, due to its unique morphology. 16

39 In many of these analyses, one or two exemplar species may have been included in the phylogenetic analysis, acting as placeholders for tribes and even in some cases the whole of the diversity among the basal Epidendroideae. Additionally, even when sampling was improved, as in the case of Cameron s (1999) rbcl analysis, the use of a single locus, especially one which is uniparentally inherited, to infer phylogenetic relationships may not be appropriate given the issues of using a single locus in phylogenetic inference (Goodman et al. 1979, Olmstead and Sweere 1994, Pamilo and Nei 1988). 17

40 Lindley ( ) Genus Bentham (1881) Genus Schlechter (1926) Neottieae Neottia, Listera Neottieae Monandrae Vanilleae Sobralia, Sertifera Polychondreae Arethuseae Cephalanthera, Epipogium, Gastrodia, Limodorum, Nervilia aragoana (Pogonia aragoana), Triphora gentianoides (Pogonia gentianoides), Psilochilus (Pogonia macrophylla), Sobralia Corymbieae Spirantheae Diruidaeae Limodoreae Corymbis (Corymborkis), Tropidia Listera, Neottia, Wullschlaegelia Aphyllorchis, Stereosandra Cephalanthera, Epipactis, Limodorum Listereae Cephalanthereae Vanillieae Gastrodieae Tropidiinae Listera, Neottia Genus Aphyllorchis, Cephalanthera, Epipactis, Limodorum Triphora, Psilochilus, Monophyllorchis, Xerorchis Didymoplexis, Gastrodia Corymborkis, Tropidia 18 Epipogoneae Epipogium, Stereosandra Sobralieae Elleanthus, Epilyna, Sertifera, Sobralia Nervilieae Nervilia Table 1.1: Historical treatment of the genera of the primitive Epidendroideae used in this study. Continued

41 Table 1.1 Continued Dressler and Dodson (1960) Epipogiinae Disinae Epipogium, Stereosandra Silvorchis Genus Dressler (1993) Genus Chase et al. (2003) Spiranthoideae Epidendroideae Diceratosteleae Diceratostele Neottieae Neottieae Tropidieae Corymborkis, Tropidia Sobralieae Genus Aphyllorchis, Cephalanthera, Epipactis, Limodorum, Neottia/Listera, Palmorchis Elleanthus, Epilyna, Sertifera, Sobralia Limodorinae Aphyllorchis, Cephalanthera, Epipactis, Limodorum Neottinae Listera, Neottia Neottieae Epidendroideae Tropidieae Corymborkis, Tropidia Neottia, Aphyllorchis, Cephalanthera, Epipactis, Limodorum, Listera Triphoreae Triphora, Psilochilus, Monophyllorchis, Diceratostele 19 Spiranthinae Corymborkis, Tropidia Palmorchideae Palmorchis Nervilieae Epidendreae Triphoreae Gastrodiinae Pogoniinae Sobraliinae Auxopus, Didymoplexis, Didymoplexiella, Gastrodia, Uleiorchis Monophyllorchis, Nervilia, Psilochilus, Triphora Diceratostele, Elleanthus, Palmorchis, Sertifera, Sobralia, Xerorchis Nervilieae Gastrodieae Epidendreae 1 Triphora, Psilochilus, Monophyllorchis, Vanilleae Nervilia Uncertain Xerorchis Auxopus, Didymoplexis, Didymoplexiella, Gastrodia, Neoclemensia, Silvorchis, Stereosandra, Epipogium, Wullschlaegelia Sobralia, Sertifera, Epilyna, Elleanthus Gastrodieae Arethuseae Nervilia, Silvorchis, Stereosandra, Epipogium, Xerorchis Auxopus, Didymoplexis, Didymoplexiella, Gastrodia, Neoclemensia Wullschlaegelia

42 Neottieae + Palmorchis Tropidieae Sobralieae Triphoreae Nervilieae Gastrodieae Calypsoeae Malaxideae Dendrobiinae Arethuseae Podochilinae Collabiinae Epidendreae Vandeae, Cymbidieae Figure. 1.1: Tree presented for the Epidendroideae redrawn from summary tree of Chase et al. (2003). Arrow indicates Orchidoideae, taxa in bold are in the scope of this study. 20

43 CHAPTER 2 TOWARDS A PHYLOGENETIC HYPOTHESIS OF THE BASAL EPIDENDROIDEAE (ORCHIDACEAE) INFERRED FROM 3 LOCI AND 3 GENOMES. INTRODUCTION As a taxonomic unit, orchids have had a long history, dating back to the works of the Greek philosopher Theophrastus (ca BC), primarily the manuscript Enquiry into plants (Reinikka 1995). All classical classifications were primarily based on medicinal use of the plants, a largely artificial method of classification. Numerous attempts to make a classification of the Orchidaceae and lower order relationships have been made since Lindley ( ) first formulated a more natural classification. As more orchid species were discovered, more detailed classifications emerged, and associations changed, although relationships remained intuitive, based on a few key morphological or vegetative characters. Increasingly over the last century, systematists 21

44 have tried to establish a natural classification based on an understanding of historical phylogenetic patterns of relatedness between taxa. Three of the most recent comprehensive classifications of the orchids are based largely on intuitive schemes (Dressler 1981, 1993, Szlatchetko 1995). Orchid relationships at the level of the family have only recently been resolved with the use of cladistic methods (Cameron et al 1999). All of the current hypotheses of orchid relationships have failed to retrieve robust or even resolved phylogenetic relationships among the tribes of the basal Epidendroideae (Kores et al 1997, Cameron 1999, Freudenstein and Rasmussen 1999, Goldberg et al. 2001, Chase et al. 2003, Freudenstein et al. 2004, Van den Berg et al. 2005). All were limited in both taxon sampling and locus sampling, relying instead on a few exemplars taxa to represent whole tribes or even the diversity of the basal Epidendroideae. Admittedly however, many of these were not focusing on lower order relationships within the Epidendroideae, especially many of the earliest. Given the results of these studies it has been argued that the Epidendroideae may be the result of a rapid radiation as indicated by short internodes subtending clades and low branch support, such that resolving relationships may be nearly intractable (Chase et al 2003). However, given the significance of the basal epidendroids for understanding evolution of particular traits within the subfamily, there is a significant need for an improved understanding of relationships among the most primitive members of this the largest subfamily of orchids. 22

45 PURPOSE OF THIS STUDY- The purpose of any phylogenetic systematic study is to provide an hypothesis of historical relationships among the organisms being studied, and further provide a point from which to assess the evolution of particular characters of interest. With a robust hypothesis of evolutionary relationships among these orchids, more fundamental evolutionary questions regarding the origin and evolution of the Epidendroideae may be addressed. Using both a more comprehensive taxon and increased locus sampling in a combined analysis, a phylogenetic hypothesis of relationships among the basal Epidendroideae is presented here. For this study three loci were used, the nuclear ITS1, ITS2 and 5.8S region, the plastid trnl-f and the one mitochondrial marker, NADH dehydrogenase subunit 1 (nad1) intron between the B and C exons (nad1b-c). Achlorophyllous orchids are similar for many ecological or adaptive strategies and morphological features. For example, among orchids one observes floral convergences such as soft mealy pollen, short column, and fused perianth parts (Molvray et al. 2000) and reduction or absence in vegetative structures such as leaves and associated structures. Such a reduced phenotype results in few or no phylogenetically informative morphological characters that are unique homologies. As a consequence, many of these taxa have traditionally been grouped together because they appear to share many characters that are the result of convergence. One tribe, Gastrodieae, has historically been the repository for many epidendroid taxa that lack chlorophyll (Dressler 1993) and also lack characters that point to other affinities. As part of this study, the concept of Gastrodieae under both the Dressler (1993) and Chase et al. (2003) classifications will be tested using a broader sample of taxa than previously included. 23

46 With reduced dependence on chlorophyll and increased mycoheterotrophy, it is expected that sequence evolution should increase as functional constraints on genomes decrease. This hypothesis is based on the results of numerous studies in which it was observed that achlorophyllous taxa exhibited a transversion bias relative to green sister taxa (eg. Nickrent and Starr 1994, Nickrent and Duff 1996). Orchids for at least some point in their life history are dependent upon fungi for carbon, and with the loss of chlorophyll, this relationship is expected to increase (Rasmussen 1995). Furthermore, the basal Epidendroideae have a large number of achlorophyllous or transitional taxa, consequently orchids are an excellent model for testing this hypothesis. MATERIALS AND METHODS MATERIALS-Taxon sampling- Where possible, two species of each genus were used as representatives of the tribe. Sampling was increased through field collections where possible and in collaboration with the DNA banks at Royal Botanical Gardens Kew and the New York Botanical Garden. Additional sequences were obtained from Genbank (Benson et al. 2006) and from colleagues at the University of Florida and the Departamento de Botânica, Universidad de Campinas, Brazil. Because of the scope and geographical distribution of the taxa in this study, fresh material was obtained with the help of researchers in Brazil, Ecuador, Panama, Mexico, Cameroon, Australia, Singapore, and Japan. Fieldwork was performed throughout the 24

47 eastern United States in late July/August of 2001, Florida in June/July 2002, Panama and central and northern Ecuador in June and July of 2003, and central and southern Ecuador during December of METHODS-DNA Extraction and Purification- Total DNA extraction from fresh or silica dried material was performed using either the CTAB method of Doyle and Doyle (1987) or DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA) for very small quantities of tissue. These extractions were stored at 20 C. In some instances where weak amplifications were seen further purification of the total DNA was performed using the Elu-Quik DNA purification kit (Schleicher and Schuell, Keene, New Hampshire, USA). Amplification and Sequencing- All amplifications were performed initially using standard PCR protocol methods as follows: 50 L reactions were prepared using 40 L HPLC water, 1 L of each of 10 M primer, 5 L buffer (100mM tris HCL [ph 8.8], 35 mm MgCl 2, and 250mM KCL), 0.5 L of 0.20 M dntps, 0.5 L Taq polymerase, and 0.5 L of 10 g/ L of bovine serum albumen. Each reaction had between 1 L to 2.5 L of template. For weak amplicons, a second round of amplification was performed in order to increase overall yield. In nearly all instances, the internal transcribed spacer region (ITS) was amplified using the universal primer pairs of White et al. (1990, but also see Baldwin 1992 and Baldwin et al. 1994), ITS 1 (5 TCCGTAGGTGAACCTGCGG3 ) and ITS 4 (5 TCCTCCGCTTATTGATATGC3 ). In those instances where amplifications yielded messy or non-orchid sequences or multiple bands, a reamplifaction using a nested primer approach was performed using the Sun et al. (1994) primers, 17SE and 26SE, followed 25

48 by a second round of PCR using ITS1 and ITS2; the Sun et al. (1994) primer pairs preferentially amplify angiosperms, thus reducing the occurrence of secondary signals due to other contaminating plant materials and the nested approach helps to increase the yield when an initial reaction resulted in weak bands. ITS1 and ITS4 were used internally for the second amplification and all sequencing. Amplification was performed under the following PCR conditions: an initial denaturation step of 95 C for 5 min, followed by 35 cycles of 95 C for 1 min, 48/52 C for 2 min and 72 C for 2 min; a final 7 min extension at 72 C was performed. The primers of Taberlet (1991) were used in the amplification and sequencing of trnl-f. These primers were C (5 CGAAATCGGTAGACGCTACG 3 ) and F (5 ATTTGAACTGGTGACACGAG 3 ); amplification was performed under the following PCR conditions: an initial denaturation step of 96 C for 3 min, followed by 29 cycles of 96 C for 45s, 64 C for 45s and 72 C for 2 min.; a final 5 min extension at 72 C. Even though the nad1bc mitochondrial locus is highly conserved, it was chosen rather than any of the more extensively studied chloroplast or nuclear loci because of the inaccessibility of chloroplast genes in achlorophyllous orchids. Secondly, nad1bc is relatively easy to align. However, being a Type II intron, it is variable in length (Freudenstein et al. 1998, Freudenstein and Chase 2001, and Kelchner 2002) making it ideal for the use of indels in a phylogenetic study. For the mitochondrial nad1b-c intron, the primers nad1b (5 GCATTACGATCTGCAGCTCA 3 ) and nad1c (5 GGAGCTCGATT AGTTTCTGC 3 ) were used (Demesure et al. 1995). Because of the large indels and extreme sequence length variation the nadm primer (5 GGTGACAGATCGGCCAT AGG 3 ) was used internally in order to obtain 26

49 complete sequences (Freudenstein and Chase 2001). PCR conditions were as follows: an initial denaturation step of 94 C for 4 min, followed by 34 cycles of 92 C for 45s, 52 C for 45s and 72 C for 2 min; a final 5 min extension at 72 C was performed. PCR products were quantified visually using an agarose gel. Products were cleaned using the Wizard PCR Prep DNA Purification system (Promega Corporation, Madison, Wisconsin, USA), Ampure (Agencourt Bioscience Corporation, Beverly, Maine, USA), or 50 L of 20% polyethylene glycol 2.5 M NaCl and sequenced directly using the amplification primers. Sequencing reactions were performed using BigDye Terminator v3.1 chemistry (Applied Biosystems, Foster City, California, USA) in 5 L reactions: 3.32 L distilled water, L DMSO, 1 L Big Dye, and 1 L ABI buffer. These were combined into a master mix and aliquoted at 4.5 L to which 0.5 L of the PCR product was added. The following cycle sequencing protocol was followed: initial denaturation step of 96 C for 1min, followed by 24 cycles of 96 C for 10s, 50 C for 5s and extension phase at 60 C for 4min. Sequences were cleaned using ethanol purification, Sephadex (Sigma-Aldrich, St. Louis, MO USA.) spin columns or Cleanseq (Agencourt Bioscience Corporation, Beverly, Maine, USA). All reactions were run on an ABI Prism 3100 automated sequencer (PE Biosystems, Foster City, California, USA). Alignment - Contigs were assembled using Sequencher (Gene Codes, Ann Arbor, Michigan, USA) and aligned using Clustal X (Thompson et al., 1994). In Clustal X, an initial gap opening /extension costs of 6/3 (ITS), 6/4 (trnl-f and nad1bc) was applied in order to estimate alignments. Being a type II intron, nad1 is generally easy to align regardless of the gap costs assigned. This is true at least for the 5 region of the locus, however there is considerable sequence length variation between taxa. This is due 27

50 to the presence of several hairpin loop regions in which there are a number of indel events making it difficult to align using the algorithms implemented in programs currently in use. It is well known that Clustal X does not perform well in regions with large numbers of gaps, therefore for all loci, the Clustal alignments were manually adjusted using the program Se-Al v (Rambaut, 1996). Outgroup Choice- Based on previous studies of the Orchidaceae, the Epidendroideae are monophyletic, and included all the genera designated as Epidendroideae in this study. Therefore based on these previous results, representatives from across the Orchidoideae were chosen to serve as outgroups thereby rooting the tree by outgroup comparison; this provides the best method for establishing polarity and ancestor descendent relationships. Gap Coding- given the sequence length variation observed in nad1bc and trnl-f, gaps were coded for these two loci and included in the analysis. Gaps were coded using the simple gap coding method of Simmons and Ochoterena (2000) as implemented in SeqState (Müller 2005). Parsimony- Cladistic phylogenetic analyses were performed on each dataset and the combined data using cladistic methodology in a parsimony framework. Parsimony analysis was implemented in the program PAUP* version 4.0b.10 (Swofford, 2002). Data sets were combined in 4 different searches, ITS + trnl-f, ITS + nad1bc, trnl-f+ nad1, and all three together. This was done to explore which if any of the datasets may be contributing the most signal and thus is providing the hierarchy observed in the combined tree. The following approach was taken for all searches; an initial heuristic search was 28

51 performed on 1000 random taxon addition replicates using TBR, with settings to hold two trees per random addition sequence, saving only two trees, multrees in effect, and swapping on best trees only. The best trees from this search were used as starting trees for a second, exhaustive heuristic search in order to search the tree space as thoroughly as possible. Maximum Likelihood- Model-based methods are advocated as a means to integrate knowledge regarding the processes of evolution including transition to transversion ratios, base frequency, etc. Maximum likelihood was performed and implement in PAUP*. A parsimony heuristic search was used following the above methods to obtain an initial starting tree. From this starting parsimony tree, likelihood parameters were estimated from the data in order to determine the best substitution model for the analysis. The estimated values were then applied, and a maximum likelihood heuristic search was performed using the same search settings as in the parsimony search. Branch Support- Following the jackknife search parameter recommendations by Freudenstein et al. (2003), branch support was evaluated on all trees using jackknife as performed in PAUP* set to run 5000 jackknife replicate iterations and with 1 addition sequence replicate in each. Two random addition sequences per replication were used, saving only two trees per random addition sequence, and tree bisection reconnection (TBR) branch swapping was employed for all analyses with Multrees in effect, and swapping on best trees only. With regards to the maximum likelihood analysis, a jackknife search was performed with settings as in the parsimony jackknife, and let run for 1 week; during this time it performed 20 jackknife replicates. 29

52 In subsequent discussions of the results, support for the data was considered weak from 50% jackknife support to 70%; strong support ranged from 71%-85%, and very strong %. No support was considered for anything less then 50%. These values are not significant in terms other than to provide a method for discussion. RESULTS ITS PARTITION-the ITS region is a commonly used locus for phylogenetic inference given its high copy number and relative range of phylogenetic utility (Soltis and Soltis 1998). The ITS matrix of 64 taxa and 900 molecular characters (see Appendix A.1) was submitted for a parsimony heuristic search. Characters were excluded based on the relative amount (i.e. >50%) of missing data for the character position, or regions determined to be so variable that homology assessment was not possible; on this basis I excluded 281 (31%) characters from the analysis leaving 619 positions, and 400 parsimony informative sites. The analysis returned 3 most parsimonious trees (MPTs) of length 2307 (CI=0.412, RI=0.649). A strict consensus was calculated in order to summarize all the MPTs. (Fig. 2.1). The strict consensus was well resolved with a considerable amount of structure, but failed to receive strong support for tribal level relationships, however the monophyly of each of the tribes was supported. Palmorchis and Neottieae were found successively branching at the base of the tree sister to the remaining Epidendroideae. As the next clade to branch, Epipogium united with 30

53 Triphoreae and this clade sister to Sobralieae followed on successive branches by Wullschlaegelia, Nervilieae+ Didymoplexis+ Xerorchis +Diceratostele, Tropidieae and the advanced Epidendroideae. A phylogram showing branch lengths was calculated (Figs. 2.2). Many of the branches are short, with 42 changes between the Orchidoideae and Epidendroideae. Comparatively, some taxa were observed to be subtended by long branches, so in order to test whether these were due to the effects of long branch attraction, a series of experiments were performed in which taxa appearing on long branches were systematically removed and the analyses repeated (Siddall and Whiting 1999). The clade of Triphoreae and Epipogium is subtended by a long branch, with each taxon also on long branches (Fig. 2.2); given that this relationship is an unexpected finding, Epipogium was deactivated and dataset reanalyzed. This returned 15 trees of length 2169 steps (CI=0.430, RI =0.665). The resulting topology of the strict consensus (not shown) found Triphoreae sister to Wullschlaegelia, and with the exception of a loss in structure, it was otherwise unremarkable. Therefore this does not appear to be a case of long branch attraction. On successive branches, Palmorchis and Neottieae were still observed sister to the remaining Epidendroideae with remaining tribes forming a polytomy. Triphoreae (including T. amazonica) was deactivated and Epipogium reactivated. This resulted in eight trees of 2199 steps (CI=0.416, RI= 0.660). In the strict consensus (not shown), both Epipogium and Sobralieae were in a basal polytomy sister to the rest of the Epidendroideae including Neottieae and Palmorchis. Based on the results of these experimental manipulations, the relationship of Epipogium to Triphoreae does not appear to be a case of long branch attraction. 31

54 Another set of manipulations was performed looking at the effects of Didymoplexis pallens and Xerorchis amazonica; the branch subtending this clade is relatively long compared to other clades (Fig. 2.2b) and receiving moderately weak support in the jackknife analysis (69%). The deactivation of Didymoplexis resulted in the retention of 1 MPT of 2189 steps (CI= 0.417, RI=0.661). The topology of this tree was unaffected when compared to the strict consensus of the complete data set, as such this does not appear to be a case of long branch attraction. TRNL-F PARTITION- Numerous attempts were made to amplify the plastid trnl- F region from species of Gastrodia, Epipogium and other achlorophyllous epidendroid taxa but without success. A trnl-f sequence from Wullschlaegelia was obtained by Molvray et al. (M.Chase pers. com) and was initially included in this study but regarded with optimistic skepticism given the numerous unsuccessful attempts to amplify it for both W. aphylla and W. calcarata, as well as the overall difficulty in obtaining plastid sequences from achlorophyllous orchids (Cameron et al. 1999, Cameron 2001, Goldman et al 2001). The resulting strict consensus (not presented) of the heuristic search found a very well supported (89%) relationship of Wullschlaegelia sister to Corallorhiza (Calypsoeae). Based on the results of a study using the plastid matk locus, others have suggested a relationship of the Wullschlaegelia with Aplectrum and Govenia in Calyposeae (see Freudenstein et al. 2004) but this is regarded as not likely given the lack of morphological synapomorphies to support such a group. Arguably a morphological synapomorphy is not needed to validate the results of a molecular study, however, in 32

55 conjunction with the difficulty in obtaining chloroplast loci for achlorophyllous orchids, and the numerous attempts to amplify this genus using different optimizations and protocols, this sequence was removed from all subsequent analyses of this locus. With the removal of the accession of Wullschlaegelia, the matrix (Appendix A.2) consisted of 53 taxa. During the alignment process, it was observed that there were indels that may have phylogenetic utility; therefore gaps were coded using simple gap coding. An analysis with and without gaps was conducted. Including gaps in the analysis increased consistency and retention index values as well as improved resolution and increased support for clades. The parsimony heuristic search of trnl-f including gaps (1326 characters) resulted in 32 MPTs being retained of length 1495 (CI= 0.78, RI= 0.714). There were 400 invariant characters, and 466 parsimony informative characters (35%). Since the analysis returned multiple MPTs, a strict consensus was calculated in order to summarize the results (Fig. 2.3). In general, there was good resolution for most tribal level relationships. While support for each of the tribes was observed, with some exceptions tribal level relationships were unsupported. The Epidendroideae receives very good support. The first clades to branch off within the Epidendroideae are a clade containing Palmorchis sister to Neottieae with weak support (66%), this sister to the remaining Epidendroids with weak support. Neottieae sensu stricto are resolved as monophyletic with weak support. Among the remaining Epidendroid taxa, Triphoreae (100%) and a clade of Tropidia + Xerorchis (without support) form a polytomy followed by a clade of the advanced epidendroid outgroups (55%) and Sobralieae, Nervilia 33

56 and Diceratostele gabonensis. In order to determine which taxa are in conflict, an Adams consensus was also calculated; the topology agreed with that of the strict consensus, but resolved Sobralieae (Fig. 2.4), which received very good support (76%) in the jackknife analysis. NAD1BC PARTITION- Being a type II intron, the nad1 locus is highly conserved, and easily aligned sequence with the exception of a number of variable sized gaps primarily located in loop regions. Analyses of DNA sequence data with and without gaps coded as simple gap characters were performed. The resulting consensus tree of the sequence characters without gaps (not shown) resolved the Epidendroideae, but generally failed to resolve any of the lower order relationships. Previous studies have suggested the utility of gaps for phylogenetic analysis in orchids (Freudenstein et al. 1998, Freudenstein and Chase 2001). In order to test the utility of nad1 gap characters at this level, simple gap characters were coded using SeqState (Müller 2005). The output matrix was imported into PAUP*, and executed implementing parsimony. Both matrices, without gaps and with gaps, were submitted for analysis. The results of the search without gaps (not presented) returned an unstructured tree in which the Epidendroideae was resolved, however internal relationships were not. The matrix (Appendix A.3) consisted of 58 taxa for 2602 characters (710 characters or 27% of the matrix was parsimony informative) consisting of both sequence (1480, 57%) and gap characters (1122, 43%) was submitted for heuristic analysis. This returned

57 trees that were subsequently filtered using best trees ; this resulted in 640 MPTs being retained of length 3236 (CI=0.735, RI= 0.536). Strict and Adams consensus trees were calculated (Fig. 2.5 and Fig. 2.6). The strict consensus returned a very highly resolved topology however there is little jackknife support for any of the relationships (Fig. 2.5). The Epidendroideae is supported with 100% jackknife support. Neottieae and Palmorchis form a clade at the base of the Epidendroideae with Palmorchis sister to Neottieae s.s. This clade is sister to the remaining Epidendroideae in which a clade of the advanced Epidendroids (50%) is next to branch, sister a polytomy of Tropidieae (57%), Triphoreae, Sobralieae (including Nervilia plicata) and a clade of Xerorchis amazonica + Diceratostele gabonensis sister to Gastrodieae (including Epipogium aphyllum and Nervilia shirensis with very good support). The Adams topology differed from that of the strict consensus in uniting Triphoreae and Sobralieae, but was otherwise identical (Fig. 2.6). PARSIMONY COMBINED ANALYSIS- The combined analysis included three loci (trnl-f, ITS, and nad1) and two gap partitions (trnl-f and nad1). The matrix (Appendix A.4) was constructed with 43 taxa and 4828 characters consisting of 1686 (35%) variable parsimony uninformative characters, 1659 (32%) constant and 1202 (26.4%) parsimony informative characters. Eight trees were retained of 5452 steps (CI=0.66, RI= 0.553). Both a strict and an Adams consensus were calculated; the topologies did not differ, therefore the strict consensus is presented for discussion (Fig. 2.7). The resulting topology was fairly well resolved, with each of the tribes receiving some support. Palmorchis was sister to Neottieae; these were sister to the remaining tribes with weak 35

58 support. Triphoreae formed a clade with Epipogium. Tropidieae and Sobralieae form a clade, this a part of a polytomy with the advanced Epidendroideae, and a weakly supported clade of Nervilia + Diceratostele sister to Didymoplexis + Xerorchis. In order to explore which data partition may be influencing the topology of the combined analysis, three analyses were conducted looking at each of the data partitions in combination with one of the other datasets. The ITS +trnl-f+ gaps combined dataset (results not presented) returned a highly structured strict consensus tree with high support for the all the tribes except Triphoreae. Palmorchis and Neottieae branched successively as the first two clades at the base of the Epidendroideae. An unsupported Triphoreae is pulled down sister to Palmorchis. This is sister to the remaining taxa, which form an unresolved polytomy of Nervilieae (including Diceratostele, Xerorchis and Didymoplexis), Sobralieae (including Epipogium unsupported) and a clade of Tropidieae and the advanced epidendroids. The combined trnl-f +gaps and nad1+gaps analysis retrieved a supported Epidendroideae, however there was a lack of tribal level resolution within the Epidendroideae. This analysis recovered Palmorchis sister to Neottieae with weak support (75%). The results of the nad1+gaps and ITS analysis returned Palmorchis and Neottieae successively branching at the base of the Epidendroideae. Sobralieae was recovered, as was Tropidieae and the advanced Epidendroideae. However the relationships between these tribes and the remaining taxa remained unresolved. 36

