L épidémiologie moléculaire en laboratoire de recherche en bactériologie : l exemple d Escherichia coli
|
|
- Christine Leonard
- 6 years ago
- Views:
Transcription
1 L épidémiologie moléculaire en laboratoire de recherche en bactériologie : l exemple d Escherichia coli Académie Nationale de Pharmacie Paris 15 Mars 2017
2 The various E. coli lifestyles Primary habitat E. coli cells Secondary habitat Digestive tract of vertebrates Among 500 species and bacteria Commensal Soil and sediments Saprophyte Pathogenic Intestinal (InPEC) Extra-intestinal (ExPEC)
3 Habitat primaire Tube digestif des vertébrés Habitat secondaire Eau et sédiments Homme : 10 8 E. coli / g de fèces Commensal, en fait plutôt mutualiste (protège de la colonisation species par les pathogènes, est dans un environnement nutritif, protégé) Pathogè ne Saprophyte The phylogenomics of the
4 A highly variable genome 4,200 to 5,400 genes Core genome: 1,900 genes < 50 % of the genome Pan genome: 18,000 non-orthologous genes Variable genome: Pan Core Touchon et al., PLoS Genet., 2009
5 Core and variable genomes are under distinct selective pressures Variable Core 9,054 strain specific genes deleterious or neutral = transient genes, purged rarely adaptive Touchon et al., PLoS Genet., 2009
6 The recombined fragments on the core genome with their short sizes do not blur the phylogenetic signal A1 A2 A3 A4 A5 B1 B2 B3 B4 C1 C2 C3 Hence, provided enough loci are studied, the topology of the phylogeny is recovered despite quite important recombination Tenaillon et al., Nature Rev Microbiol, 2010
7 E. coli sensu stricto E. albertii A B1 C E D. 13 genes, 9819 bp (Achtman and Pasteur Institute MLST schemes). 7 main phylogroups. Good proxy of the core genome tree F STc95 B2 Clade I E. fergusonii Clermont et al., Environ Microbiol Rep, 2013
8 O18:H7 Subgroup B O1:H1 O25b:H4 O2a:H7 O1:H7 Subgroup C O2a:H4 Subgroup E O1:H7 O2a:H7 Subgroup A Substructure within STc 95 (B2 phylogroup). 105 strains Core genome 35,137 SNPs. ML tree Rooted on ED1a strain O45a:H7 O1:H7 O2a:H4 O1:H7 Subgroup D Gordon et al., Submitted
9 The insertion/deletion events are localised in 133 hot spots 43 asnt trna leux trna
10 A modular organisation of the hot spots of integration: a molecular Lego 64 Strain specific module F Multiple combinations of genetic elements
11 Despite a very high gene flow, genes co-exist in organised genomes exhibiting a robust phylogeny despite numerous gene conversion events
12 Habitat primaire Tube digestif des vertébrés Habitat secondaire Eau et sédiments The molecular epidemiology of Homme : 10 8 E. coli / g de fèces Commensal, en fait plutôt mutualiste (protège de la colonisation par les pathogènes, est dans un environnement nutritif, protégé) Pathogè ne Saprophyte E. coli populations
13 Humans and animals exhibit different E. coli commensal strains % p=0.05 Animals Humans p=0.01 p=0.01 p=0.001 A B1 D B2 Phylogenetic groups 400 animals, 45 species 150 humans >2,500 strains One to 10 randomly selected colonies per subject Escobar-Paramo et al., Environ. Microbiol., 2006 Smati et al., MicrobiologyOpen, 2015
14 Human commensal E. coli populations are geographically structured Prevalence of commensal B2 phylogroup strains (One randomly selected colony per subject) Massot et al., RFL, 2016
15 Human commensal E. coli populations evolve as a function of decades 1980/2000 (n=5+10) 2010 (n=95) Paris area. Same selection of subjects. Same sampling and typing strategies. One randomly selected clone per subject Massot et al., Microbiology, 2016
16 Relative frequency of STc 95 subgroups An epidemic structure within the STc STc 95 strains collected from people living in the Canberra region, Australia Different from USA and France epidemiologies Gordon et al., Submitted
17 An association between the strain phylogeny, the presence of virulence genes and the lifestyle Severe diarrheas (STEC/EHEC, ETEC, Shigella) F F Extra-intestinal diseases Escobar-Paramo et al., Mol Biol Evol, 2004
18 Habitat primaire Habitat secondaire Tube digestif des vertébrés Homme : 10 8 E. coli / g de fèces Commensal, en fait plutôt mutualiste individual level (protège de la colonisation par les pathogènes, est dans un environnement nutritif, protégé) Pathogè ne Eau et sédiments Fine scale molecular Saprophyte epidemiology at the
19 Can we see signs of selection during an infectious process?. 19 patients with deep and closed extra-intestinal infections (UTI, deep abscess, pleurisy, meningitis, peritonitis). 5 to 20 colonies per sample (226 isolates). Genetic diversity (ERIC-PCR, PFGE, MLST, virulence genes). 11 patients were infected by a single clone exhibiting microheterogeneity Levert et al., PLoS Pathog, 2010
20 Cell density (O.D. 600nm) What could explain the within clone diversity? Heritable variations in growth characteristics Time (h) Patient 3, Liver abscess and blood (20 isolates) Levert et al., PLoS Pathog, 2010
21 Bacteria survival (%) Other phenotypic heterogeneities Isolates a b* c d* e* f* g h i* Use No use Exposure to H 2 O 2 (min) Metabolic capacity Biolog plates C sources Motility Resistance to stress H 2 O 2 Strains with impaired growth use fewer substrates, are less motile but more resistant to H 2 O 2.