59 A Partition Homogeneity Test (Swofford 1995; also ILD sensu Farris et al. 1994) was performed using parsimony to measure the amount of incongruence in the individual partitions in the combined analysis. This was performed in PAUP* using 100 partition homogeneity replicates; the results indicated considerable incongruence between the data partitions (P=0.01). In the combined parsimony analysis, Gastrodia procera is observed uniting with Palmorchis, which was seen only in the ITS analysis. Even though there are two complete sequences represented in the combined matrix (ITS and nad1 +gaps) for Gastrodia, the suggestion is that the position of Gastrodia procera may be greatly influenced by the ITS dataset. When analyzed with the other taxa in the nad1 partition analysis, G. procera comes out within Nervilieae sister to G. sesamoides. In order to see whether the position of G. procera in the combined analysis was an artifact of the ITS partition influencing the placement of this genus, two manipulations were performed on the dataset. The nad1 dataset was the only locus for which there were four additional accessions of Gastrodia (Fig ). These accessions were included and missing data were added for the other two outstanding loci. With Epipogium uniting with Triphoreae, an ITS sequence of Epipogium roseum was added in order to improve sampling within the genus. In addition an ITS sequence of Wullschlaegelia aphylla was included because of its importance (either Gastrodieae sensu Dressler [1993], or Arethuseae sensu Chase et al. [2003]) in more fully understanding what are the relationships among the basal epidendroids. 37

60 A matrix of 49 taxa was created and the analysis was rerun including all taxa. This returned two MPTs L= 5903, CI=0.651 RI=0.540; the Adams consensus did not differ from the strict consensus (results not presented). Gastrodia was found to be polyphyletic, Gastrodia sp. ER214, G. seamoides, and G. confusa united with G. procera in Palmorchis as in the ITS analysis. Gastrodia zeylanica, on the other hand, was seen in a position consistent with that seen in the nad1 analysis, sister to Didymoplexis (91% jackknife) in Nervilieae. To determine whether or not G. procera was influencing these results, it was removed from the analysis and the analysis was rerun. The removal of G. procera produced the expected results, Gastrodia species reuniting with Gastrodia zeylanica in Nervilieae (not presented). The relationships of the remaining taxa also differed between the two manipulations with and without G. procera. The inclusion of all taxa produced a more resolved topology, but when G. procera was removed, Triphoreae comes out in a polytomy with Neottieae and Palmorchis, which also fail to unite. In both analyses Epipogium species are sister to the whole of the Epidendroideae. When analyzed with all taxa, Palmorchis was sister to Neottieae followed on successive branches by Triphoreae, Sobralieae, Tropidieae, and Nervilieae sister to the advanced epidendroids. Wullschlaegelia, in both analyses, was sister to the advanced epidendroids orchids. As a result of the loss of resolution observed when G. procera was removed it was of interest to determine what could cause Triphoreae to fall back to an equivocal position in this second analysis. The ITS sequence of Triphora amazonica was considerably more divergent than the other sequences within the genus, and in the ITS analysis it came out with Palmorchis and Gastrodia procera. While this relationship failed to be retrieved in any other analysis, this conflict could influence both support and 38

61 resolution of this combined analysis, resulting in the position of Triphoreae being unresolved. In order to test this hypothesis, using the dataset with both G. procera and Triphora amazonica deactivated, the analysis was rerun. The resulting topology (Fig. 2.8) is presented as a strict consensus of 6MPTs of 5570 steps (CI=0.663 RI= 0.546). With the removal of both G. procera and T. amazonica, both with conflicting ITS sequences, Palmorchis and Neottieae are recovered as sister groups with strong support, these sister to the remaining Epidendroideae. The next clade was Tropidieae followed by a pair of sister clades: Triphoreae (including Epipogium) and Sobralieae, and Nervilieae (including Gastrodieae) and Wullschlaegelia and the advanced epidendroids. MAXIMUM LIKELIHOOD COMBINED ANALYSIS- Due to the methodological and technical limitations of applying this optimality criterion, gap characters were excluded (1466 characters from trnl-f and nad1). The matrix (Appendix A.4) contained 3081 characters from three data partitions (ITS, trnl-f and nad1). The parameters were estimated as follows: two substitution types; TI:TV = ; nucleotide frequencies estimated as A= , C= , G= , T= ; Shape (alpha)=0.5; 4 rate categories. From these values, a model of HYK85+G+I was selected, and a maximum likelihood heuristic search was performed. This analysis resulted in a single ML tree (Fig. 2.9). The resulting topology was highly structured with good support for most clades, and agreed in principle with the combined parsimony analysis regarding tribal level composition. In order to compare topologies without G. procera and T. amazonica to those obtained using parsimony, an ML analysis was performed using the same matrix prepared to test the effects of these taxa on topology reconstruction using parsimony. 39

62 Given the observed effects in parsimony, the analysis was performed with both taxa removed. An initial parsimony search was performed from which from the following ML parameters were estimated: two substitution types, TI:TV= , nucleotide frequencies estimated as A= , C= , G= , T= , Shape (alpha)= 0.5, and four rate categories. These values correspond to a model of HYK85+G. Using these model parameters a maximum likelihood heuristic search was run. The analysis was run for six days, during which time 48 replicates were performed. The topology (Fig. 2.10) is identical to the one obtained using whole dataset, with two notable exceptions. The four Gastrodia accessions are found in clade sister to Nervilieae (including Diceratostele) and Wullschlaegelia branched off after Tropidieae and the advanced Epidendroideae, subtending the clade of Nervilieae, Triphoreae, and Sobralieae. Likelihood jackknife scores were not calculated due to time limitations for computer access. DISCUSSION There have been a number of recent molecular studies of the orchid family, subfamily and tribes that have included members of the basal Epidendroideae (Cameron et al. 1999, Goldman et al. 2001, Freudenstein et al. 2004, Van den Berg et al. 2005). Some authors, particularly those using morphology alone, placed some of the taxa used in the current study in either Orchidoideae or in their own subfamilies (see Chapter 1, but also Dressler 1981, 1993, Szlachetko 1995, Szlachetko and Rutkowski 2000). Based on the results of the current study, the Epidendroideae (sensu Chase et al. 2003) is strongly supported. This is the first study of the Epidendroideae in which there is a significant 40

63 improvement in taxon sampling of the primitive grade of orchids at the base of this subfamily. Furthermore, sample choice greatly influences the patterns of relationships, such that poor sampling increases the probability of obtaining spurious relationships due to unrelated taxa being coded as homologous for the same character. Within the Epidendroideae, it is apparent that the results of the parsimony combined analysis support a more defensible hypothesis of relationships. This study supports many of the tribes as outlined by Dressler and confirms the results of previous authors that Tropidieae and Diceratostele belong in the Epidendroideae (Cameron et al.1999, and Chase 2003), however the monophyly of Gastrodieae is questioned. CONFLICTING SIGNALS USING DIFFERENT OPTIMALITY CRITERIA- The parsimony combined analysis found Gastrodia procera nested within Palmorchis. Removing it caused Triphoreae to become polyphyletic, with Triphora amazonica uniting with Palmorchis. The only other instance these relationships were observed was in the ITS analysis. The implications are that the ITS sequences for these two taxa are contributing conflicting signals, but at least for T. amazonica there is additional signal which unites it with the rest of Triphoreae in the parsimony combined analysis. Although the ML analyses with and without T. amazonica and G. procera did not differ greatly in the overall topologies returned, the removal of these taxa resulted in some very interesting changes in the parsimony topology. There is topological agreement between the two methods when these taxa are removed. Both retain a clade of Triphoreae (including Epipogium) sister to Sobralieae, and a clade of Nervilieae, Diceratostele gabonensis, Xerorchis amazonica, and Gastrodieae. Furthermore, Palmorchis and 41

64 Neottieae are both at the base of the Epidendroideae either with Palmorchis the first to branch off, or sister to Neottieae and this clade the first to branch; but as in previous analyses in this study, the relationships of these taxa to each other are as yet not clear. The only major difference between the two topologies using the different optimality criteria is the placement of the advanced Epidendroideae. In previous studies, Tropidieae and Sobralieae have been seen at the base of the Epidendroideae branching off after Neottieae (Chase et al. 2003). However, when T. amazonica and G. procera are included, Triphoreae (including T. amazonica) is found branching after Neottieae, something not previously suggested, and not found in any other analysis in this study except ITS. When Triphora amazonica and Gastrodia procera are removed, Tropidia is again seen in this at the base of the tree branching after Neottieae. In the parsimony analysis, after Tropidieae, Wullschlaegelia unites with the advanced Epidendroideae this sister to a clade of Nervilieae and Gastrodieae, however, there is no clear reason to support Tropidieae sister to the advanced epidendroid orchids, near the base of the tree as observed in the ML analysis. While this manipulation added more taxa, it included more missing data, which can affect topologies in ways similar to poor taxon sampling resulting in spurious associations from long branch attraction (see Wiens 1998). Given these results, there is nothing to suggest this is the case. The analysis including both Triphora amazonica and Gastrodia procera is more complete for the loci used and will be the results discussed from this point forward. It must be pointed out however that further study is warranted given these results, especially focusing on improving locus sampling. 42

65 TOPOLOGY One issue with topology reconstruction using combined data is whether any single data partition is having a greater influence on the topology than the other partitions. The results of the experimental analysis looking at different partition combinations found that other than the instance of Triphoreae uniting with Palmorchis in the analysis of ITS + trnl-f(+ gaps), there were no groupings of relationships not supported by another analysis and returned in the combined analysis, therefore, the combined parsimony analysis does not appear to be influenced by any single data partition. In addition, these results suggest that ITS and trnl-f may have greater phylogenetic signal at the level of the tribe when combined than nad1, which when included reduced the resolution. Topological congruence between trees obtained from independent data partitions and using different optimality criteria is often touted as evidence for the truth of relationships which are not otherwise supported using traditional support measures (Kelchner 2006). Proponents of the total evidence approach argue that the tree obtained from multiple independent partitions obtained from different loci and different genomes is more indicative of the phylogeny of the taxa then any one partition might be (Grandcolas et al.2001, Kluge 1989, 2004, Kluge and Wolfe 1993). In recent years there has been extensive discussion regarding the use of multiple genes in phylogeny reconstruction (e.g. Goodman et al. 1979, Olmstead and Sweere 1994, Pamilo and Nei 1988). These discussions have focused on instances where there is topological incongruence between gene trees and species trees, which may arise if different genomes and individual genes have different evolutionary rates or histories as consequences of lineage sorting, introgression or modes of inheritance (Wendel and Doyle 1998). By 43

66 using multiple independent genes in a combined analysis in a total evidence approach (Grandcolas et al.2001, Kluge 1989, 2004, Kluge and Wolfe 1993), the processes that affect single genes are outweighed by the collective information content of the combined data set allowing secondary signal to interact in tree construction. In addition, Wenzel and Siddall (1999) argued that homology is additive whereas homoplasy is averaged when datasets are combined, consequently combining datasets should improve phylogenetic signal and provide better evidence for relationships. The total evidence philosophy is the one taken in this study. Moreover there is a considerable amount of homoplasy in the dataset as indicated by the low CI values and the results of the partion homogeneity test. It is important to clarify that this does not mean that these datasets are not combinable, the combined data or total evidence philosophy is that different processes drive evolution in each partition of the matrix, therefore different trees can be returned by each partition when analyzed separately. As parsimony methods are interested in the shortest tree given the data, and as homoplasy tends to add length to a branch, preserving the pattern is preferred over throwing out data. By combining data, secondary signal may be revealed which is not affected by independent processes and histories, and therefore may reflect the species tree. In this study, all of the analyses returned resolved topologies with support for tribes, but lacked support (>50%) for tribal level relationships at deeper nodes. An assessment of support is desirable to some as it is a measure of the confidence of a clade given the data, but support values, regardless of support measure, are not a measure of the truth of any given results so much as a measure of the relative support of the clade 44

67 given the dataset. The choice of using Jackknife rather than other measures of support such as Bootstrap or Bremer support (Bremer Decay Index) is because it minimizes the effects of invariant and phylogenetically uninformative positions by assigning a probability of 1/e (i.e. 37% deletion) of being excluded; therefore using this approach a fraction of the matrix is resampled with each replicate and any character has an assigned probability of being included (63%) in the jackknife matrix. PAUP* was set at 37% deletion in using the emulate Jac command; this is consistent with the sampling strategy of Farris et al. (1996) in which a each character has a probability of 1/e to be included in the jackknife matrix. Support is often low in data sets with high levels of homoplasy. The fact that we obtained well-resolved topologies with low CI values, but relatively higher RI values indicates that many of the nodes are supported by homoplasious characters. The topologies of the trees have some agreement regarding tribal level relationships with much of the conflict between the topologies from the placement of clades with low jackknife support. Many of these are clades with achlorophyllous taxa which are lacking for chloroplast markers in this analysis and are thought to have higher divergence rates as indicated by higher frequency of indel events or a TI:TV bias (see discussion below). For the remainder of the discussion, the total evidence combined trees will be evaluated, particularly the parsimony tree (Fig. 2.7) as this methodology presents the most testable hypothesis of relationships as it assumes the fewest ad hoc hypotheses of homoplasy. 45

68 While the position of Palmorchis is not as yet unequivocal, it is clearly found at the base of the Epidendroideae in all analyses with Neottieae s.s. and these are sister to the rest of the Epidendroideae with good support. On successive branches at the base of the Epidendroideae, Palmorchis (Palmorchideae sensu Dressler 1993) is followed by Neottieae, each clade very well supported; the relationship between these two groups fails to receive support in the parsimony analysis but does receive high support in the ML analysis as sister taxa. On the basis of these findings, I propose to maintain Neottieae to include Palmorchis (sensu Chase et al. 2003). A basal position of Sobralieae sister to Tropidieae and branching after Neottieae had been suggested by Cameron (1999, but also see Chase et al. 2003). The relationships among the other tribes of the basal Epidendroideae failed to resolve in the strict consensus. In the current study, after Neottieae, the next clade observed is Epipogium sister to Triphoreae. Although the position of this clade fails to receive support in the parsimony analysis, the relationship of these two taxa to each other is observed in both the combined parsimony and ML analyses, the latter with jackknife support of 76%. Triphoreae observed at or near the base of the Epidendroideae is not a new observation among molecular phylogenies of these orchids. Cameron (1999) found Triphoreae (including Diceratostele) in a grade with Nervilieae at the base of the Epidendroideae sister to everything including Neottieae. However, this, like most of the relationships among the basal Epidendroideae, failed to receive support and was not recovered in the strict consensus. Dressler (1993) stated that Triphoreae was superficially similar to Neottieae in the flower and that Cephalanthera in particular resembled Triphoreae in the 46

69 column. Cephalanthera (Rasmussen 1982), Triphora, and Psilochilus (see Fig. 3.2) each possesses recurved anther locules and rather prominent apical beaks on the anther. Of the remaining three tribes, the clade of Nervilieae + Diceratostele and Xerorchis + Didymoplexis forms a polytomy with the advanced Epidendroideae and a clade of Sobralieae and Tropideae (Fig. 2.7). Morphologically, Nervilieae could easily be justified in a position near Triphoreae at the base of the tree. Nervilia and Triphora have at times been associated due to similar flower morphology and for much of their history Triphora, Psilochilus and Nervilia have been included together (Chapter 1, Table 1.1). In this analysis Gastrodieae were observed to be polyphyletic, with Gastrodia procera uniting with Palmorchis (this being the result of influence from the ITS partition) and Didymoplexis pallens in Nervilieae. In the morphological analysis of Freudenstein and Rasmussen (1999), Nervilia and Gastrodieae were united, and Chase et al. (2003) moved Epipogium, Stereosandra and Silvorchis to Nervilieae. In the current study when all Gastrodia accessions were included, with the exception of Gastrodia zeylanica, the species were pulled down to a position sister to Palmorchis, consistent with the observation of ITS and the combined analysis. Gastrodia zeylanica came out among Nervilieae sister to Didymoplexis pallens in the clade of Xerorchis. Removal of Gastrodia procera (Fig. 2.8) moves all the Gastrodia together in a polytomy with Didymoplexis pallens, this sister to Xerorchis, which is consistent with the results obtained from the nad1 analysis. However based on these results and previous findings, it appears that there is a close relationship between these tribes. My results do not clarify 47

70 the question of relationships between Nervilieae and Gastrodieae with any certainty, as there is low support for this clade as well as a large amount of missing data for Gastrodia (2 of three loci, but with better sampling within Nervilieae and Gastrodieae using more taxa and additional loci, a more robust hypothesis among these orchids can be presented. In both of the combined analyses (Fig. 2.7 and Fig. 2.9), Tropidieae was observed either sister to or in an equivocal association with the advanced Epidendroideae in a position very near Sobralieae. Morphologically, Sobralieae and Tropidieae share derived features such as reed-stem habit and large fibrous plicate leaves, characteristics observed in a few other taxa among the basal epidendroids such as Xerorchis and Diceratostele (Nervilieae). Based on characters such as these as well as having eight firm pollinia, Dressler included Sobralieae among with the more derived taxa in the so-called reed-stem epidendroid Phylad. Tropidia and Corymborkis both have hamular stipes, which is a trait not observed in other basal taxa, but found in more advanced epidendroids. Sobralieae and Tropidieae are observed as sister groups in the parsimony analysis, consistent with the observations of Chase et al. (2003) however they are in disagreement regarding their position within the Epidendroideae, and given the presence of derived traits found in the advanced epidendroids, these results support a position closer to the more derived taxa. TRIBAL COMPOSITION In Dressler s taxonomy (1993; also see Chapter 1 table 1.1), the tribe consisted of Neottia, Listera, Aphyllorchis, Cephalanthera, Epipactis, and Limodorum. Chase et al. (2003) tentatively placed Palmorchis in Neottieae on the basis of molecular work by Cameron et al. (1999). Neottieae s.s. is clearly supported by this study. In three of the five analyses (trnlf, nad1, and parsimony combined) Palmorchis was sister to Neottieae, receiving support (66%) in the trnl-f analysis. In both the ITS 48

71 analysis and ML combined analysis, it received very high support as the first clade to branch off within the Epidendroideae and sister to everything else, and both the ML combined and the parsimony combined analysis are incongruent with regards to this. Palmorchis is clearly closely related to Neottieae. Given the results of these parsimony analyses, Palmorchis should be included within Neottieae following the classification of the orchids proposed by Chase et al. (2003). Tropidieae are considered a natural group on the basis of morphological synapomorphies of an erect anther subequal to the rostellum and a hamular stipe as well as similar habit and floral morphology. With the exception of the trnl-f analysis in which Tropidia remained united but Corymborkis verticilata came out in a distant polytomy composed of members of Sobralieae and Nervilieae, all the other analyses returned a monophyletic Tropidieae. Based on these findings, the Tropidieae should be considered monophyletic. Internal organization of the terminals within the tribe suggests more sampling may be required within in order to resolve these relationships. Dressler s (1993) concept of Nervilieae was somewhat narrower than that proposed by Chase et al. (2003) who in addition to Nervilia included Xerorchis, Epipogium, Silvorchis, and Stereosandra. The concept of a monogeneric Nervilieae suggested by Dressler (1993) is not supported here. In all the analyses a clade of Nervilia, Xerorchis and Diceratostele gabonensis is found. With the exception of this latter species, these findings support a concept of Nervilieae sensu Chase et al. (2003). These results can neither support nor contradict the inclusion of Silvorchis or Stereosandra given they were not included due to a lack of material for these taxa. The nad1 results are the only results that fail to support the monophyly of Nervilia. In this case Nervilia 49

72 included was polyphyletic with Nervilia plicata observed in Sobralieae, and Nervilia shirenesis in a position consistent with other results of this study. Observation of the sequences for each indicated they are highly divergent, which could result in spurious associations, which could be corrected for with better taxon sampling within Nervilia. Chase et al. (2003) recommended that Epipogium be transferred out of Gastrodieae and placed into Nervilieae based on the findings of Molvray et al. (2000) in which it was seen sister to Nervilia. The result of the current study do not support this given the sister relationship recovered for Epipogium and Triphoreae. In addition, Nervilia is deep in a clade with Diceratostele gabonensis sister to a clade of Xerorchis amazonica and Didymoplexis pallens. There is evidence based on these results that Xerorchis should be included in Nervilieae as suggested by Chase et al. (2003). My results are the first study to suggest that there is a relationship between Xerorchis and Didymoplexis, let alone that Didymoplexis is not closely related to Gastrodia as previously thought hypothesized on morphology. Clearly further study is needed to examine these associations more thoroughly. Given the results of two recent molecular studies (Cameron et al. 1999, Molvray et al.1997), Diceratostele was tentatively in Triphoreae by Chase et al. (2003), and put in a subtribe Diceratostelinae by Rothacker and Rasmussen (see Pridgeon et al. 2005). This decision was based on the results obtained from a single gene, and relatively poor sampling of primitive epidendroid orchids. In terms of vegetative morphology and habit, Diceratostele is not similar to any other member of Triphoreae appearing more closely related to taxa such as Tropidia or Sobralia. Dressler (1993) suggested that Diceratostele resembled Tropidia or Corymborkis in habit; additionally, no 50

73 morphological synapomorphies support a relationship with Triphoreae. For example, Diceratostele seeds are considered to be Goodyera type (Dressler 1993, Tohda 1995) while other members of this tribe are referred to the Eulophia type (Barthlott 1979). Goodyera type seeds are characterized as dust-like, ca. 5 cells wide, with testa cells isodiametric or slightly elongate with intercellular spaces. Eulophia type seeds are clubshaped balloons to threads, whitish-brown, with elongate testa cells, lacking intercellular spaces, and a cell border covered by a cuticle. The current study indicates that Diceratostele is more closely related to Nervilieae and in particular Nervilia, and should probably be transferred to that tribe as consequence; Nervilia has a similar seed type to the Goodyera seed type (Dressler 1993). This raises some rather interesting biogeographical questions as Diceratostele is Old World African, Nervilia is also Old World, but found in Asia, and Xerorchis is New World. Diceratostele and Xerorchis are both are tropical species with plicate, fibrous leaves and reed-stem habits. Interestingly, they also seem to share a feature of sympodial branching (term used in Rasmussen and Rasmussen [1979]), a characteristic not seen in other basal epidendroid orchids. Yet the nad1 tree (Fig ) is the only analysis that places Diceratostele and Xerorchis together, while in all the other analysis s Diceratostele was seen at the base of Nervilia. Given the similarity in habit, a relationship to Xerorchis cannot yet be ruled out, and requires further investigation including the use of morphology and an increased sampling within the tribe. Sobralieae has often been considered more derived than the other primitive epidendroids, and is composed of three to four genera (Elleanthus + Epilyna, Sobralia, and Sertifera). Dressler (1993) considered Sobralieae to be part of an advanced group of 51

74 orchids he called the Epidendroid Phylad given Bletia seed type and eight solid pollinia. The Bletia seed type is characterized as dust-like or balloon seeds to thread-like, with flat trough-shaped elongate testa cells with a smooth surface (Dressler 1993). Moreover, Sobralieae have a reed-stem habit and an operculate anther; morphology alone suggests that it might be more closely related to the advanced epidendroid outgroups, than the more primitive taxa of the basal Epidendroideae. The trnl-f analysis was the only analysis that failed to recover a resolved Sobralieae, however the Adams consensus (Fig.2.4) shows there is conflict between terminal relationships, and as such the strict consensus presented does not resolve the tribe. The monophyly of Triphoreae (sensu Dressler 1979,1993) is supported by this study. Psilochilus could not be amplified for ITS and was not included in the analysis of that locus. Moreover, this was the only analysis that recovered a polyphyletic Triphoreae, where Triphora amazonica was found in Palmorchis. This sequence was complete, yet highly divergent relative to other members of this tribe, nevertheless there was no reason seen to exclude it from the analysis. That sequence was provided by E. R. Pansarin from material collected in Brazil and amplified as part of work related research being conducted by that individual. Additional amplification attempts of an accession (ER73) of this species from the same population as that of Pansarin were made, however no useable sequences were obtained. With the exception of T. amazonica, the remaining Triphoreae were recovered in the ITS analysis with high support. Resembling the ITS results, the ML analysis recovered a polyphyletic Triphoreae, with T. amazonica and Gastrodia uniting among Palmorchis which suggests that the ITS partition may have a greater influence on the ML than on parsimony which recovered a monophyletic 52

75 Triphoreae. One explanation for this lies with the technical limitations of the ML methodology in which gaps are excluded from the analysis; the parsimony combined analyses were performed with both sequence and gap characters. The nad1 locus is highly conserved, with most of the phylogenetic signal at the level of interest coming from gap characters. Given the lack of sufficient tribal level signal when using nad1 sequence data only, the effects of excluding gaps on the ML analysis are evident in the recovery of a polyphyletic Triphoreae. Members of Triphoreae are found exclusively in the Western Hemisphere, from northern South America, Central America, the Caribbean, and eastern North America, with the highest diversity found in tropical and subtropical Americas. In all analyses, Monophyllorchis, which is found in South and Central America, is seen to be the first genus to branch off within the tribe, followed by Psilochilus and Triphora. Psilochilus is also found throughout South America and the Caribbean. Within Triphora, the South American/Amazonian, T. amazonica is at the base of the clade followed by a clade of the pan-caribbean, T. gentianoides and the temperate T. trianthophora. Based on these results, given the sampling, it appears that the tribe evolved in the Southern Hemisphere and expanded its range into North America. No previous study has suggested that Epipogium might be related to Triphoreae. Both ML and parsimony combined analyses support a sister relationship between Epipogium and Triphoreae (Figs ). The only analysis that failed to recover this relationship was the nad1 partition including gaps in which Epipogium was sister to Nervilia with high support, a position consistent with that argued by Chase et al (2003). The results of the trnl-f analysis can neither support nor refute these relationships, 53

76 because this locus did not amplify for Epipogium. Both Triphoreae and Epipogium possess monads, pollen grains with smooth tectum, irregular sectile massulae, columnar stigmatic cells, prominent undetached viscidium, and a prominent apical thick anther beak similar to that observed in Triphora trianthophora (Rasmussen 1981, Freudenstein and Rasmussen 1999, and this study [see Chapter 3 for discussion]). Epipogium has a rather unique tuberous rhizome and villous, reduced roots superficially similar to those observed in Triphora, especially T. gentianoides, but also present in T. trianthophora. With the exception of vegetative characters such as reduced or absent leaves, which is associated with a lack of chlorophyll (some achlorophyllous Triphora), the flower of Epipogium is so highly derived that there are no apparent floral synapomorphies. Dressler (1981) reported that Epipogium possessed an erect anther but revised this by 1993 where he reported that it possessed an incumbent or sub-erect anther, most likely referring to the somewhat recurved appearance of the anther; Epipogium aphyllum is clearly incumbent as shown in Rasmussen (1982, Fig. 28) and Vermeulen (1965), but the anther of E. roseum is sub-erect (Rasmussen 1982, Fig. 30). The flower and column of Epipogium are highly derived in that the perianth is fused and the column is much reduced, characteristic features both of self- pollination and a loss of chlorophyll. The loss of chlorophyll and associated increase in mycoheterotrophy also reduce vegetative characters such as leaves and habit. Yet no single morphological character could be considered a unique synapomorphy for the relationship of Epipogium and Triphoreae and moreover, many are symplesiomorphies seen in other primitive Epidendroideae. In addition, Epipogium is Old 54

77 World, found throughout Europe, Africa, and Southeast Asia. Given the current distribution of Triphoreae, there exists a geographic disjunction between sister taxa. Because of the complex tectonic and geological history of the regions to which these taxa are currently found, biogeographic relationships may also be complex. The Orchidaceae as a family began to evolve rapidly in response to the evolution of the bees, a major pollinator group (Chase 2001), for which long tongue bees are at least 65 mya old (Michener and Grimaldi 1988). This places diversification of the orchids during the late Cretaceous period, and after the breakup of Gondwana had begun. Triphoreae, based on the results presented here, evolved in South America and expanded its range northward, therefore, the most recent common ancestor to both Epipogium and Triphoreae must have been present in both Africa and South America prior to 65mya. The implication is that the most recent common ancestor diverged as a result of this vicariance event. Other orchids exhibit similar patterns of associations between Africa and South America, some in support of long distance dispersal and others ancestral distributions separated by vicariance. Oeceoclades maculata in the Western Hemisphere may be the result of long dispersal from Africa to South America after the breakup of Gondwana (Stern 1988), arriving in the Caribbean and Florida during the mid 1970 s (Nir 2000). Vanilla, Campylocentrum, Polystachya, as well some members of the Angraecinae are all taxa with current distributions in South America, Asia, and Africa which can also be attributed to vicariance as a result of the breakup of Gondwana (Chase 2001). Gastrodieae have traditionally been the repository for many of those orchids with epidendroid affinities lacking chlorophyll, but without definitive associations to other tribes based on some other set of characteristics. Dressler (1993) suggested that the taxa 55

78 of Gastrodiinae were united based on the characters of petal fusion, Gastrodia seed type, and the habit of saprophytism. The Gastrodia seed type is characterized as small dust or thread seeds from 1.5 x m, white or light brown with isodiametric testa cells with reticulate thickenings and a covered cell border (Dressler 1993). Given the results of this study Gastrodieae, as sampled in here, is not consistent with Dressler s (1993) concept of the tribe, nor is it monophyletic based on the taxonomy of Chase et al. (2003). The condition of achlorophylly also affects molecular markers, such as resulting in a reduced plastid genome (Cameron et al. 2000, Cameron 1999, Freudenstein 2000) and the work of Nickrent, Duff and others (see below for discussion) found increased rates of evolution in the other genomes as well. The observation that Wullschlaegelia is inconsistent in its affinities in the various manipulations is not surprising given that it is achlorophyllous and has a higher rate of evolution as indicated by the long branch subtending it. The results of both analyses show the importance of taxon sampling in obtaining spurious relationships between taxa. In the ITS analysis in which Epipogium was removed, Triphoreae unites with Wullschlaegelia. This may be an indication of long branch attraction between Triphoreae and Wullschlaegelia as each is subtended by long branches. Furthermore, it is interesting to note that the position of Wullschlaegelia can be greatly affected by the removal of a single taxon (e.g., Didymoplexis or Xerorchis), which shows the importance of taxon sampling in preventing the resolution of spurious relationships. Improving taxon sampling, such as including sequences from both species of Wullschlaegelia and adding sequences for the closely related genus Uleiorchis, should help resolve these relationships. 56

79 THE LOSS OF CHLOROPHYLL- As a character, the loss of chlorophyll has been discussed as being a convergent condition by a number of authors. Within the angiosperms, it is evident that the condition of being green (presence of chlorophyll) is a symplesiomorphy, with the loss of chlorophyll being the derived condition. By some estimates, achlorophylly and holoparasitism have evolved a minimum of 400 times in different families of flowering plants (Furman and Trappe 1971). Dressler (1993) reports that saprophytism (i.e. mycoheterotrophy associated with achlorophylly) arose at a minimum of 10 times in the orchids. There is no doubt that this is a conservative estimate given that Gastrodieae as circumscribed by most authors is a repository for achlorophyllous, leafless, mycoheterotrophic orchids with epidendroid affinities and as such is probably not a natural group. Molvray et al. (2000) reported a high level of convergence for achlorophylly when it was mapped onto an 18S topology and is associated with some combination of a reduction in pollinator specificity and complex pollinator/flower interactions, or increased autogamy when associated with a reduced or absent rostellum. Based on these results it appears that achlorophylly evolved a minimum of 5 times (Fig. 2.7) among the basal Epidendroideae. Putatively achlorophyllous angiosperms have been reported to have at least some small amount of chlorophyll present in their tissues (Cummings and Welschmeyer 1998). In orchids, Cephalanthera austiniae and Corallorhiza maculata are reported to possess low, but detectable levels of both chlorophylls a and b. Cephalanthera austinae is pigment free while Corallorhiza maculata contains additional pigments and higher levels of chlorophyll. This is consistent with more recent observations made of different species of Corallorhiza (C. F. Barrett pers com.). The implications of these findings are 57

80 that for terrestrial achlorophyllous taxa, the incomplete absence of chlorophyll may be masked by the presence of other pigments such as anthocyanins or carotenoids, and therefore while their concentrations are much reduced, chlorophyll and hence chloroplasts, still occur in some taxa and could therefore contribute photosynthates. The lack of pigmentation all together may be the end result of holomycoheterotrophy and reduced/absent functional chloroplast genomes, as indicated in some studies of holoparastic angiosperms. Duff and Nickrent (1997) found that mitochondrial 19S rdna sequences from holoparasitic plants expressed higher rates of substitutions and a transversion bias indicated by lower transition to transversion (TI:TV) ratios than related, nonholoparasitic green plants. This is consistent with findings made in earlier studies of the same holoparasitic non-asterid taxa in which both nuclear (18S rrna) and chloroplast (16S rrna) loci were studied (Nickrent and Starr 1994, Nickrent and Duff 1996, and Nickrent et al. 1998). As a general rule the results of these studies indicate that one should expect higher rates of nucleotide substitutions and subsequent divergence rates in those taxa that lack chlorophyll as functional constraints of the genomes is reduced. This is measured by lower TI:TV and nucleotide base substitutions (e.g. longer branches) when compared to green relatives. The absolute rate of transitions is higher than that of transversions; therefore transversion bias is observed when transitions become saturated making transversions appear more frequent (Moore and DeFilippis 1997). Given the results of this previous work, it was expected that achlorophyllous taxa would express higher rates of evolution as observed by higher substitution rates and lower TI:TV ratios. This study confirms this for the nuclear ITS (Table 2.1) and the 58

81 mitochondrial nad1 locus (Table 2.2) for which there were significant numbers of achlorophyllous taxa represented. The difficulty in obtaining plastid sequences from taxa suspected of lacking chlorophyll is indirect evidence for a reduced or absent plastid genome in these plants. In addition, achlorophyllous or nearly achlorophyllous species tended to be on longer branches than green taxa, signifying higher rates of sequence change along these branches. Furthermore, TI:TV ratios were relatively lower in achlorophyllous species than chlorophyllous ones in the same clade and generally lower than other taxa. Moreover, achlorophyllous, pigment-free taxa such as Epipogium and Wullschlaegelia had lower TI:TV than other achlorophyllous pigmented taxa such as Gastrodia procera and Neottia. Further evidence for greater evolutionary change among achlorophyllous taxa comes from sequence length changes. Achlorophyllous taxa on average had shorter sequences and higher percentages of gaps than other taxa (Tables ). The wholly achlorophyllous pigment-free Epipogium aphyllum, is the only representative of this type of achlorophylly in the nad1 dataset, therefore broad conclusions from this observation cannot be made, however it was considerably lower than other achlorophyllous taxa. Some anomalous results were observed for pigmented taxa such as Nervilia for nad1 and Triphoreae (Triphora trianthophora and Monophyllorchis maculata) for ITS. These had much lower TI:TV scores than other taxa to which they are putatively related. One explanation for this is that these taxa are in transition to becoming achlorophyllous holoparasites. Triphora trianthophora for example is found with some plants in a population being green while others are wholly achlorophyllous (T. trianthophora forma rossiii) with a gradient in the middle. Additionally, both Nervilia and Monophyllorchis 59

82 are found in dense tropical understories where photosynthesis is greatly reduced. While not presented because achlorophyllous taxa failed to amplify for the trnl-f locus, pairwise base comparisons show that Triphora trianthophora exhibits ratios similar to green taxa, whereas species of Psilochilus and Monophyllorchis maculata both exhibited low ratios (by as much as 50%) consistent with the hypothesis that taxa without chlorophyll or those that are becoming holoparasitic should have lower values. It is apparent that further investigation is needed in order to study this more thoroughly. THE UTILITY OF NAD1B-C- The mitochondrial marker used in this study was the NADH dehydrogenase subunit 1 (nad1) intron between the B and C exons (nad1b-c). In plants, the mitochondrion generally has low rates of nucleotide sequence evolution compared to the other two genomes (Soltis and Soltis 1998). The results of both the nuclear ITS and mitochondrial nad1b-c intron datasets are consistent with this general observation in that there was an observable difference in rates of evolution between the two loci. This is best observed in the lower number of nucleotide substitutions calculated for the nad1b-c locus (Table 1.4) than those calculated for the same taxa using ITS. Intron families are characterized by their conserved secondary RNA structure consisting of stems and loops regions associated with exon/intron borders (Michel and Dujon 1983, Michel et al. 1989, Kelchner 2002). As a type II intron, the nad1 mitochondrial locus is highly conserved making alignment relatively easy with the exception of a number of variable length mutations found primarily in loop regions. Most of the length variation observed was seen in the large 781bp loop of the IV domain. Functionally, stem regions are more conserved than loop regions. Kelchner (2002) argued that stem regions will most likely be sites of transition mutations as these, while not being 60

83 synonymous substitutions per se, are less likely to cause a structural change in the secondary structure. Loops on the other hand are under less functional constraint and exhibit a greater degree of length change. In terms of the overall performance of nad1 in this analysis, it is clear that nucleotide data alone did not have enough signal to sufficiently resolve relationships at the level of interest. The proportion of parsimony informative sites went from 15% to 27% with the inclusion of gaps even though the absolute number of sequence positions was much lower when gaps were coded. In addition, there were a high number of constant characters (21%) and parsimony uninformative (64%) characters relative to parsimony informative characters in the matrix. Wenzel and Siddall (1999) reported that you need a lot of noise (i.e. homoplasy) in a data set in order to swamp out the phylogenetic signal (see also Källersjö et al. 1999). Gaps when included in a phylogenetic analysis significantly improved the overall signal and increased phylogenetic resolution. Given the relatively high CI values, including nad1 gaps still did not resolve tribal level relationships among the basal Epidendroideae. Therefore the nad1 locus is not adequate for studies below the level of the subfamily. CONCLUSIONS This is the first study of these taxa in which there has been a significant improvement in both taxon and locus sampling, providing a first look at historical patterns of relationships among the basal epidendroid orchids from which further investigation can proceed. In addition, my results show that the basal epidendroid problem is not intractable. Combining data in phylogenetic analysis permits secondary 61

84 phylogenetic signal to contribute to topology reconstruction, essentially reducing the effect of different histories, and evolutionary processes that may affect different partitions of the data. This approach provides the best evidence of phylogenetic relationships. The basal epidendroid problem in resolving historical relationships is that, given the apparent rapid radiation of the subfamily, there are often short branches with few characters supporting them. The issues of differing gene and genome histories compound this, and together results in a lack of strong support for deeper nodes, and different topologies observed in analyses of the individual partitions. Therefore in order to come up with a hypothesis of relationships for these orchids, statistical support will have to be secondarily important, giving way to congruence between topologies in a combined analysis using different methods. There are still some issues with regard to defining Nervilieae in the sense of any of the previous classifications. My results support moving Diceratostele out of Triphoreae into Nervilieae (sensu Chase et al. 2003) or into an association with Nervilia. Also, Nervilieae is in some way closely associated with Gastrodia and Didymoplexis, but given the ambiguities with the placement of Gastrodia into this higher-level organization, further work is needed to work out the details. Epipogium, which was included in the Nervilieae by Chase et al. (2003), appears in all the analyses to be sister to Triphoreae or to Monophyllorchis within Triphoreae. In either case, the implications are that it should be moved. Further work at the tribe level will be need in order to determine whether or not to include Epipogium in Triphoreae or put it into a monotypic tribe sister to Triphoreae. 62

85 The affinities of the achlorophyllous Wullschlaegelia remain somewhat unclear. An exemplar of this genus appears in only a single partition, ITS sister to a clade containing Nervilieae + Didymoplexis, Tropidieae, and the advanced epidendroids, while in the combined analysis in which it was included, it is observed sister the advanced epidendroids. The ITS sequence of this accession is highly divergent from all of the other sequences as indicated by the long branches subtending it. It is suggested that additional accessions be amplified for these loci, as well as obtaining a sample of the closely related Uleiorchis (Born et al. 1999). The parsimony analysis (Fig. 2.7) places Neottieae sister to Palmorchis at the base of the Epidendroideae, followed by Triphoreae. Tropidieae and Sobralieae form a clade, however the relationship between these, Nervilieae and the advanced Epidendroids has not been resolved. This is the first step towards a phylogenetic hypothesis of relationships among the basal tribes of the Epidendroideae, and there is still a lot of work to be done. Greater taxon sampling has already improved the resolution of relationships among the basal epidendroid orchids, and the combined analyses were able to recover relationships not seen in the analyses of the individual partitions, and improve the resolution some, as a result of secondary signal coming through. These first steps, although tentative, are finding that patterns of relationships may not be intractable given enough data. 63

86 % ti/tv Taxon Length Gaps ratio Corycium nigrescens Codonorchis lessonii Goodyera macrantha Pterygodium catholicum Brownleea coerilea Monandenia bracteata Palmorchis trilobulata Palmorchis trilobulata Palmorchis powellii Palmorchis sp.1 ER Palmorchis sp.2 ER110E Palmorchis sp. ER Palmorchis sp Gastrodia procera Cephalanthera austiniae Cephalanthera damasonium Cephalanthera longifolia Epipactis helleborine Epipactis fageticola Epipactis lusitanica Limodorum abortivum Listera smallii Neottia nidus-avis Corymborkis sp Corymborkis verticilata Continued Table 2.1: ITS sequence information including sequence length, % gaps and transition/ transversion ratios. Bold entries indicate achlorophyllous or holomycoheterotrophs. 64

87 Table 2.1 Continued % ti/tv Taxon Length Gaps ratio Tropidia effusa Tropidia graminae Tropidia polystachya Epilyna jimenzeii Epilyna hirtzii Sertifera columbiana Sertifera sp Elleanthus sp Elleanthus lancifolius Elleanthus cynarocephalus Ellianthus oliganthus Elleanthus tricallosus Sobralia amabilis Sobralia fimbriata Sobralia crocea Sobralia mucronata Diceratostele gabonensis Epipogium aphyllum Epipogium roseum Nervilia shirensis Nervilia plicata Nervilia holochila Didymoplexis pallens Xerorchis amazonica Monophyllorchis maculata Triphora trianthophora Triphora gentianoides Triphora amazonica Calypso bulbosa Ephippianthus schmidtii Chysis bractescens Coelia triptera Corallorhiza trifida Eulophia sp Wullschlaegelia aphylla Isochilus amparoana Leptotes bicolor Oreorchis patens Govenia sp Avg.=

88 % ti/tv Taxon Length Gaps ratio Brownleea caerulea Altensteinia palacea Disperis lindleyana Goodyera pubescens Habenaria repens Orchis quadripunctata Pachyplectron arifolium Spiranthes cernua Stenoglottis longifolia Palmorchis trilobulata Palmorchis powellii Epipactis helleborine Limodorum abortivum Cephalanthera damasonium Cepahalanthera austiniae Neottia nidus-avis Listera smallii Listera convol Listera cordata Aphyllorchis montana Corymborkis verticilata Tropidia effusia Tropidia curculigoides Tropidia bambusifolia Sertifera columbiana Sertifera sp Elleanthus sp Epilyna jemenzii Epilyna hirtzii Sobralia mucroanta Sobralia crocea Xerorchis amazonica Epipogium aphyllum Nervilia plicata Nervilia shirensis Continued Table 2.2: Sequence characteristics for nad1 including length variation, % gaps, and transition/ transversion ratios. Bold entries indicate achlorophyllous/holomycohetrotrophs. 66

89 Table 2.2 Continued % ti/tv Taxon Length Gaps ratio Gastrodia sesamoides Gastrodia procera Gastrodia sp. Reunion Island Gastrodia confusa Gastrodia zeylanica Diceratostele gabonensis Didymoplexis pallens Psilochilus macrophyllus Psilochilus sp. LJ Triphora trianthophora Triphora gentianoides Triphora amazonica Monophyllorchis sp Aplectrum hyemale Bletilla striata Isochilus amparoana Calypso bulbosa Leptotes bicolor Ephippianthus schmidtii Chysis bractescens Coelia triptera Avg.=

90 Figure 2.1: Strict consensus tree returned from an analysis of the nuclear ITS locus calculated from 3 MPTs of length 2307 (CI=0.412, RI=0.649). Numbers below branches are jackknife support values > 50%. 68

91 Corycium nigrescense Pterygodium catholicum Codonorchis lessonii Goodyera macrantha Brownleea coerilea Monadenia bracteata Palmorchis Sp ER110 Palmorchis sp1 ER110E Palmorchis powellii Gastrodia procera Palmorchis sp ER129 Palmorchis O- 462 Triphora amazonica Palmorchis trilobulata Palmorchis trilobulata Cepahalanthera austiniae C. damasonium Cephalanthera longifolia Limodorum abortivum Listera smallii Neottia nidus-avis Epipactis lusitanica Epipactis helleborine Epipactis fageticola Epipogium aphyllum Epipogium roseum Monophyllorchis maculta Triphora trianthophora Triphora gentianoides Sobralia amabilis Sobralia fimbriata Sobralia crocea Sobralia mucronata Sertifera columbiana Sertifera n546 Epilyna jimenzeii Epilyna hirtzii Elleanthus tricallosus Elleanthus sp Elleanthus oliganthus Elleanthus lancifolius E. cynarocephalus Wullschlaegelia aphylla Didymoplexis pallens Xerorchis amazonica Diceratostele gabonensis Nervilia plicata Nervilia shirensis Nervilia holochila Corymborkis sp 0542 Corymborkis verticillata Tropidia graminae Tropidia effusa Tropidia polystachya Eulophia sp Chysis bractescens Isochilus amparoana Leptotes bicolor Coelia triptera Calypso bulbosa Ephippianthus schmidtii Govenia sp Corallorhiza trifida Oreorchis patens Palmorchis Neottieae Triphoreae Sobralieae Nervilia Tropidieae Advanced Epidendroids Figure

92 Corycium nigrescense AJ Pterygodium catholicum Codonorchis lessonii Goodyera macrantha Brownleea coerilea AJ Monadenia bracteata Palmorchis Sp ER110 Palmorchis sp1 ER110E 9 Palmorchis powelllii Gastrodia procera ER64 Palmorchis sp ER129 Palmorchis Triphora amazonica Palmorchis trilobulata Palmorchis trilobulata ER Cephalanthera austiniae Cephalanthera damasonium Cephalanthera longifolia Limodorum abortivum 10 changes Listera smallii Neottia nidus-avis Epipactis lusitanica Epipactis helleborine Epipactis fageticola Continued Figure 2.2: Phylogram of 1 of 3 most parsimonious trees. Numbers indicate character changes along the branch. 70

93 Figure 2.2 Continued Sobralia amabilis Sobralia fimbriata Sobralia crocea 49 9 Sobralia mucronata 1 20 Sertifera columbiana Sertifera n Epipogium aphyllum Epipogium roseum 60 Monophyllorchis maculata Triphora trianthophora Triphora gentianoides 28 Epilyna jimenzeii Epilyna hirtzii Elleanthus tricallosus Elleanthus sp Elleanthus oliganthus 11 6 Elleanthus lancifolius Elleanthus cynarocephalus Wullschlaegelia aphylla Diceratostele gabonensis Nervilia plicata Nervilia shirensis 16 Nervilia holochila 2 14 Corymborkis sp 0542 Corymborkis verticillata 2 Tropidia graminae 9 9 Tropidia effusa Didymoplexis pallens Xerorchis amazonica 62 Tropidia Eulophia sp 15 9 Chysis bractescens Isochilus amparoana 28 Leptotes bicolor 28 Coelia triptera Calypso bulbosa Ephippianthus schmidtii Govenia sp Corallorhiza trifida 5 Oreorchis patens 71

94 Figure 2.3: Strict consensus tree for trnl-f including gaps coded using simple gap method. Tree returned from 32 most parsimonious trees of length 1495 (CI=0.78, RI=0.714). Numbers indicate jackknife support values >50% for relevant clades. 72

95 Monadenia bracteata Brownleea coerulea Pterygodium catholicum Corycium carnosum Codonorchis lessonii Goodyera sp Platylepis polyadenia Palmorchis Er211 cf trilobulata Palmorchis sp. Palmorchis silvicola Cephalanthera damasonium Listera smallii Listera cordata Neottia nidus-avis Neottia sp Epipactis sp Epipactis Aphyllorchis pallida Aphyllorchis montana Limodorum spp Limodorum abortivum Tropidia effusa Tropidia gramineae Xerorchis amazonica Xerorchis sp. Monophyllorchis maculata Monophyllorchis microstyloides Psilochilus macrophyllus Psilochilus modestus Triphora gentianoides Triphora amazonica Triphora trianthophora Coelia triptera Chysis bractescens Calypso bulbosa Leptotes bicolor Eulophia sp Isochilus amparoanus Ponera striata Govenia liliacea Oreorchis patens Corallorhiza trifida Elleanthus lancifolius Elleanthus Corymborkis verticillata Epilyna jimenzii Sertifera columbiana Sobralia crocea Sobralia mucronata Nervilia aragoana Nervilia shirenensis Nervilia plicata Diceratostele gabonensis Palmorchis Neottieae Tropidieae Xerorchis Triphoreae Advanced Epidendroids Sobralieae + Corymborkis Nervilieae Diceratostele Figure

96 Corymborkis verticillata Corymborkis Nervilia aragoana Nervilieae Nervilia shirensis Nervilia plicata Diceratostele Diceratostele gabonensis Sobralia crocea Sobralia mucronata 76 Elleanthus lancifolius * Elleanthus sp 374 * Sobralieae Epilyna jimenzii * Sertifera columbiana Figure 2.4: Adams consensus for the portion of the trnl-f strict consensus for which there was a lack of resolution. * indicates taxa in conflict in the 32 MPTs. Arrows indicate nodes which not recovered in the strict consensus. Number beneath branches are jackknife support values of > 50%. 74

97 Figure 2.5: Strict consensus tree for nad1, returned from 640 most parsimonious trees of length 3236 (CI=0.735, RI=0.536). Numbers indicate jackknife support > 50%. 75

98 Codonorchis lessonii Corycium nigrescens Brownleea caerulea Disperis lindleyana Habenaria repens Orchis quadripunctata Stenoglottis longifolia Goodyera pubescens Pachyplectron arifolium Altensteinia palacea Spiranthes cernua Palmorchis trilobulata Palmorchis powellii Aphyllorchis montana Epipactis helleborine C. damasonium Limodorum abortivum Cephalanthera austiniae Neottia nidus-avis Listera smallii Listera convol Listera cordata Ephippianthus schmidtii Calypso bulbosa Aplectrum hyemale Bletilla striata Isochilus amparoana Leptotes bicolor Chysis bractescens Coelia triptera Corymborkis vert Tropidia cuciculigoides Tropidia Effusia Tropidia bambusifolia Monophyllorchis maculata Psilochilus macrophyllus Psilochilus sp LJ6914 Triphora amazonica Triphora trianthophora Triphora gentianoides Elleanthus sp Sobralia mucroanta Sobralia crocea Epilyna jemenzii Epilyna hirtzii Nervilia plicata Sertifera columbiana Sertifera sp N565 Xerorchis amazonica Diceratostele gabonensis Epipogium aphyllum Nervilia shirensis Gastrodia sesamoides Gastrodia procera Gastrodia sp reunion Gastrodia confusa Gastrodia zeylanica Didymoplexis pallens Palmorchis Neottieae Advanced Epidendroids Tropidieae Triphoreae Sobralieae Gastrodieae Figure

99 * Monophyllorchis maculata Psilochilus macrophyllus Psilochilus sp LJ6914 Triphora amazonica Triphora trianthophora Triphora gentianoides Xerorchis amazonica Diceratostele gabonensis Epipogium aphyllum Nervilia shirensis Gastrodia sesamoides Gastrodia procera Gastrodia sp reunion Gastrodia confusa Gastrodia zeylanica Didymoplexis pallens Triphoreae Nervilieae Gastrodieae Figure 2.6: Portion of the nad1 Adams consensus tree; * indicates node not obtained in strict consensus. 77

100 Figure 2.7: Strict consensus tree returned from the parsimony analysis of the combined data from three loci: trnlf, trnlf gaps, ITS, and nad1, nad1 gaps (L= 5452, CI=0.666, RI=0.553). 78

101 Codonorchis lessonii Corycium sp. Brownleea coerulea Goodyera sp. Palmorchis sp. Palmorchis trilobulata Gastrodia procera Aphyllorchis montana Epipactis sp. Limodorum abortivum C. damasonium Cephalanthera Listera smallii Listera cordata Neottia nidus-avis Epipogium aphyllum austiniae Monophyllorchis maculata P. macrophyllus Psilochilus sp. LJ6914 Triphora amazonica T. trianthophora Triphora gentianoides Xerorchis amazonica Didymoplexis pallens Diceratostele gabonensis Nervilia plicata Nervilia shirensis Calypso bulbosa Chysis bractescens Isochilus amparoana Corallorhiza trifida Oreorchis patens Tropidia effusa Corymborkis verticillata Tropidia sp. Sobralia crocea Sobralia mucronata Sertifera columbiana Sertifera sp. Epilyna jimenzeii Epilyna hirtzii Elleanthus lancifolius Elleanthus sp. Palmorchis Neottieae Triphoreae Nervilieae Advanced Epidendroids Tropidieae Sobralieae Figure

102 Figure 2.8: The strict consensus from calculated from 6 MPTs of length 5570 (CI=0.663, RI=0.546) returned from the combined analysis excluding Gastrodia procera & Triphora amazonica, but including all partial sequences of Wullschlaegelia, Epipogium and Gastrodia species. Numbers below branches indicate jackknife support >50%. 80

103 Codonorchis lessonii Corycium sp Brownleea coerulea Goodyera sp Palmorchis trilobulata Palmorchis sp Aphyllorchis montana Cephalanthera damasonium Cephalanthera austiniae Epipactis sp Limodorum abortivum Listera smallii Listera cordata Neottia nidus-avis Tropidia effusa Corymborkis verticillata Tropidia sp Epipogium aphyllum Epipogium roseum Monophyllorchis maculata Triphora trianthophora Triphora gentianoides Psilochilus macrophyllus Psilochilus LJ6914 Sobralia crocea Sobralia mucronata Sertifera columbiana Sertifera sp Epilyna jimenzeii Epilyna hirtzii Elleanthus lancifolius Elleanthus sp Wullschlaegelia aphylla Calypso bulbosa Chysis bractescens Isochilus amparoana Corallorhiza trifida Oreorchis patens Diceratostele gabonensis Nervilia plicata Nervilia shirensis Xerorchis amazonica Gastrodia sesamoides Didymoplexis pallens Gastrodia zeylanica Gastrodia sp reunion Gastrodia confusa Palmorchis Neottieae Tropidieae Triphoreae Sobralieae Advanced Epidendroids Nervilieae Gastrodieae Figure

104 Figure 2.9: Topology from the Maximum likelihood combined analysis of the three data partitions, ITS, nad1, and trnl-f. Numbers indicate jackknife support > 50% for relevant nodes. 82

105 Palmorchis Cephalanthera austiniae Neottia nidus-avis Neottieae Corymborkis verticillata Tropidieae Advanced Epidendroids 100 Corallorhiza trifida Nervilieae 76 Monophyllorchis maculata Triphoreae Sobralieae Figure

106 Figure 2.10: Maximum Likelihood topology returned from the combined analysis excluding Gastrodia procera and Triphora amazonica, but including all partial sequences of Wullschlaegelia, Epipogium and Gastrodia species. 84

107 Figure

108 CHAPTER 3 A PHYLOGENETIC HYPOTHESIS OF BASAL EPIDENDROIDEAE FROM MORPHOLOGY AND MOLECULAR DATA: A TOTAL EVIDENCE APPROACH INTRODUCTION The use of morphological and anatomical characters has not, surprisingly, decreased in the modern era of chemical and now molecular methods. The tactical advantages of molecular data lie in the relative ease in which large quantities of data can be gathered relatively rapidly (Soltis and Soltis 1998). Many of the traditional orchid classifications were based exclusively on morphology and anatomy, relying on a few key characteristics. Most of these characters are related to the column, such as degree of fusion and anther number (3, 2, or 1) and position (erect vs incumbent). One of the diagnostic characters of the Orchidaceae is the fusion of the androecium and gynoecium into a structure called the column. Many authors used these structures and degrees of fusion as a means to delimit relationships in the larger family (Schweinfurth 1959). At the subfamily level, two of the key characters 86

109 relied upon by most authors have been the number and position of anthers. However, with closer examination, as well as improved taxon sampling, many of these classifications have been subsequently modified. In light of recent findings (Kores et al. 1996, Cameron et al. 1999, Cameron and Chase 2000, and Freudenstein et al. 2002) the utility of key characters, such as anther number and incumbency, has been questioned. Problems associated with the use of key characters are that many of these characters are of floral and reproductive structures, which are subject to selection. In orchid flowers and columns, character convergence is associated with specific pollinator interactions, which results in adaptations to the column and perianth reflecting this interaction. Plants with highly zygomorphic flowers often have very specific pollinator interactions (for example see Cubas 2004), which are suspected in enabling the radiation of many plant groups (Endress 1999, 2001a, 2001b). Interestingly, very little has been reported on the effects of the loss of pollinator specificity. At least among orchids this often results in an increased fusion of the perianth parts, reduction or loss of column characters such as rostellum and viscidium, soft mealy pollinia, and a decreased floral display (Catling 1990). In no anatomical or vegetative structures is convergence more obvious then the orchid gynostemium (anther, stigma and column regions. see Dressler 1993, Rasmussen 1982). The anthers and gynostemium of basal epidendroids have been studied in part by various researchers (Burns-Balogh and Bernhardt 1985, Freudenstein et al. 2002; Rasmussen 1982, Szlachetko and Rutkowski 2000). Until recently the importance of the single incumbent anther has not really been emphasized because the two groups which possess this condition, the vanilloids and the Epidendroideae, were thought to be related. Incumbency is defined as a change in anther position in which 87

110 during development the anther is bent forward (Dressler 1993), and was noted by Bentham (1881). The incumbent anther has traditionally been considered a key systematic feature of the Epidendroideae (Dressler 1981). However, Cameron et al. (1999, 2000; but see also Kores et al. 1997) have sufficiently established that Vanilloids are a distinct subfamily, considered either sister to the other monandrous orchids or the first to branch off after core Orchidaceae diverged from the Apostasioideae (Chase et al. 2003). MORPHOLOGICAL HYPOTHESES- The epidendroid subfamily includes orchids with a single incumbent anther (Freudenstein and Rasmussen 1999; Pridgeon et al. 1999), a type III stigma (Dannenbaum et al. 1989), and distinct hard or firm pollinia (except some basal taxa). Burns-Balgoh and Funk (1986) utilized morphological and vegetative characters in their phylogenetic reconstructions, however these trees were not made using any explicit methodology, as a result it is not clear the significance of any findings. Dressler s (1993) classification was based largely on the use of morphological and vegetative characters, but was distinctly not cladistic, and for that reason any phylogenetic relationships presented must be considered intuitive. The only cladistic morphological study to include any significant numbers of Epidendroideae was performed by Freudenstein and Rasmussen (1999). That study found that morphology alone could not resolve relationships among the basal epidendroids. Epidendroid taxa, such as Triphora, grouped with the orchidoids sister to Caladenia, based on the characters of seed striation, viscidium, and endothecial thickenings. The genus 88

111 Palmorchis is a difficult genus to place using morphology alone, and in the study of Freudenstein and Rasmussen (1999) it united with vanilloids ([Vanilloideae] Cameron and Chase 2000; Cameron et al. 1999) given characters of the seed and carinate parianth. The basal epidendroid orchids have traditionally been difficult to place into a hierarchical grouping of relationships. Morphologically they are a mosaic of primitive and derived traits with few morphological synapomorphies. The purpose of this study is to examine morphological characters with a particular emphasis on the anther and column. The tribes of the basal Epidendroideae will be examined using a morphological dataset separately and in combination with the molecular dataset in a total evidence analysis (Kluge 1989, 1998, and 2004). MATERIALS AND METHODS The matrix of Freudenstein and Rasmussen (1999) is one of the most comprehensive, both in terms of taxa and character sampling. The scope of the Freudenstein and Rasmussen study was to address relationships at the level of the family using a general representation of the diversity of taxa. As such the sampling of basal epidendroids, while significant in the use of a number of tribal exemplars, excluded a number of taxa that are important this study. For instance, Gastrodieae was particularly poorly sampled, especially given its diversity and in light of the work of Chase et al. (2003) which moved a number of these taxa tentatively into other tribes such as Nervilieae (see Tables. 1.1 and 1.2 for a more complete listing) or Calyposeae 89

112 (Wullschlaegelia). In order to better understand the diversity and character distributions, sampling of the basal epidendroid taxa was increased in the current study to include an exemplar of each genus. Two taxa were excluded due to a lack of sufficient material; these were Neoclemensia and Silvorchis. The character matrix of Freudenstein and Rasmussen (1999) was evaluated and characters that were uninformative for the present level were excluded. Given the prevalence of inaccurate or uncontested statements of homology for characters in the literature, characters were scored based on observations of fresh collected and alcohol preserved material or herbarium specimens (AMES, MO, MU, OS, K, US) whenever possible. However, given the rarity of some taxa in collections, additional character study was made using published illustrations and photos of dissected, sectioned or SEM images. MICROMORPHOLOGY - Fresh or alcohol/faa preserved material was used for sectioning of Paraplast embedded samples. Specimens were prepared for embedding by placing them in three changes of 70% EtOH, followed by standard dehydration series (95%EtOH, TBA (tertiary butyl alcohol), dh 2 0 in 50:35:15 ratio; 50:50 parts EtOH and TBA; 25:75 parts EtOH and TBA). This was followed by three changes of 100% TBA. The final TBA volume was reduced and Paraplast was added for a total of three changes; the final Paraplast change was placed in a vacuum oven at 58 C for hours depending on the size of the specimen to help with infiltration and air removal from the specimen. Embedded samples were sectioned with a Microm HM340 microtome and mounted on slides using 1% gelatin and 2% phenol and stained. 90

113 The staining series consisted of two changes of 100% xylene for 5 min. each, 50% xylene: 50% EtOH for 2 min., followed by four steps of 100%-95%-70%- 50% EtOH for 2 min. each, 3% acetic acid for 2 min., 1% Alcian Blue in water for 20 min., water 3 min., 1% Safranin in 50% EtOH for 10 mins. and a final step of water for 3 min. This was followed by several dehydration washes of several dips in each 50%- 70%-95%- 100% EtOH, 50%EtOH and 50% xylene, and two changes of 100% xylene. CHARACTER CODING - The use of characters of interest in phylogeny reconstruction is somewhat controversial due to issues of circularity and independence (Deleporte 1993, de Queiroz 1996, Luckow and Bruneau 1997). However, it can be argued that since organisms are composed of characters, which are either functionally constrained or evolutionarily plastic, conditions not necessarily apparent a priori, the inclusion of all characters is preferred. Under a total evidence approach (Kluge 1989, 1998, 2004), the inclusion of these characters of special interest in phylogeny reconstruction allows them to contribute signal to the topology and is the approach used in this study. Every effort was made to use a binary coding system when constructing the morphological matrix, however multistate character coding was necessary for a few of the characters; all multistate characters were treated as unordered. OUTGROUP CHOICE - Based on previous studies of the Orchidaceae, the Epidendroideae are monophyletic (Kores et al 1996, Cameron 1999, Freudenstein et al. 2004). The rbcl study of Cameron et al. (1999, but see also Kores et al.1996) clarified many of the more ambiguous relationships of the Orchidaceae, finding five subfamiles to the exclusion of the Neottioideae and Spiranthoideae of Dressler (1993). The 91

114 Neottioideae consisted of orchids with suberect to subincumbent anthers, mealy or weakly sectile pollinia, while the Spiranthoideae contained those taxa with erect anthers, Goodyera seed type, and a terminal viscidium. Taxa previously assigned to these subfamlies were subsumed into either Orchidoideae or Epidendroideae. In Dressler s (1993) classification, the Spiranthoideae included three tribes: Diceratosteleae (Diceratostele), Tropidieae (Corymborkis and Tropidia), and Cranichideae; the former two tribes were moved to the Epidendroideae based on the results of Cameron et al. (1999). Furthermore, some of the Neottioideae are now considered members of a primitive grade of taxa at the base of the Epidendroideae. Cameron et al. (1999) found a lack of support for relationships among the basal epidendroid taxa, instead resolving a polytomy in the strict consensus. Based on the findings of Kores et al. (1996) and Cameron et al. (1999), representatives from across the Orchidoideae were chosen to serve as outgroups; this provides the best method for establishing polarity and ancestor-descendant relationships (Nixon and Carpenter 1993). Starting with the matrix of Freudenstein and Rasmussen (1999), characters that were uninformative or invariant at this level were removed. To this new characters were added resulting in the construction of a matrix consisting of 40 taxa and 30 characters. PHYLOGENETIC MORPHOLOGICAL ANALYSIS - Given the methodological and technical limitations of model based methods for use with morphology, cladistic analyses were performed on the dataset in a parsimony framework as implemented using the program PAUP* version 4.0b.10 (Swafford, 2002) using the heuristic search option. Initially the analysis was run with all characters being treated as equally weighted, and 92

115 multistate characters were treated in all analyses as unordered. The following approach was taken for all searches: an initial heuristic search was performed on 1000 random taxon addition replicates using TBR, with settings to hold two trees per random addition sequence, saving only two trees, multrees in effect, and swapping on best trees only. The best trees from this search were used as starting trees for a second, more exhaustive heuristic search in order to search the tree space as thoroughly as possible. A strict consensus tree was calculated. While it is not possible to determine which characters are homoplastic a priori, homoplasy nevertheless is a factor, therefore in order to more fully explore the data set it was determined to use an a posteriori differential weighting method. This was done using the successive approximation weighting method of Farris (1969, 1988) as implemented in the program PAUP* version 4.0b.10 (Swofford, 2002). This method uses a rescaled consistency measure to reweight characters. Successive iterations were stopped when consistency values stabilized; this occurred in two iterations. TOTAL EVIDENCE ANALYSIS- Using the molecular matrices of Chapter 2 (Appendix A.1-A-4) a combined morphological and molecular total evidence analysis (TEA) was performed. This included a morphological matrix of 34 taxa coded for 30 characters, and molecular characters from the nuclear ITS, plastid trnl-f and mitochondrial nad1. In addition, sequence length variation was observed in nad1bc and trnl-f, therefore gaps were coded for these two loci using the simple gap coding method of Simmons and Ochoterena (2000) as implemented in SeqState (Müller 2005). Gaps were combined with both the sequence data and morphology (Appendix B.1) and analyzed using parsimony. 93

116 BRANCH SUPPORT- Branch support was evaluated on all trees using 5000 jackknife replicates as performed in PAUP*. In order to meet the criteria of Farris et al. (1996), resampling was set to 37% character deletion corresponding to the probability of 1/e that a character will be deleted from the matrix; emulate Jac command was in effect. Two random addition sequences per replication were used, saving only two trees per random addition sequence, and TBR branch swapping was employed for all analyses with Multrees in effect, and swapping on best trees only. CHARACTERS: Vegetative- RESULTS 1. orchidoid root tubers 0=absent, 1=present Most terrestrial species of orchids possess some form of root storage organ. Within orchidoids, the entire root is often thickened forming a very distinct perennial structure from which new growth emerges. Orchidoid root tubers are considered polystelic, in the sense that the roots are composed of multiple steles (i.e. vascular tissues an associated ground tissues [sensu Van Teighem and Douliot 1886]), however these steles are not derived through division of a monostele, but rather are an aggregation of roots (Pridgeon and Chase 1995). This distinguishes these root tuber structures from others seen in taxa such as Triphora, Gastrodia, and Epipogium among others. 94

117 Freudenstein and Rasmussen (1999) coded Triphora as possessing true root tubers, however they do not possess this polystelic form observed in Orchidoideae, and as such were recoded as absent for this character in the current study. 2. root epidermis 0= rhizodermis, 1= velamen, 2= root absent 3. spiranthosomes 0=absent, 1=present 4. leaf morphology 0=flat nonplicate, 1=plicate, 2=conduplicate, 3= reduced/absent 5. leaf articulation 0=absent, 1=present 6. stegmata 0=conical, 1=spherical, 2= absent 7. leaf abaxial epidermal cells 0= straight, 1= wavy 8. subsidiary cells 0= present, 1=indistinguishable 9. inflorescence position 0= terminal, 1= lateral Each of these vegetative characters was used by Freudenstein and Rasmussen (1999) who discussed them in detail. Root epidermis was coded by these authors as unordered states, either rhizodermis or velaman; a third character state, root absent, was included for use in coding Epipogium (Groom 1894), Gastrodia and Stereosandra in the current study. This was done to account for the observation that these taxa tended to have 95

118 tuberous structures that lacked roots. While Triphora gentianoides and other species of Triphora appeared to have similar types of tubers, Triphora trianthophora was coded here as having a rhizodermis on the basis of the observation made by Freudenstein and Rasmussen (1999). Spiranthosomes were initially reported in Cranchideae by Stern et al. (1993). At the time, this tribe was placed in the Spiranthoideae, hence the name. Given that this character has not been reported for any of the epidendroid taxa, Freudenstein and Rasmussen (1999) coded this as an assumed absence for the basal epidendroids. Stern (1999) reported on the presence of spiranthosomes in Wullschlaegelia and Uleiorchis, showing very detailed micrographs of the structures; these observations suggest a greater need for detailed morphological analysis of the basal epidendroid taxa. Given the results of this study and others it is clear that Wullschlaegelia is a member of the Epidendroideae and shares many features with the genus Uleiorchis (see Born et al and Stern 1999). Leaf morphology used by Freudenstein and Rasmussen (1999) was coded as a multistate character with three states. Many of the taxa in the current study had reduced or absent leaves. This state is often associated with a loss of chlorophyll, and an increased reliance upon fungal associates. Molvray et al. (2000) reported on the loss of chlorophyll and the associated reduction in leaf morphology. Among the basal epidendroid orchids there are a large number of taxa that have a reduced dependence on sunlight and chlorophyll for carbon fixation. Consequently, this condition was coded as having four multistate, unordered states. 96

119 Detailed studies of morphology are lacking for many of the rare taxa. Groom (1894) performed detailed observations of the vegetative morphology of Aphyllorchis, including an illustration of the stomata in which no subsidiary cells were illustrated. Based on these observations, for this study it was assumed that subsidiary cells were indistinguishable from other epidermal cells. In addition, Groom (1894) made observations of Epipogium finding that stomata were absent in the bracts; on this basis it was coded as absent, however there is definitely a need to perform additional observations of fresh material of each of these taxa, including vegetative morphology. Dressler (1979) reported that both Psilochilus and Monophyllorchis had subsidiary cells with the implication that these were distinguishable from adjacent epidermal cells. Stegmata were coded as absent in Didymoplexis on the basis of observations made by Möller and Rasmussen (1984). Gynostemium- Characters of the gynostemium have traditionally played a rather important role in orchid classifications. Anther position was considered to be erect, incumbent or recurved, and it has been used variously to delimit subfamilies by many authors. Generally, bending of the column and anther position is associated with positioning of the pollinium for pollen attachment and dispersal, therefore presumably under strong selective pressure. Freudenstein et al. (2002) showed that there is variation in the extent of incumbency among the epidendroid orchids resulting from both hetrochronic changes in the timing of anther bending and differential regional bending 97

120 within the anther. Given these results, anther bending in different regions may have phylogenetic utility. Anther incumbency is essentially a complex character composed of different levels bending within each of the zones of bending described in Freudenstein et al. (2002). 10. sporogenous zone bending 0=absent, 1=present 11. basal zone bending 0=absent, 1=present 12. column zone bending 0=absent, 1=present 13. anther recurved 0=absent, 1=present For this analysis, the composite character anthers incumbent or erect was recoded as three binary characters in order to maximize the phylogenetic information content. These are the column, basal and sporogenous zones (Fig 3.4) following the delimitations used by Freudenstein et al. (2002). Presence was coded based on the relative contribution each zone had in incumbency; erect anthers were coded as 0 for each character. Taxa such a Triphora and Tropidia are often reported as having more or less erect or recurved anthers, however it is unclear what the homology of these conditions is. Recurved anthers were seen only in a single tribe, Triphoreae (see Figs. 3.2 A -3.2D); observations of the anthers of Corymborkis veratrifolia and Tropidia curculigoides (Rasmussen 1982) show them having a clearly erect anther. Diceratostele gabonensis was coded based on photos of the column taken from the specimen ER44 (OS; Fig. 3.3); no microsections were prepared of this material. 98

121 14. endothecial thickenings 0 = other, 1 = intermediate, 2 = type II 15. endothecial thickenings II 0 = other, 1 = type III/IV Coding for these characters was based on the published observations made by Freudenstein (1991), no additional observations were made for these characters. 16. pollen unit 0 = monad 1= tetrad 17. massulae 0=absent, 1=singular regular, 2= multiple irregular, 3= hollow 18. pollen tectum 0= reticulate, 1= smooth, 3= perforated, 4= absent 19. pollen apertures 0=colpate/sulcate, 1=porate, 2= inaperturate The evolution of pollinia and the pollinium is as diagnostic of the Orchidaceae as the fused gynostemium. Orchids typically pack their pollen grains into pollinia, which enable the pollen to be dispersed either as a unit or in parts. However the packaging itself is not the same in all orchids. In general, pollen grains can be packaged as monads (single units) or tetrads (in fours), weakly or strongly united under a single common exine, or into massule, a condition called sectile pollinia, in which subunits of monads or tetrads are separately packaged under a common exine. Pollinia therefore can appear mealy or granular, sectile or as a solid unit. The evolution of sectile pollinia has occurred in orchids least four times (Dressler 1993) but among the basal epidendroids the homology of this character proves easier to assess. Freudenstein and Rasmussen (1999) used four character states absent, orchidoid, epidendroid, and arethusoid. For ease, these are 99

122 renamed here to be more explicit, but refer to the same condition as those of the original authors. The arethusoid type was observed in Arethusa and Calopogon in the analysis of Freudenstein and Rasmussen (1999). The former is represented this study, and as such the condition is an autoapomorphy. The state 0 refers to otherwise solid pollinia such as those observed in Palmorchis and the more derived epidendroid taxa, or mealy/ granular pollinia such as that observed in Neottieae s.s. Burns-Bologh and Funk (1986) produced two SEM images of pollen tetrads for a Psilochilus species. Based on these images it was determined that Psilochilus was inaperturate and sectile with a reticulate tectum, and Psilochilus mollis (ER207) was prepared and sectioned (Fig. 3.2.A) which shows clearly the presence of sectile pollinia. Freudenstein and Rasmussen (1999) coded Triphora trianthophora as lacking massulae, however dissections prepared for this study clearly show irregular massulae (Fig. 3.2.C inset). Sections were prepared for Monophyllorchis maculata (Fig. 3.2.D), showing a nearly erect anther with some basal zone bending and irregular sectile pollinia. Pollen morphology of Neottieae was characterized by Ackerman and Williams (1980). Representatives from across the tribe included seven of 12 species of Cephalanthera, Limodorum abortivum, 11 of 33 species of Epipactis, seven of 20 species of Aphyllorchis, Neottia nidus-avis and Neottia listeroides, and three species of Listera. These micrographs were the basis of character coding for Aphyllorchis, Neottia, and Limodorum. 100

123 20. apical caudicle 0= absent, 1= present 21. basal caudicle 0=absent, 1=present 22. stipe 0=absent, 1=present There are two types of pollinium stalks, caudicles and stipes, which are used for the attachment of pollinia to both the viscidium and pollinator. The former are derived from the anther, particularly the pollen itself, and the stipe is derived from the rostellum. Caudicles are found in both Orchidoideae and Epidendroideae. In Freudenstein and Rasmussen (1999) basal caudicles were observed primarily among the Orchidoideae and as a convergence in Epipogium. The derivation of the caudicle is most likely a product of anther position for pollen deposition, therefore the basal caudicule observed in orchidoids with erect anthers derives from the base of the anther; on the other hand, the epidendroid caudicle develops from the apical portion of the anther and is a result of incumbency. Epipogium aphyllum is clearly incumbent (Rasmussen 1982, Fig. 28), whereas E. roseum is suberect (Rasmussen 1982, Fig. 30). For this character there is no apparent transformation, therefore they were coded as two unordered, binary characters. Rasmussen (1982) distinguished between two types of stipes, the tegular and hamular stipes. The hamulus develops from the recurved apex of the rostellum, while the tegula is derived from the modified epidermis of the rostellum (Rasmussen 1982, 1986; Dressler 1993). Both Tropidia and Corymborkis are reported to have a hamulus (Rasmussen 1982, for Corymborkis see also Rasmussen 1977), while other taxa such as Aplectrum, Calypso, and Govenia (each Calyposeae), have stipes to a varying degree; 101

124 Aplectrum has a hamulus, while Calypso and Govenia each possess a tegula. Freudenstein and Rasmussen (1999) coded each as a separate binary character, however it was determined in the current study to code a single character, stipe as either present or absent. 23. pollinium number :2 0=absent, 1=present 24. pollinium number :8 0=absent, 1=present Rasmussen (1986) stated that the plesiomorphic condition for the number of pollinia in orchids is four, which corresponds to the number of pollen sacs found in other lilioid monocots. In orchids, four pollinia are the predominant number and an apparent symplesiomorphy within orchids. This condition is most often observed in the Epidendroideae among the basal members. Two pollinia are often the result of fusion of the four pollinia. Some authors (Freudenstein and Rasmussen 1999) suggested that bilobed or bi-partite pollinia were actually four pollinia. However from literature and observations of the published images used for this study it was concluded that bipartite/bilobed pollinia were actually two pollinia as was reported in Rasmussen (1982) for Stereosandra and Tropidia. Freudenstein and Rasmussen (1996) report that there are two ways to obtain eight pollinia, either via transverse or longitudinal division of the pollen sacs. Based on this, the condition of eight pollinia was coded in Freudenstein and Rasmussen (1999) as three character states. Of the taxa observed in the current analysis the transverse condition is represented in Sobralia, as such the other genera in Sobralieae, which also have eight 102

125 pollinia, were assumed transverse as well. Xerorchis was also coded as having eight pollinia, however little is known about this neotropical genus, and since no fresh material of this was obtained, it was coded as present based on reports in the literature, not direct observations. 25. stigmatic cell shape 0=finger, 1=prosenchymatic This character derives from the work of Dannenbaum, Wolter, and Schill (1989) who looked at orchid stigmas using scanning election microscopy. In that study they observed the shape of the stigma cells of receptive stigmatic surfaces. Freudenstein and Rasmussen (1999) were the first to use the character in a systematic study in which they coded three conditions: various, finger, and prosenchymatic. In the current study, only two conditions of Freudenstein and Rasmussen (1999) were seen, finger and prosenchymatic. A comparison of stigmas from longitudinal column sections of Epipactis palustris (Schick 1989) with the SEM images of the same species made by Dannenbaum, Wolter and Schill (1989), revealed that it was possible given well prepared microsections to identify the same condition of the underlying stigmatic surface cells observed using electron microscopy. With the exception of Cephalanthera, Neottieae are reported in the literature as having papillate stigmatic receptive surfaces, which is the result of the underlying cells shapes (Prutsch and Schill 2000), however based on the published images of Kurzweil (1988) which is the basis of these reports, it was not possible to establish this condition for all the taxa, therefore, Neottia and Limodorum were both coded as unknown for this character. For examples of the types, Triphora trianthophora 103

126 (Fig. 3.2.C), Psilochilus mollis (Fig. 3.2.A), Monophyllorchis macualta (3.2.D), Eulophia (Freudenstein et al. 2002), Epipactis macrophylla (Bonatti et al. 2006) each show the condition of finger-like, while Gastrodia procera (Fig. 3.1.D), Palmorchis trilobulata (Fig. 3.1.C; see also P. kuhlmannii in Szlachetko and Rutkowski [2000]), Epilyna hirtzii (Fig. 3.2.A), and Didymoplexis pallens (Fig. 3.1.B) represent the prosenchymatic cells. This character was coded as an unordered multistate character. 26. viscidium 0= none, 1= diffuse, 2=detachable Orchid seeds- Orchid seeds are among the smallest seeds found in plants, and have often been described as dust seeds due to their extreme size reduction, which range in size from mm long and as little as five cells wide or 0.01mm (Arditti et al. 2000). 27. seed testa cell shape 0= isodiametric, 1=ends isodiametric w/ middle elongate, 2=all elongate 28. seed striations 0=absent, 1=transverse or reticulate, 2=longitudinal 29. seed intercellular spaces 0=absent, 1= present 30. seed covered cell border 0=absent, 1=present Orchid seeds, even with their small size and apparent reduction in morphology and anatomy have only recently been used in taxonomy of orchids. There is considerable 104

127 variation in the seed coat texture and decorations, size and shape of the seed, and distribution, size and shape of the testa cells, all of which may have phylogenetic utility. The most comprehensive work on seed morphology was by Ziegler (1977) and summarized by Barthlott and Ziegler (1981), and Dressler (1993). These works each used a typological model where each seed type is a composite character. It is evident using this method that not all taxa that were described as particular type had all the characters that defined that type. As has been argued for amino acid coding, relying on a typological model fails to capture the underlying phylogenetic signal (Simmons 2000, Simmons and Freudenstein 2002, and Simmons et al. 2002). For this study, the seed characters of Freudenstein and Rasmussen were used. In order to complete the dataset, additional taxa were coded from the original work of Ziegler (1977), Barthlott and Ziegler (1981), Dressler (1993), Arditti et al. (1980), and Tohda (1986). EXCLUDED CHARACTERS- Freudenstein and Rasmussen (1999) included a number of characters that were informative at the level of their study but since many of these characters are not applicable at the level examined here, they were excluded. Invariant or autapomorphic characters were excluded, as these provide nothing informative for phylogenetic inference. Additional characters not included in this study are discussed below. Habit-All the orchids observed here were principally terrestrial or lithophytic, with only a single exception, Epilyna (Elleanthus; Sobralieae), which is typically epiphytic. There were observations made of Monophyllorchis maculata in which large numbers of individuals in one population along the Rio Pastaza, Ecuador were observed 105

128 epiphytic on trees; such observations from other taxa had been made by other authors, however, these are always considered rare, and not the typical habit. Achlorophylly- While there are number of taxa in the basal Epidendroideae that lack chlorophyll, no study has ever included this character in the cladistic analysis. The switch from an autotrophic habit to achlorophylly and increased mycoheterotrophy however is associated with reductions in floral displays and vegetative morphology associated with leaves. As a character, the loss of chlorophyll has been discussed as being a convergent condition by a number of authors. Dressler (1993) reported that saprophytism arose at a minimum of 10 times in the orchids. No doubt this is a conservative estimate given that Gastrodieae as circumscribed by most authors is a repository for achlorophyllous, leafless, mycoheterotrophic orchids with epidendroid affinities and as such may not be a natural group. Molvray et al. (2000) reported the high level of convergence this trait appeared to exhibit when it was mapped onto the tree produced using the 18S locus, but did not perform any cladistic analysis of the characters in part because it is difficult to homologize characters such as achlorophylly. While this is an important condition among these orchids, and originally was coded for this study, it was rejected because the character was observed to be non-independent, correlated with a reduced or absent leaf. Leaf fiber bundles This character was used by Freudenstein and Rasmussen (1999), however it was observed to be uninformative here. This condition is typically observed in large leaves such as those of Palmorchis where it functions as structural 106

129 support, but given that many of these basal taxa have small non-plicate leaves or leaves which are absent, this character would have to be coded as missing in many taxa, therefore it was excluded. Column foot- Freudenstein and Rasmussen (1999) decided not to include this character stating that it was difficult assess homology without a better understanding of its ontogeny. This character was again explored here for use, but rejected on grounds similar to that of Freudenstein and Rasmussen (1999). A survey of the literature found that this was a commonly applied term for any protuberance at the base of the column. A closer look at the structures revealed that variation in size, location, attachment and origin, existed. However, after a number of attempts to make homology statements it was determined that without further detailed study of the origins of these various forms of this character, especially at lower levels, it was not possible to determine homology. Further investigation is suggested as this does have the potential to provide additional phylogenetically informative characters. Stigma shape- Freudenstein and Rasmussen (1999) included a number of stigmatic characters not included in this study. Stigma shape has been reported (Dressler 1993) as being associated with the type of pollen produced such that solid pollinia masses are seen with concave stigmas, the result being that there is a better fit between the two. In this study, all the taxa except Sobralia (coded as protruded sensu Freudenstein and Rasmussen [1999], it was observed that Sobralia lindleyana has a concave stigma) were seen to possess a concave stigma, and no taxa studied possessed solid pollinia, either being granular or sectile. It was therefore decided in this study to exclude the stigma condition. 107

130 TOPOLOGY- Morphology- using the above characters, a matrix of 40 taxa and 30 characters was prepared and submitted for phylogenetic analysis (Table 3.1). The morphological analysis of the equally weighted matrix returned four trees of equal length (123 steps, CI= RI= 0.657). Given the retention of multiple most parsimonious trees, strict and Adams consensus trees were calculated in order to summarize the optimal trees. The strict consensus topology had a considerable amount of structure considering the size of the matrix and number of taxa (Fig. 3.5). Although much of the topology failed to receive support greater than 50%, many of the traditionally recognized tribes of Dressler (1993) were recovered, such as Nervilieae (Nervilia), Triphoreae, Tropidieae, and a good portion of Gastrodieae (subclade [SC] 1), as well as a clade of the derived Epidendroid taxa. Three large, highly structured subclades were recovered, forming a polytomy. In SC 2, Nervilia and Triphoreae form a clade, sister to a weakly supported clade of a polyphyletic Sobralieae (Sobralia and Elleanthus) and the advanced Epidendroideae. A large polytomy (SC 3) consisting of taxa from Neottieae, Epilyna (Sobralieae), Xerorchis, Diceratostele gabonensis, Wullschlaegelia, Uleiorchis, Stereosandra, and Aphyllorchis, as well as a very well supported Tropidieae (Tropidia and Corymborkis) and Limodorum sister to Cephalanthera and Palmorchis. Since the strict consensus method only shows those clades observed in all MPTs, an Adams consensus was calculated in order to identify those taxa that were in conflicting positions. Most of the topology agreed with that of the strict consensus, with the exception of SC 3 (Fig. 3.6) in which Stereosandra came out in a polytomy at the base of the subclade; Listera formed a polytomy with Neottieae and the mixed clade of Elleanthus, Epilyna, Diceratostele, Xerorchis and Tropidieae. There were two pairs of 108

131 identical topologies returned differing only in the placement of Listera and Stereosandra in SC 3 (Figs ). In one topology, Listera forms a polytomy with Neottia at the base of a clade containing Limodorum, Cephalanthera, and Palmorchis (Fig. 3.7), or alternatively, Listera was sister to Epipactis (Fig. 3.8); Stereosandra was placed with Uleiorchis and Wullschlaegelia sister to Aphyllorchis (Fig. 3.7) or Stereosandra sister to Tropidieae (Fig. 3.8). The jackknife analysis found moderate support (70%) for the clade of Diceratostele, Xerorchis and Tropidieae, which was recovered with the Adams consensus (Fig. 3.6). Goloboff (1994) argued that the only defensible reason to weight characters was to reduce the effect of homoplasy on tree construction. In order to more fully explore these data, a successively weighted analysis was performed. Consistency indices stabilized after two iterations and a single tree of length (CI=0.526, RI=0.805; Fig. 3.9) was retained. The topology was consistent with that obtained from the unweighted analysis with a few exceptions, and provided resolution in SC 3. In one iteration, Epilyna united with Sobralieae sister to Elleanthus, a position consistent with previous analyses. Likewise, Listera came out with Neottia and Limodorum in a polytomy, this sister to a successively branching clade containing Epipactis sister to Cephalanthera and Palmorchis, followed by a polytomy of Diceratostele and Xerorchis and Tropidieae. Stereosandra came out in a polytomy containing Uleiorchis and Wullschlaegelia, this sister to Aphyllorchis. TOTAL EVIDENCE- the Total Evidence Analysis was run using the combined matrices of morphology, ITS, trnl-f +gaps, nad1 +gaps (Appendix B.1). This matrix included 34 taxa coded for 4858 characters, in which 281 ITS characters were excluded. 109

132 Sequence characters were excluded based on the relative amount (i.e. >50%) of missing data for the character position, or regions determined to be so variable that homology assessment was not possible. The resulting parsimony heuristic search returned a single MPT of 4196 steps (Fig. 3.10; CI=0.712, RI= 0.461). The topology is highly structured, with resolution of many of the tribes with good support, however backbone and tribal level relationships failed to retrieve support (i.e. <50%). A clade of Palmorchis sister to Neottieae is found at the base of the Epidendroideae, followed successively by Triphoreae and Epipogium, then Sobralieae. The next to branch is a clade of Tropidieae sister to Stereosandra united with the advanced Epidendroideae and these sister to a successively branching clade containing Xerorchis, Diceratostele, Nervilieae, and Gastrodieae. Many of the morphological characters used in this study represent structures associated with leaves and the column. As many of the characters of interest were used in the construction of the morphological tree, evolution of morphological characters will be discussed mapped on the TEA topology (Figs ). The use of multiple independent datasets in a TEA will better reflect the species tree (Kluge 1989, 1998, 2004), thus providing a better hypothesis of character evolution. DISCUSSION TOPOLOGY-Morphology- The morphology supports some tribal level compositions that were constructed using more intuitive models of relationships such as Dressler (1993). In this work, many of these tribes were basal members of the Cymbidioid Phylad (i.e., clade). Although relationships between the taxa were not 110

133 depicted, this basal group consisted of Palmorchis, followed successively by Triphoreae, Gastrodieae, and Nervilieae. The remaining taxa were all basal members of the Reed Stem Phylad, containing Neottieae, Pogoniinae, Xerorchis, and Sobralieae. Interestingly, Dressler considered Neottieae and Palmorchis the most primitive members of each of these Phylads. This scheme however does not consider many of the taxa determined by Dressler as belonging to Spiranthoideae, these being Tropidia, Corymborkis, and Diceratostele; this was based on the presence of erect anthers. Clades were obtained in this study that were supported by recent studies using molecular and morphological characters. The four most parsimonious trees returned from the analysis of the unweighted mrophological matrix contained clades of Gastrodieae, Triphoreae, Nervilieae, and Tropidieae sensu Dressler (1993) with some exceptions. The results of the unweighted analyses were not surprising given the size of the matrix, and the number of characters. As was expected from analyses containing small numbers of characters and relatively few taxa, the topology was weakly supported with low consistency values. Most morphological characters that are informative in this study were also highly homoplasious, but provide a significant amount of the structure observed in the tree. This results in topologies with low CI values and jackknife support, which is typical of small datasets with relatively high number of taxa and low number of characters; adding more characters is the only way to overcome this issue. In addition, many of the characters used in this study could be considered symplesiomorphies such as having pollen in tetrads and plicate leaf morphology. Among orchids, Dressler (1993) 111

134 argued that soft, herbaceous (e.g., flat nonplicate) and conduplicate leaves were derived from plicate leaves, which is supported by the results of this study (Figs. 3.7 and 3.8). The reduced or absent leaf morphology evolved a minimum of 5 times while flat nonplicate and conduplicate leaves each evolved once. The return of a largely monophyletic Gastrodieae sensu Dressler (1993) is not unsurprising (Fig. 3.5 SC 1). Traditionally this tribe was the repository for epidendroid orchids that lacked chlorophyll, had an increased reliance on mycoheterophy, and were missing other derived features that supported other affinities. The absence of leaves and roots, and possessing a detachable viscidium support the monophyly of this clade. All taxa are lacking chlorophyll and share a reduced habit associated with this condition. Epipogium has a basal caudicle, a characteristic of orchidoid orchids, and apparently convergently evolved given the results of this study. One interesting hypothesis suggested by this study is the relationship of Stereosandra, Wullschlaegelia, and Uleiorchis. Like all members of Gastrodieae, these taxa are leafless achlorophyllous plants lacking roots and have reduced perianth. Wullschlaegelia and Uleiorchis are often considered closely related, and are supported here by single regular massulae (#17). Both Rasmussen (1982) and Szalchetko and Rutkowski (2000) reported that Wullschlaegelia had thin plate-like or lamellate sectile anthers interpreted as the condition of single regular massulae in the current study. Uleiorchis has sectile pollinia, but as no fresh material was available, it was coded as single regular given its close association with Wullschlaegelia (Born et al. 1999), however new material is needed in order to confirm this. Stereosandra has porate pollen (#19) that supports its inclusion in SC3, whereas other Gastrodieae have aporate pollen and Uleiorchis and Wullschlaegelia were coded as missing data for pollen 112

135 aperatures. In two of the four MPTs obtained, these taxa were united by single regular massulae, a characteristic not found among Neottieae, whereas other members of Gastrodieae had irregular massulae. Aphyllorchis, Wullschlaegelia, Stereosandra and Uleiorchis, which are related in two MPTs, all have two pollinia whereas other Gastrodieae have four pollinia. With regard to pollinia number, the degree to which pollinia are divided can be difficult to assess (Freudenstein and Rassmussen 1996), and it is possible that some reported pollinia numbers in the literature are inaccurate. In addition, the current study treated bilobed pollinia as being two, a condition observed in Stereosandra, rather than four pollinia, as others have suggested. Freudenstein and Rasmussen (1996) argued that bilobed pollina were unique, and should be coded as a distinct character (referring to the Habenaria types specifically). There are two potential developmental paths that could result in two bilobed pollinia in general, either incomplete separation or partial fusion of the pollinia during development. As far as known, no one has looked at development in theses taxa specifically. Subclade 2 contains a number of interesting hypotheses. Nervilia sister to Triphoreae is not a new hypothesis; previously these taxa were often associated based on morphological similarities (Chapter 1). Morphological characters supporting this relationship are multiple irregular massulae (#17), the presence of subsidiary cells, and finger stigmatic cells; none of these is a unique synapomorphy for this group. Freudenstein and Rassmussen (1999) found Triphora most closely related to diurid orchids (Orchidoideae) based on the characters of intermediate Type I-II endothecial thickenings, an erect anther, root tubers, fleshy leaves and the lack of subsidiary cells. Nervilia was among a polytomy of Gastrodia species and Epipogium, sharing 113

136 epidendroid massulae (multiple irregular as per this study) and root tubers absent. The anthers of Triphoreae (Fig. 3.2) and Nervilia (see Rasmussen 1982, Fig. 63) are very similar in structure and morphology, but neither can be considered erect, with bending being observed in at least one or two regions of the anther; the stigmatic surface cells are also finger-like. In Dressler s (1979) original proposal for the tribe Triphoreae, both Monophyllorchis and Psilochilus were reported to have subsidiary cells, and were coded in this study as indistinguishable from other epidermal cells. Triphora, which has relatively small herbaceous leaves that may or may not have stomata and consequently may lack subsidiary cells. Some species (e.g., Triphora trianthophora, T. craigheadii, and T. ricketii) are green with relatively large, flat nonplicate leaves and others (e.g., Triphora gentianoides) have reduced bract-like leaves; therefore stomata may be present but not observed. The relationship of Nervilia and Triphoreae sister to the clade of Sobralieae and the higher Epidendroideae has not been suggested in previous studies. Three characters support this, which also received weak jackknife support (58%). The presence of a single uncontroverted synapomorphy, articulate leaf, supports the relationship between Sobralieae and the advanced Epidendroideae, as well as two homoplasious characters of root with velamen, and smooth pollen tectum. The finding of Sobralieae most closely related to the advanced outgroups is suggested by other authors. Dressler (1993) placed Sobralieae in the Reed-stem epidendroid Phylad; while not closely related based on Dressler s scheme, the Reed-stem Phylad also contained Arethuseae which was seen as an intermediate group between the Cymbidoid and the Reed-stem Phylads; Arethusa represents this group in this analysis as one of the advanced epidendroids. Freudenstein 114

137 and Rasmussen (1999) found Sobralia among a polytomy of advanced epidendroids in the unweighted analysis, and in the PIWE weighted analysis, it was closely related to Arethuseae. Sobralia has an operculate anther, a condition seen in more derived epidendroid taxa, but a character not included in this current study. With so many derived features, Sobralieae is frequently considered closely related to the advanced Epidendroideae. All molecular analyses of Sobralieae strongly support Epilyna sister to or imbedded within Elleanthus (Whitten et al. pers. com., and this study). The morphological analysis in the current study returned a polyphyletic Sobralieae (Fig. 3.5). Looking at character distributions, it is clear that some characters that are optimized for Epilyna are missing data. Such entries are suspected to cause Long Branch Attraction during individual character tree optimizations under certain instances; missing data produces effects similar to incomplete taxon sampling, which can cause spurious relationships and Long Branch Attraction (see Wiens 1998). Missing data accounts for 36% (11) of the characters coded for Epilyna and 19% of the matrix generally. One in particular, pollen aperture type (#19) is missing for 28% of the taxa including Epilyna. It is optimized in Epilyna as porate, a synapomorphy for the whole clade to which it is associated (Fig ), however, Sobralia, for which this is known, was coded as being inaperturate. All three taxa share the synapomorphy of eight pollina (#24). Based on previous results it is suspected that missing data may be contributing spurious associations to the topology based on optimizations considering only a few present weak characters (see further discussion below EFFECTS OF WEIGHTING). 115

138 Subclade 3 is composed of members of Neottieae, Palmorchis, Tropidieae, Gastrodieae and Nervilieae (sensu Chase et al 2003). The single uncontroverted synapomorphy subtending the clade is porate pollen, however it was not coded for six of the 15 taxa (40%). Several taxa in this subclade could be considered misplaced given the results of other studies (Kores et al 1997; Cameron et al 1999; Chase et al. 2003, this study) which support affinities elsewhere. For instance Epilyna is considered a member of Sobralieae, a position supported by the results of the molecular analysis (Chapter 2), Xerorchis, Stereosandra and Diceratostele are found in Nervilieae (Chase et al 2003 and this study), and Uleiorchis and Wullschlaegelia (Gastrodieae sensu Dressler 1993, or Arethuseae sensu Chase et al. 2003). The findings of this particular analysis may be the result of missing data (20-30% of matrix for these taxa). All of the conflict among the four MPTs was the result of Listera and Stereosandra moving between clades. The latter is missing about 23% of the characters used in this study, while the former was coded for all the characters. Experimental manipulations of the dataset by removing each of these taxa resulted in a topology consistent with that of the Adams consensus of the unaltered analysis. This suggests that missing data are not contributing as much to the associations observed within this clade as discussed previously with Epilyna. Of the remaining relationships, Listera and Neottia form a polytomy with a clade of Limodorum sister to Cephalanthera and Palmorchis. This was supported by isodiametric seed testa cell shape, which is changed in Cephalanthera to ends isodiametric, middle elongate. A single homoplasious character, pollen unit, supports the clade of Limodorum sister to Cephalanthera and Palmorchis; Limodorum has condition 116

139 of tetrad, while other two taxa have monads. Palmorchis and Cephalanthera are united based on plicate leaf morphology and covered seed cell border. The results of the molecular analysis (Chapter 2, Figs ) place Palmorchis sister to the remaining Neottieae, in which Aphyllorchis is basal to in polytomy with Cephalanthera, Neottia, Listera, and Limodorum, and Epipactis in the strict consensus of the parsimony analysis. Given the results of the morphological analysis alone, it is unclear what the relationships are among Neottieae. The jackknife analysis strongly supported a clade of Aphyllorchis, Uleiorchis, Stereosandra, and Wullschlaegelia, although it was not resolved in the strict consensus (Fig. 3.5), and is unexpected based on current classifications. No study to date has included Stereosandra, given its rarity and difficulty to find. All of these taxa are achlorophyllous mycoheterotrophs, and therefore share a number of homoplasious features associated with this condition such as reduced or absent leaves. Uleiorchis and Wullschlaegelia are each missing characters (43% and 2% respectively), mostly characters associated with the loss of leaves. The support for Diceratostele gabonensis and Xerorchis amazonica in a polytomy subtending Tropidieae is interesting. Xerorchis has been placed at least tentatively into Nervilieae (Chase et al 2003), and given the results of this study Diceratostele should be included in that tribe as well (Chapter 2). Xerorchis is missing about 36% of the characters, while Diceratostele is missing only 2%. At least morphologically the placement of these taxa near Tropidieae is not surprising given similar vegetative and morphological features such as plicate leaves and erect anthers. 117

140 EFFECTS OF WEIGHTING- While weighting schemes are controversial, with the position taken by some authors that no weighting scheme [a priori, to a lesser extent a posteriori] is justifiable (Swofford and Olson 1990), others suggest weighting as a means to explore the data, especially a posteriori weighting (Goloboff 1993, but also see Allard and Carpenter 1996, and Carpenter 1994). The arguments supporting a priori weighting schemes are based on the notion that some characters inherently are worth more than others (Bull et al. 1993; Swofford et al. 1996), however knowing the importance of a character a priori is not possible in phylogenetics as character distributions are a product of the evolutionary process and are only interpretable in the context of a phylogenetic analysis. This is very much a problem for morphological characters as selective processes influence these and convergences are common. A posteriori successive weighting uses iterative heuristic searches whereby characters were reweighted on the basis of their respective rescaled consistency indices (RCI). This procedure will downweight characters with low consistency (i.e. favors characters that are not homoplastic) in favor of characters that may have better phylogenetic signal. Goloboff (1993) argues that this is the only defensible weighting scheme for phylogenetic inference, as by definition, homoplasy is discordance between the tree and the character ; given that our goal is to provide a hypothesis of phylogenetic relationships, characters that are homoplasious do not meet the expectation of a hierarchical framework. The successively weighted analysis generally produces a more resolved topology than a strict consensus topology, and provides a means to choose among multiple most parsimonious topologies (Carpenter 1988, 1994, Goloboff 1993). 118

141 The weighted analysis returned a topology that was consistent with the unweighted analysis. Based on the Adams consensus of the unweighted matrix, only three taxa were problematic, and successive weighting suggests that character conflict due to homoplasy was influencing patterns as the topologies of the unweighted and weighted analysis only differed in the placement of these three taxa (Carpenter 1988). Epilyna moves back with the other Sobralieae, and Listera unites with Neottia and Limodorum. Listera and Neottia are considered closely related, some authors arguing that they are the same genus, therefore this position is consistent with previous observations. Stereosandra was seen within the clade of Aphyllorchis, Uleiorchis and Wullschlaegelia, in a polytomy with Uleiorchis and Wullschlaegelia. These taxa share a number of characteristics such as reduced or absent leaves, an achlorophyllous habit, a terminal inflorescence and two pollinia but no unique synapomorphies. The association of Stereosandra, Uleiorchis and Wullschlaegelia had not previously been suggested, although Dressler (1993) had included them in Gastrodieae. Chase et al. (2003), based on molecular data, moved Wullschlaegelia to Arethuseae and Stereosandra to Nervilieae. The results of the molecular analyses of Chapter 2 clearly support Aphyllorchis in Neottieae, and Wullschlaegelia, which was included in the ITS analysis, was sister to a clade containing Nervilieae, Tropidieae and the advanced Epidendroideae. TOTAL EVIDENCE ANALYSIS- One of the stated applications of Freudenstein and Rassmussen (1999) was to provide a morphological dataset that could be used in larger analyses. Morphology in orchids is strongly influenced by selection pressures 119

142 associated with pollination syndromes, the loss of chlorophyll, etc., which make hypotheses regarding morphological character evolution difficult to evaluate. Adding more characters, in particular those that are more or less independent of the characters of interest could provide a better understanding of character evolution. The fact that tribal level relationships are well resolved but not receiving significant support continues to provide evidence supporting previous assertions that the diversity of the Epidendroideae may be the result of a rapid evolutionary radiation (Cameron et al. 1999, Chase et al. 2003). The TEA is the most comprehensive study to date of the basal Epidendroideae, including five molecular datasets and morphology, and provides the most resolved pattern of relationships among the tribes of the basal Epidendroideae (Fig.3.10). This analysis returned many clades found in the molecular study presented in Chapter 2, but differs in some significant respects, and with a few exceptions is consistent with recently published molecular hypotheses of tribal compositions (Chase et al. 2003). Here we find a basal clade of Neottieae and Palmorchis sister to the remaining Epidendroid orchids. Chase et al. (2003) tentatively placed Palmorchis in Neottieae. Further study is necessary in order to confirm this, however at this time, both the morphological and TEA results provide evidence of a very close relationship between Neottieae and Palmorchis, and given the cumulative results of morphology and molecules, this group is sister to the rest of the Epidendroideae. Bateman et al. (2006) presented two topologies for Neottieae with each of the genera represented (but excluding Aphyllorchis) using nuclear ITS alone and ITS combined with plastid markers. My findings of relationships within the tribe concur with their observations of Palmorchis sister to Neottieae s.s. followed by Cephalanthera. 120

143 Bateman et al. however found Neottia/Listera the next to branch off followed by Limodorum, then Epipactis. In the current study, within Neottieae s.s., Cephalanthera is the first to branch off, followed by a clade of Aphyllorchis and Limodorum; this was sister to Epipactis, followed by Listera and Neottia. While Bateman et al. used more species within genera than the current study I used multiple independent loci representing each of the plant genomes as well as morphology, plus exemplars of all genera. This is the most complete sampling of generic level relationships of Neottieae to date and provides a unique alternative hypothesis of relationships within Neottieae. There were two interesting hypotheses presented by this analysis. These are the overall position of Triphoreae and that Triphoreae is sister to Epipogium. This latter was an association also observed in the combined parsimony analysis presented in Chapter 2 (Fig. 2.7). Based on the findings of the molecular study it was concluded that Triphora amazonica might be contributing conflicting signal pulling Triphoreae down towards the base of the tree (see 2.8 and discussion of Chapter 2). However as T. amazonica was not represented in the analyses using morphology, the position of Triphoreae certainly cannot be due to the same reasons argued in Chapter 2 and requires further investigation. The rbcl study of Cameron et al. (1999) found Triphoreae and Nervilieae at the base of the epidendroid clade sister to the rest of the Epidendroideae. This was not strongly supported nor was it recovered in the strict consensus, but does provide evidence that a very basal position of the tribe is possible. Dressler (1993) stated that Triphoreae was superficially similar to Neottieae in the flower and Cephalanthera in particular resembled Triphoreae in the column. While many of the characters thought to be used by Dressler in making this assertion are plesiomorphic, Cephalanthera (Rasmussen 1982: Fig. 5), 121

144 Triphora, and Psilochilus (see Fig. 3.2) have recurved anther locules and rather prominent apical beaks. Member of Triphoreae have been associated with Nervilia at one time or another based on morphology (see Chapter 1 for discussion), in particular the columns of Nervilia and Triphoreae are quite similar (Fig 3.2, see also Rasmussen 1982: Fig. #63). A relationship between these taxa however is not supported by the TEA results. Within Triphoreae s.s., there is a clear and consistent pattern of relationships emerging. There is strong support for Monophyllorchis branching first, with Psilochilus sister to Triphora. Nervilia, Xerorchis (both Nervilieae sensu Chase et al. 2003) and Diceratostele (moved to Nervilieae, see Chapter 2) are found at the base of a clade with Gastrodieae (sensu Dressler 1993). While there is structure within the clade, it is unclear what the relationships are among Gastrodieae given the relatively short branches observed. The observation that Nervilieae and Gastrodieae are in some way related, is similar to findings of the nad1b-c analysis for which most of Gastrodia were sampled and the combined molecular results. Morphology alone suggested a different pattern; following the arguments made in Chapter 2, the results of the TEA may be due to a single locus (nad1b-c) influencing the pattern. Further work is needed to assess this. Furthermore, within Gastrodieae, the relationships of taxa such as Uleiorchis, Auxopus and Didymoplexiella, which were not sequenced for any of the loci used in the study, remain to be clarified. Sobralieae is seen branching after Triphoreae, followed by Tropidieae sister to the advanced epidendroid outgroups and this sister to Nervilieae and Gastrodieae. This is the first study to suggest these relationships. Sobralieae clearly forms a monophyletic group 122

145 with very good support. Within the tribe, Sobralia is the first to branch off, followed on successive branches by Sertifera, and a clade of Epilyna and Elleanthus. In their composite tree of orchid relationships, Chase et al. (2003) placed Sobralieae and Tropidieae in a clade branching after Neottieae, sister to everything else. The morphological analysis performed as part of this study supports Sobralieae in a position near Triphoreae (Fig. 3.7) but the combined molecular analysis of this dataset finds Sobralieae sister to Tropidieae (Chapter 2, Fig. 2.8). The Maximum Likelihood analysis of the combined dataset (Chapter 2, Figs. 2.9 and 2.12) resolves a well-supported relationship between Sobralieae and Triphoreae (including Epipogium). While weakly supported, a clade of Stereosandra sister to Tropidia and Corymborkis (Tropidieae) is obtained. Stereosandra was coded for only 23 morphological characters, and was not sampled for any of the molecular loci due to a lack of material. In recent classification schemes, this genus was considered to be a member of Gastrodieae (Dressler 1993) or Nervilieae (Chase et al. 2003). Given the lack of any unique set of morphological characters supporting a relationship between Tropidieae and Stereosandra, this must be considered a spurious association due to missing data. This being the case, the TEA results can neither support nor refute either of the hypotheses presented for Stereosandra. CHARACTER EVOLUTION- Several morphological characters as well as suites of characters are diagnostic of monophyletic groups, however many of these are homoplastic (Fig. 3.11). This is not surprising given the effects of selection on orchids 123

146 generally, and in particular on characters associated with floral, habit, and vegetative morphology. The TEA topology is used to discuss morphological character evolution as this provides the best hypothesis of relationships using all the available data (Figs ). Spiranthosomes were assumed to be absent among the epidendroid orchids, however Stern (1999) found spiranthosomes in both Wullschlaegelia and Uleiorchis. Born et al. (1999) monographed these two genera, reporting on their close relationship. All recent molecular studies, as well as the current morphological analysis, support Wullschlaegelia in the Epidendroideae (Molvray 2000, this study). Wullschlaegelia and Uleiorchis are nested within the Nervilieae/Gastrodieae grade (Fig. 3.10), as such it is clear that the presence of spiranthosomes in these orchids is an apparent case of convergence; this assumes that other taxa in the basal Epidendroideae also lack this trait, however vegetative morphological work is needed among the basal epidendroid taxa in order to evaluate this further. Among the epidendroid taxa, plicate leaves are the primitive condition, with conduplicate leaves evolving once, in Epilyna (Sobralieae), and reduced or absent leaves five times (Fig. 3.12). Assuming that reduced or absent leaves is a condition associated with the loss of chlorophyll, this means that achlorophylly arose five times; the combined molecular study (Chapter 2) found that achlorophylly arose at least six times among the basal Epidendroideae. Given that the position of Stereosandra is likely due to missing data, it may be argued that when considered under either alternative placements for this genus, reduced or absent leaves have evolved a minimum of four times. Triphora was coded as having flat non-plicate leaves. This condition is a little difficult to determine in 124

147 plants with very small leaves, and may have been miscoded for this genus given that Monophyllorchis and Psilochilus both have plicate leaves. Triphora trianthophora and Triphora gentianoides both have reduced leaves, appearing conduplicate due to their bract-like appearance, but in T. trianthophora which can have larger leaves, they are clearly flat-non-plicate, while others such as T. ricketii and T. craigheadii appear to have herbaceous plicate, cordate leaves similar to those of other taxa in the tribe. Given that this was an autapomorphy for Triphora, it does not appear that recoding will change the results of this study any. Incumbency is a condition associated with epidendroid orchids, and as anther position is related to pollinium deposition, it is very important to understand it in a phylogenetic context. Freudenstein et al. (2002) reported that there is considerable variation in how incumbency is achieved. Within epidendroids, anther bending can occur late in development (non-vandoids) or early (vandoids), and can be attributed to one of the three regions of growth (Fig. 3.4). Freudenstein et al. (2002) found that the derived vandoid orchids and primitive non-vandoid taxa each express some level of elongation in the column zone contributing to anther bending, and point out that this must be considered the primitive condition in the Epidendroideae. The results of this study confirm this observation in a phylogenetic context. All of the orchids studied here are non-vandoid taxa and experience late stage anther bending (Figs ). Among the taxa studied, it is apparent that column and basal (see Fig. 3.13) zone bending contribute the most to anther bending, with sporogenous zone bending contributing the least to 125

148 anther bending, showing up at least five times among the basal epidendroid orchids. Sporogenous zone bending (Fig. 3.14) is found among taxa most considered fully incumbent, such as Epipogium, Didymoplexis, Palmorchis and Gastrodia (Fig. 3.3 A-D). Taxa considered erect or subincumbent, such as Triphoreae (Fig. 3.2 A-D), Cephalanthera and other members of Neottieae (See Rasmussen 1982 and Szlachetko and Rutkowski 2000 for comparisons), tend to exhibit low-level basal zone bending, with the majority of the bending attributed to the column zone. With the exception of Palmorchis, which is fully incumbent (Fig. 3.1.C, also Szlachetko and Rutkowski 2000, Fig 402), Neottieae s.s. is considered suberect to subincumbent (Dressler 1993, Pridgeon et al 2005). Burns-Balogh and Bernhardt (1985), using a different classification scheme and taxon sampling, concluded that the condition of suberect to subincumbent was the primitive condition of the Epidendroideae (indicated by Gastrodieae and Triphoreae); the significance of this is unclear given that the tree was not produced using any explicit methodology. From the results of the current study, it is apparent that a suberect anther is the primitive condition, with the incumbent anther evolving a minimum of five times among the basal members of the Epidendroideae. Anther position is associated with pollination syndromes as are pollen types. Taxa that are pollinated by large insects or bees often have anthers that are fully incumbent and hard or firm pollinia that are deposited as a single unit on the receptive stigma; suberect or subincumbent anthers are often correlated with sectile or mealy pollinia (see below for additional discussion), and large stigmatic receptive surfaces (Burns-Balogh and Bernhardt 1985). Most of Neottieae are suberect to subincumbent and pollinated by small flies and gnats, and have soft, mealy or sectile pollinia (Burns-Balogh et al 1987). 126

149 Palmorchis on the other hand is clearly incumbent having a firm granular pollen mass (Fig. 3.1C). As such, Palmorchis may have evolved the incumbent anther in association with bee pollination. Like many terrestrial forest species, Palmorchis exhibits gregarious blooming (Dressler 1984), which increases the probability of outcrossing, especially when each flower lasts for short periods (Dressler 1981). Pollination has been observed in two species of Palmorchis in Panama, with specific pollinators being identified for Palmorchis nitida which was collected with Osiris melanothrix (Anthrophoridae; Shanks 1986) on the plant (Dressler 1984). Palmorchis powellii was reported to be pollinated by Osiris mourei, however the relationship has never been reconfirmed (Shanks 1986). Osiris is a group of neotropical parasitic bees. The anthers of four taxa in this study can be considered erect, with a complete absence of bending in all three zones; these are Diceratostele (Fig. 3.3), Xerorchis (see Pridgeon et al. 2005), Tropidia and Corymborkis (see Rasmussen 1982 Fig. 35 and 37). Given the results of this study, the first two may be considered closely related members of Nervilieae, and the latter two belong to Tropidieae. The erect anther condition is considered the primitive condition (Dressler 1993), found primarily outside of the Epidendroideae; as a result, this condition among the primitive epidendroid orchids evolved convergently at most three to four times. There is some possibility that Stereosandra has an erect anther (Szlachetko and Rutkowski 2000) however fresh material of this genus was not available. The specimen presented by Rasmussen (1982, Figs ) was damaged during preparation, and interpretation of anther bending was made using these figures. It is clearly not fully incumbent, but given the material, the level of bending in the column zone is made more difficult to assess. New collections of 127

150 this genus are required in order to better understand the development and nature of anther positioning. Given the position it has in the TEA tree, sister to Tropidieae, it possible that it is erect as reported by some authors. This assumes that Stereosandra belongs here, which as previously pointed out, may not be the case. Pollen can be packaged into pollinia as either monads or tetrads. Among the taxa sampled for this study, tetrads should be considered the primitive condition (Fig. 3.15), and monads are found only in a subset of Neottieae (Palmorchis, Cephalanthera, Aphyllorchis, and Limodorum). The hypothesis of relationships for Neottieae presented by Burns-Balogh et al. (1987), who also included this character, suggests two parallel evolutions of monads within the tribe and that the primitive condition is the tetrad. However, they refer to the methods of Burns-Balogh and Funk (1986) for methods of tree construction, which are not explicit. The work of Bateman et al. (in Pridgeon et al. 2005) using a greater sampling of species within genera, did not include Aphyllorchis, and provides the first attempt to access relationships within the tribe using an explicit methodology; however given that not all genera were included, the origin of monads in Neottieae cannot be conclusively answered. Therefore, of the studies using a significant sampling of Neottieae, the current study is the first to provide a complete genus level picture of relationships within the tribe. As both conditions, monads and tetrads are seen in the orchidoid outgroups, the primitive condition for the Epidendroideae is ambiguous (Fig ), therefore two alternative hypotheses might explain the origin of monads in Neottieae. If tetrads are the primitive condition within the subfamily, monads evolved once in Neottieae with a reversal to tetrads in the clade of Epipactis, Listera, and Neottia. On the other hand if you assume the monads is the primitive condition, tetrads would 128

151 have evolved independently twice. Both hypotheses require two steps and are equally parsimonious, however, it is reported that tetrads are the primitive condition in the subfamily, and therefore the former hypothesis is preferred. Pollinia can be composed of either free pollen in monads or tetrads, or they can be aggregated into smaller packets of pollen; these pollinia are called sectile pollinia composed of individual units called massulae. Burns-Balogh and Funk (1986) reported that sectile pollinia evolved five times in their study of the Orchidaceae. Furthermore, other recent works (Dressler 1990a, b, c) indicate six independent derivations of sectile pollinia. Freudenstein and Rasmussen (1997) recognized three types in their study of orchid sectile pollinia. Among the orchids studied here, the primitive condition is free tetrads or monads (Neottieae), in soft or mealy pollinia (Fig. 3.15). Within the Epidendroideae, a single regularly arranged layer of uniform shape and size ( orchidoid of Freudenstein and Rasmussen 1997) in seen here in Tropidieae and Stereosandra, Uleiorchis, Wullschlaegelia and Auxopus, which implies a minimum of three independent derivations of this condition. At a minimum, multiple layers of irregular massulae ( epidendroid of Freudenstein and Rasmussen 1997) evolved twice in the Epipogium + Triphoreae clade, and Gastrodieae and Nervilieae (Nervilia) clade. One thing that is apparent given these results is that there is a trend towards increasing cohesion of pollen grains from monads to tetrads, and increasing organization of the pollinium into larger, organized packets. Pollinia may be attached either by caudicles, or caudicles and stipes to either a viscidium then a pollinator or directly onto an insect vector. Rasmussen (1986) reported on these stalks in detail. The caudicle is derived from pollen, and among epidendroid 129

152 orchids, caudicles can be seen as either attached to the apex or base of the pollinia. Dressler (1993) reported that in orchids generally the presence of a caudicle is associated with firm or hard pollinia and as the primitive condition for the pollinia is soft or mealy in orchids, caudicles are derived multiple times. Based on this study (Fig. 3.16), the primitive condition of the Epidendroideae is caudicles absent, with caudicles evolving three times: in Sobralia (Sobralieae) and in the clade containing Tropidieae, Stereosandra, and the advanced Epidendroid taxa, and basally attached pollinia convergently evolving in Epipogium. Among the epidendroid orchids, stipes may either be hamuluar or tegular. How these were coded was discussed previously, however from these results, it is clear that the stipe evolved a minimum of twice in Tropidieae and at least as far as sampling allows, Calypso (Fig. 3.17). The stipe of Tropidieae is unique in that it contains a core of scherenchyma tissues, and therefore may represent an independent derivation, or given these results, it may be seen as the transitional or intermediate condition between taxa lacking stipes and the tegular stipe that is observed some of the more derived taxa. Dressler (1993) reported that stipes have evolved a number times; therefore the use of this character in a broader analysis with greater sampling and more morphological/ developmental observations would help to address this question. A recent study by Prutsch and Schill (2000) reported that Cephalanthera (Neottieae) possesses a concave non-papillate stigma type (Type III; Calder and Slater 1985, Dannenbaum, et al. 1987) which is generally only found in the more derived members of the Epidendroideae (eg., Phaius tankervilliae). Papillate refers to the receptive surface of the stigma, however this is the result of the shape of underlying 130

153 receptive cells (finger vs prosenchymatic). Neottieae studied by Prutsch and Schill (2000), with the exception of Cephalanthera, all had a Type II, or papillate stigma (i.e. finger-like receptive cells). As a result they present a rather interesting hypothesis that Cephalanthera is an intermediate between Neottieae and the more derived Epidendroid orchids. A number of molecular phylogenetic studies consistently place the genus Cephalanthera within Neottieae (this study, Batemen et al. 2006). This study (Fig. 3.17) does not support the hypothesis of Prutsch and Schill (2000). Within the Epidendroideae, the primitive condition is clearly prosenchymatic with finger-like stigma receptive cells evolving independently four times, in the clades of Epipactis+ Neottia/Listera, Triphoreae, Nervilia, and Gastrodia. There are a number of taxa in the Nervilieae/Gastrodia clade for which this character is equivocal. Given the already stated questions surrounding this grouping, it not clear what the best optimization for this might be. The molecular partition analyses presented in Chapter 2 it can be stated that the nad1b-c partition is driving this association. In addition, Diceratostele and Xerorchis are part of Nervilieae. Neither of these genera were coded for this character due to a lack of material, but given their association with Nervilia, it is predicted that they would also have finger-like stigmatic cells. With the exception of Cephalanthera, Neottieae are reported in the literature as having papillate stigmatic receptive surfaces (Prutsch and Schill 2000), however based on the published images of Kurzweil (1988), it was not possible to establish this condition for all the taxa, as a result Neottia and Limodorum were both coded as absent for this 131

154 character in this study. Given the results of the TEA, it can be predicted that Neottia should also possess a papillate stigma with finger stigma cells as previously reported, however, Limodorum is found in a clade with taxa possessing prosenchymatic stigmatic surface cells, therefore this needs to be investigated further. Pollinium number has often been used to delimit groups of orchids at various levels. Rasmussen (1986) stated that the primitive number of pollinia in orchids is four, which corresponds to the number of pollen sacs found in other lilioid monocots. This study confirms that the primitive condition in the epidendroids is four, finding that among these orchids two and eight pollinia evolved four and two times respectively (Fig. 3.18). Xerorchis, Sobralia, Epilyna and Elleanthus were coded as having eight pollina, however given the lack of material of Xerorchis it is not clear if the condition of eight pollinia in Xerorchis and Sobralieae are the same, therefore further work is still needed in order to examine this more thoroughly. CONCLUSION It is becoming apparent that the diversity of the Epidendroideae is a result of a rapid evolutionary radiation. This was first pointed out by Cameron et al. (1999), and is indicated by the relatively short inferred branch lengths supporting the arrangement of the five basal tribes. The results of the current study are based on the most comprehensive sampling at the level of the genus performed to date, including characters from both morphology and molecules. The findings presented here are the first to provide a robust hypothesis of evolutionary relationships and a framework with which to address morphological evolution in these orchids. Although the topologies presented failed to 132

155 receive significant support for many tribal level relationships, the highly structured patterns indicate phylogenetic signal in molecular characters is present. The conflicting patterns seen using different methods (Chapter 2) are probably due more to the application and circularity of model-based methods compared to parsimony, and the technical limitations of likelihood methods. A significant amount of signal was from gap characters, which are excluded in likelihood analyses; the preferred phylogeny is that which minimizes ad hoc hypotheses of homoplasy and which utilizes all the available information. Considering the significance of the basal Epidendroideae in understanding patterns of morphological evolution within the subfamily, it is surprising that a robust hypothesis of historical relationships had not been presented for these orchids previously. This is the first study to improve both taxon and character sampling, and while these results provide the first look at a hypothesis of relationships among the basal Epidendroideae, there are still a number of questions remaining. My findings indicate Palmorchis is sister to Neottieae, and should be included in this tribe at the base of the Epidendroideae. Following this clade, on successive branches we find Triphoreae sister to Epipogium, and this clade sister to Sobralieae. The finding of Epipogium sister to Triphoreae is a new hypothesis, and while both tend to have reduced structures, there is no apparent morphological synapomorphies to confirm this association. Further work will be required with the addition the use of other loci and detailed morphology in order to confirm this. Branching after Sobralieae, Tropidieae form a clade with the advanced Epidendroideae sister to a clade of Nervilieae and Gastrodieae; Diceratostele gabonensis groups within this clade. Freudenstein and Rasmussen (1999) reported a close 133

156 relationship between Nervilia and Gastrodieae, and given the results of the current study, this is confirmed, however, the relationship between Gastrodieae and Nervilieae needs to be investigated further as this appears to be the result of nad1+gaps partition; additional locus sampling should help clarify this, as well as better sampling within the two tribes. Furthermore, Gastrodieae sensu Dressler (1993) is polyphyletic (i.e., Epipogium grouping with Triphoreae) with most of Gastrodieae held together based on morphology and a single molecular marker, nad1+gaps. The Gastrodieae are all achlorophyllous, as such amplification of plastid is usually not possible; sequencing of additional loci representing the other plant genomes will provide more characters for phylogenetic study and could help to clarify relationships. An objective of this study was to investigate anther evolution since anther position is important for pollination. Among the basal members we find anthers that are erect, or exhibit varying degrees of incumbency. It is clear from these results that the erect anthers of some these epidendroid orchids evolved independently from those observed in the Orchidoideae. The primitive condition among the basal Epidendroideae is suberect/subincumbent. Epidendroid incumbency is achieved via combinations of bending in different regions of the anther, with the primitive condition column zone bending and to a lesser extent, contributions from basal zone of the anther. The primitive condition for pollinia is free tetrads with monads evolving once in Neottieae, with a reversion to tetrads in Epipactis and Listera/Neottia; sectile pollinia have evolved four times. Some authors have suggested that the type III stigma of Cephalanthera, possessing other primitive features, was evidence that it was intermediate between Neottieae and advanced Epidendroideae. Given its position in this analysis, this is a case of 134

157 convergence. One thing that is apparent here is that there is a trend towards increasing cohesion of pollen grains from free monads or tetrads, into an organization of the pollinium into larger, more solid, organized packets. Further work is need in vegetative and floral morphology in order to find new characters as well as to fill in some of the missing data and complete the matrix. New molecular loci in conjunction with these data should help to answer many of the outstanding issues of this study. 135

158 Table Morphological matrix consisting of 30 characters coded for 40 taxa.? indicates accessions for which data was lacking due to missing supporting structures or insufficient material. - indicates accessions which were not observed for the character and represent missing data. 136

159 Codonorchis 11?00???0?110?? ?01110 Goodyera 10100? Chloraea 10000?010? ?12010 Caladenia ?? Caladenia ?? Spiranthes 11100? Aphyllorchis 00-3???100110?? Auxopus 0?-3????011?0?? Cephalanthera Corymborkis Diceratostele ?? Didymoplexis 02-3????01110? Didymoplexiella 02-3?2??00110? Elleanthus Epilyna ? Epipactis Epipogium 0203?20? Gastrodia elata 0203?2?? ? ?2101 Gastrodia siamensis 0203?2?? ?2? ?00 Gastrodia sesamoides 0203?2??01110?? ???? Gastrodia procera 0203? ? Limodorum 00-3???? ?0000 Listera Monophyllorchis ? Neottia nidus-avis 00-3? Nervilia Palmorchis ?000001?0001 Psilochilus ? Sobralia Stereosandra 02?3? Triphora 00000?000? Tropidia ? Uleiorchis 0013????0???0---1-? Wullschlaegelia 0013?2??0? ? Xerorchis Arethusa ? ?12000 Bletilla ?12000 Calypso 01010? Aplectrum Govenia ?22101 Table

160 Fig 3.1: A) Epilyna hirtzii (Sobralieae), B) Didymoplexis pallens bud just prior to opening showing granular pollinia, C) Palmorchis trilobulata, D) Gastrodia procera with distinctly sectile pollinia, inset showing stigmatic surface cells. 138

161 A B C D Fig

162 Figure 3.2: The columns of Triphoreae. A) Psilochilus mollis (ER 207) with near erect anthers; parallel bars indicated location of B) showing close up of raphide cells. C) Triphora trianthophora from mature anther with inset of anther showing sectile pollinia and tetrads as observed in stage just prior to dehiscence. D) Monophyllorchis maculata (ER208) column damaged during preparation. 140

163 A B D C Fig

164 Figure 3.3: Column morphology of Diceratostele gabonensis (ER44) showing an erect anther with distinct staminoda and concave stigma. A) Lateral view, B) ventral view with inset of stigma and rosellum, C) dorsal view. 142

165 A B C Fig

166 A B C Figure 3.4: Diagram of a longitudinal cross section of typical orchid column illustrating an epidendroid incumbent anther and delineating the three zones of bending as described and illustrated in Freudenstein et al. (2002). The zones of bending used in this study are the sporogenous zone (A), basal zone (B) and column zone (C) 144

167 Figure 3.5: Strict consensus tree of 4 MPTs (L= 123, CI= 0.333, RI= 0.657) returned from the analysis of the parsimony analysis of the morphological matrix. Numbers indicate jackknife support values >50%. SC refers to subclades discussed in text. 145

168 100 SC 1 SC 2 SC Codonorchis Spiranthes Goodyera Chloraea Caladenia 1 Caladenia 2 Didymoplexiella Didymoplexis Auxopus Gastrodia elata Epipogium Gastrodia siamensis Gastrodia sesamoides Gastrodia procera Nervilia Monophyllorchis Psilochilus Triphora Elleanthus Sobralia Arethusa Bletilla Calypso Aplectrum Govenia Aphyllorchis Diceratostele Epilyna Epipactis Listera Neottia nidus-avis Stereosandra Uleiorchis Wullschlaegelia Xerorchis Corymborkis Tropidia Limodorum Cephalanthera Palmorchis Gastrodieae Nervilia Triphoreae Sobralieae Advanced epidendroids Sobralieae Tropidieae Figure

169 SC Stereosandra Aphyllorchis Uleiorchis Wullschlaegelia Listera Neottia nidus-avis Limodorum Cephalanthera Palmorchis Epipactis Epilyna Diceratostele Xerorchis Corymborkis Tropidia Figure 3.6: Portion of the Adams consensus tree returned from the morphological analysis. Arrow indicates rest of tree that did not differ from the strict consensus topology. Numbers signify Jackknife support for clades not recovered in the strict consensus topology. SC refers to subclades discussed in text. 147

170 Figure 3.7: 1 of 4 MPTs obtained from the analysis of the morphological matrix with character distributions mapped. Black circles are synapomorphies, while unfilled circles are homoplasious characters. 148

171 149 Figure 3.7 Codonorchis Goodyera Chloraea Caladen1 Caladen2 Spiranthes Aphyllorchis Auxopus Cephalanthera Corymborkis Diceratostete Didymoplexis Didymoplexiella Elleanthus E pilyna Epipactis Epipogium Gastrodia elata Gastrodia siamensis Gastrodia sesamoides Gastrodia procera Limodorum Listera Monophyllorchis Neottia nidus avis Nervilia Palmorchis P silochilus Sobralia Sterosandra Triphora Tropidia Uleiorchis Wullschlaegelia Xeorchis Arethusa Bletilla Calypso Aplectrum Govenia SC1 SC2 SC3 Caladenia 1 Caladenia 2

172 SC Aphyllorchis A p h y l o r c h i s Ul Uleiorchis e i o r c h i s wu Wullschlaegelia l s c l a e g e l i a Neottia o t t i e a n a nidus-avis v i s Limodorum L i mo d o r u m e p Cephalanthera h a l a n t h e r a p i Epipactis p a c t i s L i Listera s t e r a Epilya E i l n a P a Palmorchis l r c h i s D Diceratostele i c e r a t o s t e t e X Xerorchis e o r c h i s St Stereosandra e r o s a n d r a Corymborkis r y o r k i s T Tropidia r o p i d i a Figure 3.8: A portion of 1of 4 MPTs derived from the analysis of the morphological matrix. Black circles are synapomorphies, while unfilled circles are homoplasious characters. SC refers to subclades discussed in text. 150

173 SC3 SC1 SC2 Codonorchis Spiranthes Goodyera Chloraea Caldenia 1 Caldenia 2 Didymoplexiella Didymoplexis Auxopus Gastrodia elata Epipogium Gastrodia siamensis Gastrodia sesamoides Gastrodia procera Nervilia Monophyllorchis Psilochilus Triphora Sobralia Elleanthus Epilyna Arethusa Bletilla Calypso Aplectrum Govenia Aphyllorchis Stereosandra Uleiorchis Wullschlaegelia Limodorum Listera Neottia navis Epipactis Cephalanthera Palmorchis Diceratostele Xerorchis Corymborkis Tropidia Figure 3.9: Single most parsimonious tree obtained from the successively weighted analysis of 30 morphological characters. 151

174 Figure 3.10: The single most parsimonious tree of 4196 steps (CI= 0.712, RI= 0.461) returned from the parsimony analysis of the total evidence matrix including all Gastrodia species except Gastrodia procera. Numbers indicate jackknife support values. 152

175 TEA 1of 1 MPTs +gast -procera 30 morpho. L= 4196 ci=0.712 ri= Codonorchis Goodyera Palmorchis Cephalanthera Aphyllorchis 69 Limodorum Neottieae Epipactis Listera Neottia 97 Epipogium Monophyllorchis Triphora 96 Psilochilus 84 Sobralia Sertifera 97 Epilyna Sobralieae 89 Elleanthus 96 Calypso Advanced Chysis 97 epidendroids Sterosandra Stereosandra Corymborkis 60 Tropidieae Tropidia Xerorchis Nervilia 95 Diceratostele Didymoplexiella Gastrodia sesamoides 534 gastrodia Gastrodia sp sp. reunion Reunion ER214 gastrodia Gastrodia confusa 0801 O gastrodia Gastrodia zyl zeylanica Wullsclaegelia Wullschlaegelia Uleiorchis Auxopus Didymoplexis 50 changes 93 Triphoreae Gastrodieae Figure

176 Codonorchis Goodyera Palmorchis Cephalanthera Aphyllorchis Limodorum Epipactis Listera Neottia Auxopus Didymoplexis Uleiorchis Wullschlaegelia Gastrodia zeylanica Gastrodia sp. Reunion Gastrodia confusa Gastrodia sesamoides Didymoplexiella Diceratostele Nervilia Xerorchis Corymborkis Tropidia Stereosandra Calypso Chysis Epilyna Elleanthus Sertifera Sobralia Epipogium Triphora Psilochilus Monophyllorchis Figure 3.11: Single MPTs obtained using total evidence with unambiguious changes mapped onto branches. Numbers refer to character numbers. Symbols used : synapomorphies, homoplasy above, homoplasy below, homoplasy above and below point on tree. Chars. that change Unambiguously on branch unique, uniform changed above, not homoplasy above homoplasy outside homoplasy above an ambiguous change derived state uncle 154

177 Gastrodia zeylanica 155 Figure 3.12: Distribution of leaf morphology mapped onto the single MPT obtained from total evidence analysis of 4858 characters from ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters.

178 Gastrodia zeylanica Gastrodia zeylanica 156 Character # 10: Sporogenous zone Character # 11: Basal zone Figure 3.13: Distribution of sporogenous and basal zone anther bending onto the single MPT obtained from total evidence analysis of 4858 characters from ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters.

179 Gastrodia zeylanica 157 Figure 3.14: Distribution of column zone bending mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters.

180 Gastrodia zeylanica Gastrodia zeylanica 158 Figure 3.15: Distribution of monads /tetrads and sectile pollinia mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters

181 Gastrodia zeylanica Gastrodia zeylanica 159 Figure 3.16: Distribution of caudices mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters.

182 F i g u Gastrodia zeylanica Gastrodia zeylanica 160 r e 3.17: Distribution of stipe and stigmatic cell shape mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c+gaps, trnl-f +gaps and 30 morphological characters.

183 Gastrodia zeylanica Gastrodia zeylanica 161 Figure 3.18: Distribution of pollinium number mapped onto the single MPT obtained from total evidence analysis of 4858 ITS, nad1b-c +gaps, trnl-f +gaps and 30 morphological characters.

184 CHAPTER 4 A MONOGRAPH OF THE ORCHID GENUS PSILOCHILUS (TRIPHOREAE, EPIDENDROIDEAE) INTRODUCTION The genus Psilochilus is composed of 7 species of neotropical orchids from southcentral South America, north through Central America and the Caribbean (Fig. 4.1). Tropical botanists, especially orchidologists, are most often interested in epiphytes consequently terrestrial species are often overlooked. This is especially a problem with species having short-lived flowers and rather inconspicuous habits such as Psilochilus. This genus is found in tropical rainforests of moderate to deep shade. It has been described as similar in appearance to Zebrina pendula (Commelinaceae), in reference to the green with silver striped leaf surface above and purple or magenta below seen in some populations. Morphologically, all species are similar in general appearance, with most of the variation found in the shape of the labellum (Fig. 4.2), and the shape of the leaf. This is the first monographic study of this genus. 162

185 GENERIC NOMENCLATURE AND HISTORY- The genus name derives from a description published by Barbosa Rodrigues (1882) in Genera et species orchidearum novarum with the description of Psilochilus modestus. Prior to this publication, many authors and subsequent authors (for examples see Reichenbach 1859, Cogniaux 1906, Williams 1970) considered members of this genus as Pogonia or related taxa. The first reference to a species now considered Psilochilus is the publication of Pogonia macrophylla (=Psilochilus macrophyllus; Arethuseae, Euarethuseae) by Lindley (1858). Bentham and Hooker (1893), while not specifically referring to any species, placed Pogonia and its relatives (Triphora, Cleistes, Nervilia and Eupogonia) into the tribe Neottieae. Pfitzer (1897) did not recognize Psilochilus at the level of the genus, instead regarding it as a section of Cleistes (Monandrae, Pogonieae, Neottiinae). In this work he made a reference to three species from Brazil, describing the leaves as sheathing and petiolate. Ames (1922), based on a discussion of Pogonia and Triphora by Holm (1900), suggested that Psilochilus was distinct from Pogonia, Isotria and Cleistes in possessing an erect anther on an entire or simply lobed column, with pollen grains compound (i.e. sectile) with a pitted or reticulate exine, the same as Triphora (but distinct from it on the basis of an articulate anther ). Schlechter ( , 1926a) placed Triphora and Monophyllorchis, of which Triphora had also traditionally been regarded as Pogonia, into the subtribe Vanilleae (Monandreae, Acrotonae, Polychondreae); Pogonia was also placed here. Schlechter did not specifically mention Psilochilus by any reference to a species, but given that for the most part he used the works of Pfitzer as his basis, Psilochilus was most likely treated as by Pfitzer, in Cleistes. Mansfeld (1937) using the classification system of Bentham and Hooker, but influenced 163

186 by Schlechter, combined the taxa of Vanilleae and Nervilieae into Vanillinae. Again it is not made clear exactly what taxa were included, as few specific references to species or genera were made. The first comprehensive work to go into intra-tribal composition of the Orchidaceae was Dressler and Dodson (1960). These authors included Psilochilus in Pogoniinae (Vanillinae, Epidendreae, Orchidoideae). Concurrently, Garay (1960) also working on family level organization, mentioned Psilochilus in passing, referring it to the Neottioideae. Brieger (1975), following the previous classification of Schlechter, treated Psilochilus as a member of Pogoniinae. Dressler (1979) segregated three species from Nerviliinae and Pogoniinae to make up the tribe Triphoreae; these included Triphora, Psilochilus and Monophyllorchis. Psilochilus has remained in Triphoreae since this, with the most recent discussion in Pridgeon et al. (2005). MATERIALS AND METHODS MATERIALS- As previously stated this is not an often-collected genus, so in order to augment herbarium collections fresh materials were field collected in Panama, Ecuador, Brazil and Puerto Rico. Specimens were prepared for study by pressing plants and preserving flowers and buds in FAA or 70% EtOH. For this project, specimens were obtained from A, AMES, BR, K, MO, MU, NY, S, SEL, and US, and other specimens were examined at QCA and QCNE. Spirit collections were borrowed from MSB and SEL. METHODS- The principle roles of systematics are to understand biological diversity, its evolution, and distribution. The most basic level of biological organization, in which there is still an apparent hierarchic order, is the species. The species is the 164

187 smallest most inclusive grouping that is diagnosable as being the same on the basis of some criteria. Yet it is well known that there is considerable variation within groups of similar organisms, and between populations of the same species. As a result, a number of species concepts have been proposed to aid in the delimitation of species. For this study, the morphological species concept will be used, as this is ideal for use with preserved materials and herbarium specimens. Images of specimens were taken using a Nikon Coolpix 995 camera attached to a Nikon SMZ1500 compound dissection light microscope with a HR plan APO 1x WD54 Nikon lens. Photos of plants in the field were taken with either a Nikon D50 or a Nikon N60 SLR with an AF micro Nikkor 105mm lens using Fujichrome, Velvia 100 film. All illustrations were made from photos taken of fresh flowers or plants and herbarium sheets. Distribution maps were made using planiglobe beta (Körsgen, R. Kantz, and M. Weineltk, k+w - digitale kartografie GmbH). Dots on the maps represent localities of observed materials only. TAXONOMY Psilochilus Barbosa Rodrigues, Gen. Sp. Orchid. Nov., 2, 272 (1882). Type species: Psilochilus modestus Barbosa Rodrigues. Description: Habit terrestrial, generally solitary, herbaceous, decumbent and sympodial. Stem erect, terate, smooth, purple or purple suffused with green, rhizomatous; roots thick and fleshy, villose, unbranched, arising from basal nodes of the plant, 165

188 occasionally seen at other nodes. Leaves sheathing, petiolate or clasping, alternating, nonarticulate, plicate, blade variously ovate, elliptic, lanceolate, acute or acuminate or obtuse at tip, upper surface light or dark green, may or may not possess markings of light green or white above, purple or purple-green below. Inflorescence a terminal raceme one to few flowered borne in succession, floral bracts ovate, acute, distichously arranged. Flowers erect. Sepals and petals free, green to purple, acute or blunt rounded. Sepals keeled, petals not. Labellum free, with claw, possessing one to three calli along upper surface; trilobed, mid-lobe fringed, crenulate, crisped or smooth, lateral lobes toothed or smooth, rounded or acute, may be hidden by mid-lobe in some cases. Column lobed at apex possessing a distinct rostellum; anther terminal and suberect or reflexed, pollinia four, soft, mealy pollen in tetrads (Fig. 3.2.A-B). Seed elongate, thicker in the middle, tapering towards ends, whitish-brown, testa cells distinctly elongate towards ends, less so towards the middle (Fig. 4.2). Etymology: The name Psilochilus stems from the Greek, psilos, meaning bare, and cheilos, meaning lip, a reference to the glabrous lip of the type species. Nomenclatural orthographic variants: Psylochyllus (Reis et al. 2004). Distribution: Southern Brazil, north and central South America, Central America, southern Mexico and the Caribbean. (Fig. 4.1). Ethnobotany: The only known medicinal or cultural uses of Psilochilus are from the Ecuadorian indigenous people, the Shuar. The name kunsui is used to refer to plants of this genus and are plants of medicinal use with reserved knowledge. What is known is that it is used in sacred rituals for the treatment of unspecified menstrual cycle conditions and in preparing the woman for pregnancy. It is an important component of establishing a 166

189 positive outlook for both the mother and baby during the pregnancy and for the baby after birth; the stripes of the leaves signify the pathway the child should follow in life, and indicate good intelligence. As with most cultures, this is particularly important for the first child. (pers. com., Sra. Teresa Dominga Shiki Masuink, President Omaere Ethnobotanical Park, Puyo Ecaudor). Cultivation: In general these plants are not cultivated widely as they possess neither showy nor persistent blooms. Cultivation however was needed in order to obtain information relevant to this study, therefore some basic observations are presented. Psilochilus can be found under natural conditions growing from ca. 800 to 2500m in the Ecuadorian Andes. Rains generally occurred daily in the area of Ecuador in which these plants are found. Plants in the wild would be running along the surface or just below leaf litter loosely attached to the substrate with new roots forming at the basal nodes. The author purchased plants from Ecuagenera Ltd. (Cuenca, Ecuador) as P. carinatus. Potting media used a combination of loose coarse bark, potting soil, sand, and sphagnum moss with Perlite added to improve drainage. Given the habit of the plants, roots were exposed but in loose association with the potting media. This plant was kept under fluorescent lights with lighting conditions as for Phalaenopsis (ca ,500 foot candles), in controlled conditions for humidity and temperature. Average temperatures were 70ºF (21ºC) during the day and 55ºF (12ºC) nights, consistent with cool to moderately warm conditions. Potting media was kept evenly moist but allowed to lightly dry out between watering so as to imitate conditions observed in the wild. Under artificial lights the plant survived well, set bud, but never flowered. Flowers matured and opened only under natural light conditions. 167

190 Phenology and pollination: This will be treated within the respective species accounts however some general observations will be reported here. Psilochilus blooms successively, from an indeterminate inflorescence. Flowers are open for up to four days, with plants considered to be gregarious or synchronous bloomers such that individuals in a population will all open at the same time. Reports exist which indicate that cleistogamy and autogamy are common (Ackerman 1995), referring to either the triandrous form of P. physurifolius (Jost pers. com) or P. macrophyllus (Ames 1922), however in at least one case (Psilochilus modestus) it is reported that while it is possible to self fertilize, it rarely occurs. ARTIFICIAL KEY TO THE SPECIES OF PSILOCHILUS 1. Claw of the labellum <5mm. 2. Petiole absent or extremely short, leaves clasping the stem; lacking a keel in the claw of the labellum.. 4. P. macrophyllus 2. Petiole distinct, sheathing the stem; with a distinct keel in the claw of the labellum. 3. Petiole < 0.5cm, lateral lobes of the labellum oblique triangular P. carinatus 3. Petiole >1cm, lateral lobes of the labellum acute equilateral triangular P. modestus 1. Claw of the labellum >5mm. 4. Lateral lobes of the labellum acute; leaf blades elliptic to ellipticlanceolate P. physurifolius 4. Lateral lobes of the labellum blunt-rounded; leaf blades ovate. 5. Sinus between lateral lobes and midlobe of the labellum >4mm P. dusenianus 5. Sinus between the lateral lobes and midlobe of the labellum <1mm, lateral lobes. 6. Leaves narrowly ovate to ovate-lanceolate (8-9 x 3-5cm); midlobe suborbicular to subquadrate, margins crenulate-erose 6. P. mollis 6. Leaves broadly ovate (to 15 x 10cm); midlobe triangular, margins entire P. ecuadoriensis 168

191 1. Psilochilus carinatus Garay. Botanical Museum Leaflets. 26(1): TYPE: Colombia: Sierra Nevada de Santa Maria, Purdie s.n. (holotype: K!). Description: Habit to 30 cm tall. Leaves green with or without stripes x 2.5cm, ovate to ovate-elliptical, acute to sub-acuminate, leaf base rounded, possessing a short petiole (0.5-1cm). Inflorescence erect, bracts ovate, conduplicate. Sepals green, dorsal sepal sub-carinate linear-oblong to lanceolate, acute, to 20 x 3mm. Lateral sepals to x 3.5 mm pale green falcate-linear, acute. Labellum green tinged with purple, with long claw (5mm) possessing a distinct keel extending from the base but tapering towards the tip, 15-17mm long. Lateral lobes oblique, triangular, medial lobe subquadrate -round, margins erose-denticulate. Midlobe, 17 x 7 mm, possessing two calli. Column thin arching, subtruncate-denticulate, to 15mm long. (Fig. 4.3.G-H). Etymology- refers to the carinate or keeled claw. Distribution: Columbia, Costa Rica and Panama (Fig. 4.4). Habitat: Lower montane rainforest (in Costa Rica) ca m. Blooming times: July December. Taxonomic notes: Dressler (2003) described an unidentified species based on the specimens Harrera 1484 and Grant et al The description is consistent with that of P. carinatus and an examination of the specimens of Grant and Herrera confirms this. In Dressler s description, he pointed out that the labellum of the Herrera specimen 169

192 possessed a single keel, an observation not confirmed by examination of the specimens, however, additional material of these collections would help to clarify this. Specimens examined: COLOMBIA. Fusagasugia, Holton 23-Dec-1852 (K). PANAMA: Bocas del Torro, in vicinity of Fortuna Dam along Pipeline road to Chiriqui Grande, at continental divide, 2.8 miles from divide, ca N and W alt m, McPherson 9679 (MO). Chiriquí, vicinity of Fortuna Dam ca N W forest above lake ca. 1100m, McPherson 9847 (MO). COSTA RICA. Limon, Guapiles, Los Angeles, San Miguel, between the Rio Blanquito and the Rio Blanco 1300m, Grant et al (SEL photos). Limon, Guapiles, Los Angeles, San Miguel, between the Rio Blanquito and the Rio Blanco 1300m, Grant et al (US). Guanacaste: Parque Rincón dela la Vieja, Libreia. Cabeceras de Quebrada Rancho Grande, bosque circundante a Meseta Agracatales, N W m, Herrera 1484 (MO, SEL). Alajuela: Upala, Bijagua El Pilon, ladera Atalantica del Volcan Tenerio, cuecna alta del Rio Celeste, N W m, Herrera 2144 (SEL). Puntarenas on border with Alajuela in lower montane rainforest. Sendero brilliante at ca. 1600m, Atwood (SEL). 2. Psilochilus dusenianus Kraenzl. ex Garay & Dunst. Venezuelan Orchids Illustrated 3: Type: Brazil, Panara Monte Alegra, Dusen 9022 (holotype: S, photo!). Description: Habit to 30cm. Leaves to 10 x 4cm ovate to ovate-lanceolate, petiolate (1-1.5cm) with sheathing bases, blades with prominent nerves, green or dark 170

193 purple with or without silver/white stripes. Inflorescence with clasping, conduplicate bracts. Flowers few in succession. Sepals thick and fleshy, dorsally carinate. Dorsal sepal 30 x 5mm, linear-elliptic, acute. Lateral sepals falcate 28 x 5mm, acute. Petals shorter than sepals, 27 x 5mm. Labellum claw short (ca. 3mm), trilobed with deep wide (>4mm) sinus, lateral lobes 18 x 9mm, midlobe 5mm, with three prominent calli tapering to two. Midlobe long narrow at base flaring near tip, orbicular or sub-globose, margins entire to weakly erose-crenulate. (Fig. 4.3.J). Etymology: Kraenzlin named this species for Per Karl Hjalmar Dusén, the collector of the type material. Distribution: Venezuela and Brazil (Fig. 4.5). Habitat: In Venezuela it is collected in damp forests, or cloud forests (Carnevali et al. 2003) from m. Specimens examined: VENEZUELA. Boliviar, Uaipan-tepui, the summit of the west peak of Uaipan, 1980m, Agostini and Koyama 7488 (NYBG). Rio Negro, Cerro Aracamuni summit, Proa. Camp, Liesner and Carnivali (MO). 3. Psilochilus ecuadoriensis ined. Rothacker and Jost. Type: Ecaudor, Esmeraldas Reserva Canande Fundacion Jocotoco. Ca 500m Oct. 19, 2005, JOST 7955 (holotype QCA; OS [spirit]). Description: Habit terrestrial, erect, to 30cm tall. Leaves petiolate (to 4cm) sheathing, green with 5 ribs broadly ovate (to 15 x 10cm), short acuminate. Inflorescence an erect raceme, with conduplicate acute bracts, with single flowers borne in succession. 171

194 Flower open, erect. Sepals green, strongly keeled, lateral sepals falcate, lanceolate, acute. Dorsal sepal 25 x 5mm, acute. Petals similar to sepals, light green to white, 20 x 5mm, falcate, rounded, with a distinct keel. Labellum ca 22mm, white with purple along the margins, yellow with purple speckling in throat, with long connate claw (ca. 11mm), possessing two distinct calli extending as one to near the apex of midlobe. Lateral lobes rounded, falcate ca. 5 x 2-3mm extending behind the midlobe, midlobe triangular, (7 x 8mm) margins entire. Column ca. 20cm, with two broad wings, possessing a prominent apical beak, anther subincumbent to suberect, with locules recurved to suberect. (Figs ). Etymology: Named for the country in which the type material was collected. Distribution: Ecuador and Panama (Fig. 4.8). Habitat: Lowland tropical rainforest found in open, 500m (in Ecuador). Blooming period: October. Taxonomic notes: Collected in flower in October, the plant was described at the time of collection by the collector, Lou Jost, as being a robust plant for the genus and found in primary tropical rainforest growing in an open understory. Given the results of a phylogenetic analysis of the genus using the chloroplast trnl-f intergenic spacer (Chapter 5), this species is most closely related to P. mollis. In Dressler (1981) there is an illustration of P. mollis made from a plant collected in Veraguas, Panama. The illustration of the flower is strikingly similar to the type specimen of this material and is clearly referable to this species. According to Dressler (pers. com.) this plant was identified by C. Dodson as P. mollis, however this is clearly a distinct species differing by the long cunate claw and triangular midlobe with entire margins. 172

195 Representative specimens: PANAMA. Veraguas, on the east ridge of Cerro Arizona, above Santa Fe de Veraguas, 30 Oct. 1977, Dressler 5734 (FLAS). 4. Psilochilus macrophyllus (Lindl.) Ames. Orchidaceae. 7: Pogonia macrophylla Lindl. Annals and Magazine of Natural History, ser. 3 1: Type: Cuba: in the east of Cuba, Wright 615 (holotype:k-l!, isotype: LE, PH). Description: Habit fleshy up to ca. 40cm. Stems purple, ascending from creeping rhizome, erect to 31cm. Leaves, sheathing, sessile clasping to short petiolate, blades ovate acute to occasionally weakly acuminate, 5-10cm x 2.5-7cm, green with or without whitish longitudinal stripes above and with or without purple below. Inflorescence erect, flowering in succession, one to several flowered, floral bracts broad, conduplicate, less then 1cm long. Flowers erect, produced in succession. Sepals greenish yellow or red, linear-oblong, acute-acuminate, dorsal sepal x 2mm, lateral sepals x 2mm. Petals linear falcate, x 2mm. Labellum (Fig 4.3.D), cunate, ca mm long with short claw, trilobed. Lateral lobes sharply acute to acute-obtuse, to 6 x 1-1.5mm, midlobe 4-6mm, suborbicular to subquadrate, crisp-erose, disk whitish with 2 longitudinal keels that extend to near the apex of the lip. Column, slender, nearly as long as the lip. Etymology- Greek, macro meaning large, and Latin folius or leaves, referring to the large leaves of the plants. Distribution: Central America, Mexico, Tropical South America and West Indies (Fig. 4.9). 173

196 Habitat: The species is found in a diverse range of habitats from m, typically a terrestrial of deep shade in leaf litter although occasionally found growing on rocks (i.e., Hamilton and Davidse 2625), tree falls, and as an epiphyte in Nicaragua (i.e., Rueda et al 15749, Heller 10463, and Heller 3756) and Saint Vincent (Judith and Judith 1951). In Nicaragua, Heller reported that he found #3756 a full 10 feet (ca. 3.3m) above ground attached to mossy branches, moreover he reported in a letter attached to the specimen he had never seen any plants in Nicaragua that were not epiphytes. Epiphytic habit is not common, however in rare cases when conditions are good, I have seen a closely related species, Monophyllorchis maculata, as an epiphyte on trees and tree trunks, along the river bank in the Rio Pastaza valley, Ecuador. There are few cases where habitat and known associates are discussed. In Puerto Rico, Ackerman (1995) reported that this species is found at m, in terrestrial habitat, among a dense leaf litter or in clay soils of wet montane forests. Fawcet and Randle (1910) reported that Psilochilus macrophyllus (as Pogonia) is a plant of moist shady habitats and can be seen in bloom year round. A Haitian specimen was collected in Eugenia jamnbos (Myrtaceae) woods, and in Guatemala it was found in Liquidambar Pinus forest. In both Bolivia and Nicaragua ( m) specimens were collected in cloud forest. Hawkins collected specimens in Belize in a tropical moist hardwood forest composed of limestone soils. Dressler (#1501) collected a specimen in Chiapas, Mexico with detailed information regarding associates and habitat. He reported that the plants were found in moist cloud scrub and pine forest (Pinus, Hauya, and Saurauia), with tall evergreen Quercus, Talamuma and Cymbopetalum. 174

197 Phenology and pollination: Late spring to fall (March to December in Trinidad). Ackerman (1995) reported self-pollination, with the occurrence of cleistogamy, and considerable seed set. Additionally he reported that the plants he observed lacked a rostellum, however upon examination of material from Puerto Rico, there is a clear and distinct rostellum on all material observed. It would be of interest to observe these plants in vivo to see if the high seed set was due to selfing or cross-pollination. Fawcett and Randle (1910) reported that flowers are found year round in Jamaica. Specimens examined: BELIZE. Cayo: 0.2km W of Baldy Beacon UTM , Catling and Brownell 55.1 (AMES). Toledo, Camp 3, SE Union camp, trail from camp 3 toward Cabro on the Jimmy cut trail, N W m, Hawkins 1463 (MO). BRAZIL. Municipo: Miguel Calmon near Jacobina in the north of Chapada Diamantinia ca 1,000m R. M. Alves s.n. (illustration In Orchids from Chapada Diamantina). BOLIVIA. Chochabamba, Cloud forest NE of Chochabamba towards Villas Tunari, alt. 950m, Luer et al (SEL). CUBA. Loma Gardero S. Maeitro, Roig et al (NY). Oriente: Sierra Nipe, near Woodfred, m, Shafer 3150 (AMES). Oriente: Vedado-Habana, Sierra Maestra, Loma del gato, Alain 366 (AMES). Oriente: Sierra Maestra Pico de la Bayamesa, N. Slope, Alt ft., Schultes et al. 605 (AMES). Crest of Sierra Maestra, Between Pico Turquino and La Bayamesa, alt. 1350m, Morton and Acuna 3526 (AMES). Crest of Sierra Maestra, Between Pico Turquino and La Bayamesa, alt. 1350m, Morton and Acuna 3526 (US). Slopes of La Bayamesa, crest of Sierra Maestra near Serradero San Antonio de los Cumbres, alt m, Morton 9226 (US). Southren Baracoa Region, Puerto del mate, Siera de Jamias, Leon (NY). Sierra Nipe, near woodfred, Oriente, Shafer 3150 (NY). COSTA RICA. La Palma 175

198 de San Ramon, Costa Rica, Alajuela 1113 (NY). Barring 86 (F). La Palma, alt. 1250, Brenes (116)480, (116)446, (244)1434 (AMES, F). La Palma de san Romón, Quirós (238)220 (AMES). DOMINICA. NNE Roseau: Forêt dense entre Providence Estate et Sylvania Estate 660m, Jérémie 1141 (A). Saint Paul, trail heading to Morne Trois Pitons Rainforest, Wasshausen and Ayensu 389 (US). DOMINICAN REPUBLIC. Las Abejas, wooded valley about 10 miles W of Aceitillar, Liogier (NY). Sobre la cima del Pico Igau, Prov. De Santiago, 960m, Jimenez 1240 (US). Arroyo Jiconie, District of San Jose de Las Matas, Prov. Santiago, 750m, Valeur 723 (K, NY, US). Sierra de Baoruco, Prov. Barahona: Loma Pie Pol [Pie de Palo en el mapa] de La Guasara de Barahona, N W, Zanoni et al (NY). MT. Drablotum Llyod 909 (NY). MT. Drablotum, Llyod 909 (K). Firme de Banilejo, Piedra Blanca, alt 800m, Liogier (NY). Arroyo del la Vieja, Loma la Vieja, An Juan, Prov. De Azusa, Ekmann H (AMES). Cordillera central, Prov. De Azusa, San Juan, Loma la Vieja, at Arroyo del la Vieja in forest c 900m, Ekmann H (AMES, US). Prope Constansa 1250m in sylvis umbrosis humidis, Turckheim 3134 (AMES, K, NY). Prov. Barahona at Paemingo in sylvis 1400m, Fuertes # IV,1912 (AMES, NY). EL SALVADOR. San Salvador, Cerro Montecristo, 2200m, Hamer 687 (SEL). GUADELOUPE. Rivere Noire, Anno 1093 (NY). Dugomier (Ténèbe) alt. 800m, Stehle 1304 (AMES, NY). Bains-Janis, 550m, Questel 426, 4140, 4979 (US). Bains Chauds du Matouba, 1050m, Stele 2571, 1381 (NY). Terrestrial, plants on moss, [ca ], Duss 3388 (NY). GUATAMALA. Dept. Alta Verapaz: Mountains along road Tactic and divide on road to Tamahú, alt m, Standly (F). Dept. San Marcos, above Finca el Porvenir, Up Loma Bandera Shac lower S-face slope of Mabess River, 2000ft, Nichols

199 (AMES). alt M, Steyermark (F). Dept. Huehuetenango: Cerro Victoria, Sierra de los Cuchamatanes near Baraillas, alt m, Steyermark (F). Dept. Huehuetenango: vicinity of Maxbal about 17 miles north of Barillas, Sierra de los Cuchumatanes, alt. 1500m Steyermark (AMES). HAITI. Gros Chevel, Morne des Commissaires, Holdridge 1951 (AMES). Rivere Glace, Elev. 2000, N W, Curtis 16 (AMES). Massif de la Hotte, Western group Pestel, Mount Delecour, Ekman 9000 (AMES, K, US) Gros Chevel, Morne des Commissaires, Holdridge 1951 (NY). Summit of Delcor, Eyerdam 348 (AMES, NY, US). JAMAICA. St. Andrew, Mt. Horeb peak, 4750ft., Podzorski JA12 (K).Mabess River below Vinegar hill, 3000ft., Underwood 1349 (NY). Morris, JP2090 (NY). Jamaica, Purdie sn. (K). Below Vinegar Hill, Botanical Departent 6462 (NY). Vinegar Hill, Harris 6252 (K). Ridge below Vinegar Hill, Harris (AMES, K, NY). Mabess River, 2000ft, Nichols 160 (K). Mabess River, 2000ft, Nichols 160 (AMES, NY). Jamaica, Morris XI 1885 (K). South eastern slopes of Stone Hole Bump, St. Thomas m, Maxon 9015 (NY, US). Upper southern slopes and summit of Maccasucker Bump, St. Thomas, alt , Maxon 9551 (US). MARTINIQUE. Camp Colson, Duss 4484 (NY). MEXICO. Chiapas: Municipo de Ocosingo, near Laguna Octoal Grande, ca km SE of Monte (Cerro) Libano (45km E of Ocosingo) elev. 950m Dressler 1501 (AMES). Chiapas: Finca el Suspiro,near Beriozabl, Dressler 2257 (US). MONTSERRAT. Upper W slopes Chances Mt., Adams M17 (A). NICARAGUA. Near top of Mombacho volcano, 1300m, Heller 3756 (SEL). Zelaya: Cerro La Pimienta number 1, Summit and area adjacent to summit, ca N84 59 W, elev m, Pipoly 5097 (MO). Madera Volcano, Ometepe Island, Rives Prov. 4500ft, Heller (SEL). Municipo de Wiwili, Reserva Cerro 177

200 Kilambe, N W m, Rueda et al (MO). Jinotega, Reserva Kilambe, Municipo Bocay, Reuda et al (MO). Jinotega, Reserva Kilambe, Municipo Bocay, Comunidad Santa Teresa de Kilmabre, N 85 39W, m, Reuda et al (MO). Zelaya: Cerro La Pimienta number 1, Summit and area adjacent to summit, ca N84 59 W, elev m, Pipoly 5097 (SEL). Granada: summit of extinct volcano Mombacho, Atwood et al (MO). Granada: summit of extinct volcano Mombacho, Atwood et al (AMES). Dpto. de Matagalpa: Macizos de Peñas Blancas, SE side drainage of Quebrada El Quebradon, Peak of WNW of Hda. San Martín, ca N W, elev m, Moreno and Elmquist (MO). Dpto. Nueva Segovia, Las Planes, Moreno (MO). PANAMA. Panama:Area surrounding Rancho Chorro, Mountians above Torti Arribam Canazas mountain chain, m, Folsom et al (MO). Coclé: Carribean side of El Cope, 8 45 N 80 35W, M, Hamilton and Davidse 2625 (MO). Cerro Colorado, Top, 1500m, Bocas Rd., Folsom and Collins 1774 (MO). PUERTO RICO. Indera Fria, near Maricao m, Britton et al (NY). Maricao to Monte Alegrillo, mountain forest 900m, Mt. Alegrillo Britton et al (NY). Maricao: Maricao forest preserve, W end of Las Teta de Cerro Gordo above Rd 120 elev. ca. 8390m, Rothacker and Ackerman ER02 (OS). Maricao Insular forest, on top of moderate shade, Horn 5909 (AMES). Prope Adjuntas, Urban 4246 (AMES, K). Prope Utuado, Urban 4479, 4474 (AMES, K). Maricao, Sargent 719 (US). Utuado, Bo. Caonillas Ariba, Cero Morales, Upper NW slopes near summit area, Axelrod and Baymann Urban (NY). SAINT VINCENT. Judith 178

201 and Judith 1951 (K). VENEZUELA. Edo. Trujillo: Municipo Bocono. Parque Nacional Guaramacal on road from Bocono to Guaramacal. SE of Guaramacal, N. slope of mountain, Dorr et al (MO). 5. Psilochilus modestus Barb. Rodr. Genera et Species Orchidearum Novarum 2: Pogonia modesta (Barb. Rodr.) Cogn. Flora Brasiliensis 3(4): Type: specimen has been lost or destroyed. Psilochilus maderoi (Schltr.) Schltr. Archivos de Botânica do São Paulo 1: Pogonia maderoi Schltr. Repertorium specierum novarum vegetabilis 7: Type: Colombia, Rio Vangolis on the highlands from Papayan m, Lehmann (Holotype: K!). If a specimen is lost, damaged or one had not been designated as a holotype for a species by the author, according to International Code of Botanical Nomenclature, a Neotype must be designated (Articles 9.6 and 9.16, Saint Louis Code 2000). Neotype remains to be chosen. For the purposes of identification the illustration of Rodrigues (1877, 1996) can be used. Description: Habit to 40cm tall; Leaves light green to purple, narrow 2-3.5cm wide and 5-8cm long, elliptic to oblong-lanceolate, acute or acuminate, tapering at base sheathing, short petiolate cm. Inflorescence with conduplicate, acute bracts. 179

202 Flowers erect 1-2 open per inflorescence. Sepals green keeled linear- lanceolate 20 x 3mm, acute, tapering at base, lateral sepals falcate, dorsal sepal 25 x 3mm, petals 17 x 3mm acute tapering at base, petals similar to sepals, pale green or whitish. Labellum 12 x 5-6mm, magenta in throat and streaked with magenta on lip, short clawed (ca. 5mm), trilobed with deep narrow sinus, lateral lobes triangular, 6 x 3mm, midlobe rounded, orbicular to suborbicular, 4 x 4mm lobe crisped to crenulate undulating, with two thin calli. Column broadly winged, strongly curved. (Fig. 4.3.C and 4.10.A-B). Etymology: Unknown. Distribution: Brazil, Colombia, Ecuador, Nicaragua, and Venezuela (Fig. 4.11). Pollination and blooming phenology: Pansarin (2000, also see Pridgeon et al. 2005), reported that while these plants are self-compatible, seed set in natural populations was low, indicating that self-fertilization was not a common mechanism of pollination, requiring a vector to transfer pollen from the anther to the stigmatic surface. This species is visited primarily by social and solitary pollen collecting bees (Plebeia droryana and Trigona spinipes). Psilochilus modestus provides pollen and nectar rewards. Nectar collecting bees, Melipona sp. and Halictid bees, were identified as pollinators. Psilochilus modestus (=P. maderoi) in Columbia was collected blooming in January Pansarin (2000) reported that this species has a blooming phenology similar to that of the rest of the tribe. Typically blooming 3-4 times per blooming period, flowers open for a day or so at most and like other members of the tribe it exhibits gregarious blooming (E. Pansarin pers com.). Reise et al. (2004) reported that P. modestus releases a floral fragrance 180

203 composed of aromatic compounds like benzyl alcohol and benzyl tiglate (46%), as well as lesser amounts of isoprenoids like 6-methyl-5-hepten-2-one (an irregular isoprenoid), geranyl acetone (oxygenated terpene), -cadinene, -ylangene (sesquiterpenes) and nerolidol (oxygenated sesquiterpene), 6-methyl-5-hepten-2-one, geranyl acetone and benzyl alcohol. Taxonomic notes: P. maderoi is known from a single collection in In Schlechter s description of the species from 1920, he differentiated P. maderoi from P. macrophyllus and P. modestus by the longer lippennagel which probably refers to the claw of the lip. The type of P. modestus as illustrated shows a rather short claw, probably an artifact of preparation, as the illustration of this species (Fig. 4.3.C) from Pansarin (2000) exhibits a longer claw. In principle the collection of P. maderoi agrees with P. modestus in all other aspects of vegetative morphology, with its longer narrow light green leaves. Given the variation observed in the specimens of P. modestus, and furthermore as there is no other diagnostic character that differentiates these collections, it was determined that P. maderoi and P. modestus were the same species. Habitat: (Fig. 4.10). In Costa Rica it was collected on a mossy hummock at 1350m, and in Ecuador in a pluvial premontane rainforest at 1690m. Specimens from Brazil are found in primary forest, from m, and in Colombia at m. Blooming time: December -March. 181

204 Notes regarding type specimen: It is unfortunate that no type specimen was designated for the epithet. Rodrigues was known to keep common gardens from which plant specimens were drawn and described, however collections, especially herbarium specimens are rare, of which many orchids described by B. Rodrigues are without herbarium collections (Rodrigues 1980). There is an illustration made to accompany the original description, but not published by the author in his lifetime. Cogniaux ( ) used the illustrations of Rodrigues (1882) for his treatment of the Orchidaceae in Flora brasiliensis (Rodrigues 1970). It was not until 1996, when Iconographie des orchidées du Brésil (Friedrich Reinhardt Verlag, Basle) was published as a two-volume set, which completed the work of B. Rodrigues by finally publishing all the text and accompanying illustrations together (Cribb et al. 1996). Speciemens examined: BRAZIL. Paraná, Tacarchy in siliva primaera ad terram sphagnosem reg. Lit, Dusen (AMES). Came from Brazil, Sanders and company sn (K). Sao Paulo, Angatuba, Fazenda do Servico Florestal Emmerich and Dressler (K, H). Serra do mar, Ypiranga in silvia primara ad terram, Dusen (AMES, K, MBG, NYBG). Rio de Janerio. Matto vacintiy of Macieriras, Mt. Itatiaya Estacao biologica. alt. 1960m S W, Smith 1770 (AMES). Sao Paluo, S. Fansicso dos Campos, Ex. Herv. Comm. Georg. E Geol. De S. S. P (NY). Paraná, Morro Sae Catira (mun. Quatro, Barrae). Paraná, Brejatuba, mun. Guaratuba, SILVA 5/2/1987 (MU). Paraná, Pontal do Poço, mun. Paranaguá, Hatschbach and Kummrow (MU, DB). Parana, Morro Sae Catira, mun. Cuatro Barra, Hatschbach (US). COSTA RICA. Cartago: Forested knoll just W of Quebrada Cas Blanca, Tapanti 9 47 N 83 48W 182

205 1350m, Grayum et al (MO). ECAUDOR. Parque Nacional Sumaco Napo-Galeras Cimbre de la Cordillera de Galeras, Bosque pluvial premontano S W, 1600m, 11 March 2003, Farfin 523 (MO). Waechst am Boden in sehr feuchten, dichten Waeldern um Chinguinta Lehmann 1303 (K). NICARAGUA. Granada Summit of extinct volcano Mombacho, Atwood et al (MO). 6. Psilochilus mollis Garay. Flora of Ecuador 9: Type: Ecuador, Morona-santiago, Río Chihuasi, 25 km SE of Logroño, Cordillera de Cutucú, Madison & Coleman 2564 (Holotype: SEL, photo!; Isotype:AMES!). Description: Habit up to 59 cm tall, stems green to purple, round. Leaves 8-9 x 3-5cm, narrowly ovate to ovate-lanceolate, acuminate, green above with or without white stripes to green or purple below, petiolate ( cm) encircling the stem. Inflorescence a terminal nodding raceme with floral bracts conduplicate, ovate-lanceolate. Sepals and petals light green, sepals sometimes suffused with purple; sepals keeled, x 2-3.5mm, linear to lanceolate, dorsal sepal x 2-3.5mm linear to lanceolate, weakly obtuse to acute, tapering at the base, lateral sepals wider than dorsal; Petals x 2-3.5mm, linear to lanceolate similar to sepals, weakly obtuse to acute. Labellum to 25 x 10mm with long cunate base, trilobed, white with two longitudinal purple stripes, with or without yellow in the throat with or without violet spots, two distinct calli diminishing toward the apex with a third smaller less distinct ridge obvious in some specimens; lateral 183

206 lobes falcate to triangular extending behind midlobe, blunt-rounded, medial lobe suborbicular to subquadrate, margins crenulate-erose. Column 12-20mm, bent with a distinct apical beak. (Fig. 4.12). Etymology: Latin mollis meaning soft or pliable; refers to the soft texture of the dried leaves when compared to the leaves of P. physurifolius. Distribution: Ecuador and Peru (Fig. 4.13). Habitat: Found in dense moist tropical montane rainforest to lowland topical rainforest, from ca. 1700m-2400m. Blooming phenology: Based on observations in the field and of specimens cultivated by Lou Jost and the author, it appears that this species blooms successively throughout the year, although there are apparent rest periods. All collections were made from October- March with a single specimen collected in flower in July. The plants do not go dormant, as in some species of the tribe (i.e. Triphora trianthophora and T. gentianoides), and at least superficially the phenology appears similar to that of P. modestus. A population was observed by L. Jost in the Tapachelach reserve in the Loja province of southern Ecuador; it was noted that some of the plants were triandrous and functionally selfing (Fig G-I) and others were outcrossing, monandrous plants (Fig.4.14.J). Both types of plants were growing in sympatry. Other differences observed were that the triandrous forms possessed smaller, 3-veined leaves with green and silver stripes above, green below, and the outcrossing individuals had larger, 5-veined, green leaves above and below. The flowers were similar in shape, size and color. 184

207 Discussion: This species was originally described by Garay (1978) to refer to all collections of this genus in Ecuador. There is a considerable amount of variation in size, leaf color and variegation among the collections of Psilochilus from Ecuador. LØjtnant (1977) referred at least some to P. physurifolius however Garay (1978) pointed out that this was incorrect. Psilochilus mollis differs from P. physurifolius in the proportions of the lip and the shape of the lateral lobes of the labellum. In P. mollis the lateral lobes are rounded and extend well into the midlobe in the former, while in P. physurifolius, the lateral lobes are acute and short (Fig. 4.3). Additionally they differ in the shape of the leaf. Psilochilus mollis has leaves that are narrowly ovate to ovate-lanceolate, short acuminate at the tip, and P. physurifolius has leaves that are elliptic to elliptic-lanceolate and long acuminate. It is unfortunate that the holotype specimen cannot be located, especially as the only flower on the isotype is in poor condition (i.e, lacking a complete labellum). Equally as disappointing is the illustration that accompanied the original description, however after looking over Garay s notes and other unpublished illustrations it is clear that he viewed P. mollis as variable in size and shape of the flower (Garay pers. com.). Of the paratypes discussed in the original publication, only a single collection had decent flowers for observation. Of the populations observed in the field there is considerable variation in flower color and size (Figs.12 and 14). A new collection will be needed from Peru to help to confirm the identity, as I only had the flower on which to base my decision. Specimens examined: ECUADOR: Zamora Chinchipe, forest along Cordillera del Condor near end of road to Los Encuentros m, Dalstrom 1901 (SEL). 185

208 Tungarahua, Rio Zunac near Rio Topo, 1400m, Jost LJ5902, LJ5903, LJ5904 (QCNE, OS). Tungarahua, Rio Zunac near Rio Topo, 1400m, Rothacker ER207. Cordillera Galaras, N. of Puyo, 1700m LJ5413. Cordillera Galaras, N. of Puyo, 1700m, Jost LJ5381. Loja, Podocarpus National Park, Tapachulaca Reserve Yangana-Valladoloid Rd. Jost LJ6852, LJ6853, LJ6913, LJ6914, LJ6914. PERU: Departamento Junin, Prov. Jauja, Astilleros, near Monobamba, alt. 2020m, S11 23'51", W75 18'54", 10/9/2001, Weigend et al Cusco, Sapan-sachayocc Vargas 2534 (NY photo of CUZ). CULTIVATED. specimen purchased from Ecuagenera, Cuenca, Ecuador, Rothacker ER220 (OS). 7. Psilochilus physurifolius (Rchb. f.) Løjtnant. Botaniska Notiser 130(2): Pogonia physuraefolia Rchb. f. Nederlandsch Kruidkundig Archief. Verslangen en Mededelingen der Nederlandsche Botanische Vereeniging 4: Type: Guyana, Schomurgk s.n. (K, photo!). Description: Habit to 40 cm tall. Leaves distinctly petiolate 0.5-1cm, sheathing, green with or without white/silver stripes above 5-8 (rarely 10) x (rarely 5)cm, elliptic to elliptic-lanceolate acuminate, leaf base rounded. Inflorescence erect or weakly nodding, short raceme with ovate acuminate bracts. Flowers one to few. Sepals green carinate, dorsal sepal 19-20mm x 3-3.4mm, lateral sepals falcate, x 3-3.2mm. Petals pale green/cream, similar to sepals, 18-19x 2-2.3mm. Labellum x 5mm, with long claw (8-9mm), lateral lobes short, acute, midlobe ca. 4 x 3mm, suborbicular to round, margins crisped with magenta/purple, possesses two distinct calli. (Fig.3.E-F). Etymology: refers to the Latin folius or leaves which look like Physurus. 186

209 Distribution: Guyana, Panama,Venezuela, Costa Rica, and Granada. (Fig. 4.15) Habitat: In Panama it was observed in premontane rainforest, while in Venezuela it was collected in Bamboo woods. Throughout most of its range it was collected along ridges or slopes from m. Phenology and Pollination: This species has been collected in bud or flowering from March October. At least two specimens determined are triandrous, and probably functionally autogamous. Taxonomic notes: Often confused with P. macrophyllus, the description of P. physurifolius by Reichenbach (1859) is barely sufficient to differentiate them, and left the shape of the labellum ( labellum ligulatum? ) in question. In Lindley s (1858) description of P. macrophyllus (as Pogonia macrophylla) he discussed a specimen in Schomburgk s collections which he stated was remarkably similar to the material for P. macrophylla but was in such bad condition it was not possible to identify; this being the same material which was the basis of the description of P. physurifolius by Reichenbach. The type specimen was triandrous and dorsally carinate as noted by Garay. Both are conditions similar to one illustrated of P. marcrophyllus by Ames (1922). The Ames illustration of a specimen from Granada also has a long claw and is distinctly petiolate, similar to that of P. physurifolius, and probably refers to this species. In the form of the lip, P. physurifolius is similar to P. macrophyllus, differing in the length of the claw. Løjtnant (1977), after observations of the type material for P. physurifolius, reported a series of vegetative characters that could be used to differentiate specimens of P. physurifolius from P. macrophyllus. He also included a single floral character, claw length of the labellum (long vs. short). Of the specimens examined, 187

210 Folsom 6115, Rothacker ER101 and Sheering all had flowers with long claws and floral morphology similar to the type. Other specimens were diagnosed based on the petiolate leaf morphology. From my observations, the characters of Løjtnant (1977) are good for differentiating P. physurifolius from P. macrophyllus. Psilochilus physurifolius has leaves that are all petiolate, whereas P. macrophyllus has mostly amplexicant or clasping leaves with some of the lower leaves occasionally short petiolate. These taxa are clearly closely related based on similarities in the shape and proportions of the labellum. Speciemens examined: COSTA RICA: Alajulea Upala, Biajaga el Pilón, Ladera Atlántica del Volcan Tenorio, cuencea alta del Rio Celeste N W m, Herrera 2144 (F). GRANADA: Azimar Mountian woods, Broadway Nov. 18, 1905 (AMES). location unknown, Sherring s.n. October May (K). PANAMA: Darien: Ridgetop area north of Cerro Pirre, between Cerro Pirre and Rancho Plastico m, Folsom et al (MO). Hills N of El Valle, E slope and ridges leading to Cerro Gaital 8 40 N W, Knapp 5778 (MO, SEL). Chiriquí, ca. 35km N- NW from San Felix summit of Cerro Colorado, Rothacker ER101p (OS, PMA). Chiriqui Fortuna Dam below road to STRI on Cable car trail, locally common 30 plants N, W m, Rothacker ER92p (OS, PMA). Chiriquí, Fortuna Dam top of mountain above camp to the south, 1700m, Folsom et al (MO). Cerro Colorado, border with of Chiriquí with Bocas del Toro along intersection of Bocas Rd. with main ridge road, 11.8km from Chami along path heading into Bocas del Toro m, Folsom 6115 (MO). Veraguas: trail up Cerro Tute to 1200m, Witherspoon et al (SEL). VENEZUELA: Merida, woods above Las Cuadras along Quebrada 188

211 Molino N of Torondoy alt. ca m., Steyermark (AMES). Merida, Trail between Las Cuadras and Timotes alt. ca m, Steyermark (NY). SPECIMENS EXAMINED WITH UNCERTAIN PLACEMENT 1. Dressler 6030 (MO): Panama, Colcé, Los Pedregales, SSW Rio Blanco del Norte (N of El. Copé, Caribbean slope. 22, Feb Terrestrial; sepals pale green, petals cream, bordered pink above; Lip white with purple margins center yellow. Dressler left this unnamed at the time of collection, and in 2000 again felt it was a unique plant, as yet unnamed. It is a plant with very large leaves (up to ca 14 x 6 cm), rather robust for the genus. It is unfortunate that the flower, which contained all the perianth parts, was either deformed/and or damaged. The labellum was clearly 20-22mm long with a very distinct midlobe. [However, another collection from this location is needed before a determination can be made.] 2. JOST 5414 (QCA). Ecuador, Napo, Cord. de Galaras. This appears to be a distinct species given the material I have, however no other collections have been found to corroborate this. It is similar to P. macrophyllus in the shape of the lip (Fig. 4.3.I) but is considerably larger, and in vegetative appearance it has leaves that are petiolate, with a leaf blade that is ovate to ovate-laceolate, acuminate at the tip, similar to P. mollis. It however differs from all other Psilochilus species in that 189

212 the lip is papillate, with the two calli appearing as a single raised space (Fig 4. 15). Further collections of this, and observations of it in vivo would help to determine if this form is stable. UNCERTAIN NAMES The name Psilochilus guatemalensis was discussed in Schlechter (1926b). In this publication he appears to reference a previous publication by use of his name after the species epithet, however upon examination of Schlechter s works there are no descriptions or illustration of the species, and no additional references were found. With the exception of the country name, from the information given in Schlechter (1926b) it cannot be determined what this name may refer to. In Guatemala this could refer to Psilochilus macrophyllus, but given the distributions of other taxa in Central America it is possible that this may refer to another species. At this time I believe this is not a valid name, and should be considered nomen nudem. 190

213 Figure 4.1: A generalized distribution map of Psilochilus. 191

214 Figure 4.2: Compound dissection light microscope images of Psilochilus macrophyllus seeds. 192

215 Figure

216 Figure 4.3: Species level variation in labellum morphology for Psilochilus. A. Psilochilus sp LJ7955 (P. ecuadoriensis ined.) B. Psilochilus mollis LJ5902. C. Psilochilus modestus (redrawn from illustration by Emerson R. Parinsin in Masters theisis.). D. Psilochilus macrophyllus ER02 from Puerto Rico. E. Psilochilus physuifiolis ER101 from Panama. F. Psilochilus physurifolius (Sherring ).G. Psilochilus carinatus redrawn from the type collection. H. Psilochilus dusenianus redrawn from type. I. Psilochilus sp. nov. LJ

217 A B C D E 10mm F G H I 194 Figure 4.3

218 Fig. 4.4: Distribution map of Psilochilus carinatus. 196

219 Fig. 4.5: Distribution map of Psilochilus dusenianus. 197

220 Fig Illustration of Psilochilus ecuadoriensis in ed. drawn from LJ7955. A. petals and labellum, B. characteristics of the column, C. Flower D. Habit. 198

221 Fig

222 Fig. 4.7: Psilochilus ecuadoriensis sp. nov. showing flower. (Photos credits:lou Jost.). 200

223 Fig. 4.8: Distribution map of Psilochilus ecuadoriensis. 201

224 Figure 4.9: Distribution map of Psilochilus macrophyllus. 202

225 Figure 4.10: Psilochilus modestus A. flower B. in habitat. (Photo credit. Emerson Pansarin) 203

226 A B Figure

227 Figure 4.11: Distribution map of Psilochilus modestus. 205

228 Figure 4.12: Variation in the labellum of Psilochilus mollis. Top row shows variation in populations collected from direction fron east to west, Baños to Puyo, Ecuador; second row are specimens collected arranged from north to south along the eastern slope, from Cordillera del Galaras to Cord. del Condor south to Junin, Peru. A. ER207, B. LJ5902, C. LJ5904 (A-C = Rio Topo); D. ER208 (N. Shell Mera), E. LJ5381, F. LJ5413, G. ER220 (cultivated specimen from Ecuagenera, Cuenca, Ecuador), H. SD1901 (Sel), I.Weigland et al. # 6853 (O , Junin, Peru). 206

229 A B C D 10mm 207 E F G H I Figure 4. 12

230 Figure 4.13: Distribution map of Psilochilus mollis. 208

231 Figure 4.14: Variation in the flower color observed in Psilochilus mollis. A LJ5902 B. LJ5904 C. LJ8258 (ER208) D. LJ5413 E. ER220 F. LJ5381. G-I. LJ6852 (from triandrous anther), J.LJ6913 and K. SD1901. (Photo credits: A-D and F-J courtesy of Lou Jost and E. taken by the author and K by Stig Dalstrom E. taken by the author). 209

232 A B C D Figure

233 Figure 4.14 Continued E F G H I Continued 211

234 Figure continued J K 212

235 Figure 4.15: Distribution of Psilochilus physurifolius. 213

236 5mm Figure 4.16: Illustration of Psilochilus LJ5414. Collected in Cord. Galaras, Ecuador. Show cross section of a labellum at junction with lateral lobes, illustrating the papillate surface. 214