22 Mouse survival (%) The intrinsic virulence of isolates from a single clone is highly variable , , , 47, Time (h)
23 SDS-PAGE 100 kda ph 4 27 proteins are differentially expressed within the isolates of a single clone Isoelectrofocalisation SecA IleS KatE GyrB SucA Lon ph 7 OmpC ND TolC LamB NmpC RbsK Acs CpsGGadA OmpA AnsB HyaB PoxB RbsA GlmM Cca TdcB TalA FbaB. Central metabolism, membrane, stress associated proteins. Half known as regulated by RpoS RbsB 20 kda WrbA Levert et al., PLoS Pathog, 2010
24 Convergence in inactivating mutations in rpos: a strong sign of selection. Intra-patient and inter-patient convergence in rpos. RpoS, one of the 7 E. coli sigma factors - Regulates a large regulon ( ~ 10% of E. coli genome) - Involved in stationary phase and many stress conditions Different levels of RpoS explain most part of the heterogeneity observed within the patient isolates
25 Habitat primaire Tube digestif des vertébrés Habitat secondaire Eau et sédiments Homme : 10 8 E. coli / g de fèces Commensal, en fait plutôt mutualiste (protège de la colonisation par les pathogènes, est dans un environnement nutritif, protégé) Pathogè ne Saprophyte Take home messages
26 . E. coli is a species with a dynamic genome but a clonal structure of population.. There is an association between the phylogenetic background, the presence of specific traits and the lyfestyle of the strain, indicating epistasis.. There are signs of selection with diversification in vivo during the extra-intestinal infectious process.. The new technologies of sequencing help to decipher the adaptability of E. coli.
27 Mathilde Lescat Maxime Levert Adrien Launay Mounira Smati Tony Le Gall Méril Massot Médéric Diard Ivan Matic Marie Touchon Eduardo Rocha David Gordon University of Sydney Tom Ferenci Patricia Escobar-Paramo Olivier Clermont Bertrand Picard Olivier Tenaillon Pierre Darlu Sören Schubert James Johnson
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationA genomic insight into evolution and virulence of Corynebacterium diphtheriae
A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8
More informationDynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationA phylogenomic analysis of Escherichia coli / Shigella group: implications of genomic features associated with pathogenicity and ecological adaptation
Zhang and Lin BMC Evolutionary Biology 2012, 12:174 RESEARCH ARTICLE Open Access A phylogenomic analysis of Escherichia coli / Shigella group: implications of genomic features associated with pathogenicity
More informationChapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
More informationExploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University
Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationName: SAMPLE EOC PROBLEMS
Name: SAMPLE EOC PROBLEMS 1.Bromothymol blue (BTB) is a ph indicator that is also used to detect carbon dioxide (CO2). BTB is blue when ph is basic and CO2 is low. BTB is yellow when ph is acidic and CO2
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationIntroduction to the SNP/ND concept - Phylogeny on WGS data
Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny
More information9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success
5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes
More informationNatural Genetic Resistance to Infection
Natural Genetic Resistance to Infection The Discovery of Natural Determinants of Susceptibility to Infection in Cattle, especially Tarentaise Steve A Carlson, DVM PhD Tim A Day, PhD PSR Genetics, LLC Scott
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationChapter 7: Covalent Structure of Proteins. Voet & Voet: Pages ,
Chapter 7: Covalent Structure of Proteins Voet & Voet: Pages 163-164, 185-194 Slide 1 Structure & Function Function is best understood in terms of structure Four levels of structure that apply to proteins
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationPerplexing Observations. Today: Thinking About Darwinian Evolution. We owe much of our understanding of EVOLUTION to CHARLES DARWIN.
Today: Thinking About Darwinian Evolution Part 1: Darwin s Theory Perplexing Observations Mystery of the Black Death?? What is evolution?? And what is this finch doing?!? We owe much of our understanding
More informationChapter 5 Evolution of Biodiversity. Sunday, October 1, 17
Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationOutline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?
Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative
More informationAlternative tools for phylogeny. Identification of unique core sequences
Alternative tools for phylogeny Identification of unique core sequences Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture you should be able to account
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationDiversity and Evolution of Secondary Metabolite Genes in the Marine Actinomycete Salinispora. Nadine Ziemert
Diversity and Evolution of Secondary Metabolite Genes in the Marine Actinomycete Salinispora Nadine Ziemert Natural Products as Drugs Ecological Functions Fundamental units with which microbes sense and
More informationno.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationRise and Fall of Mutator Bacteria
Rise and Fall of Mutator Bacteria The Evolution of Mutation Rates in Bacteria Yoav Ram Hadany Evolutionary Theory Lab 29 May 2011 Bacteria Bacteria are unicellular, haploid and asexual Reproduce by binary
More informationCalifornia Subject Examinations for Teachers
California Subject Examinations for Teachers TEST GUIDE SCIENCE SUBTEST II: LIFE SCIENCES Subtest Description This document contains the Life Sciences subject matter requirements arranged according to
More information6 th Grade Life Science Strand 3: Characteristics and Interactions of Living Organisms
Middle School Life Science Standards There are 15 standards that encompass the proposed middle school life science standards. The new standards are listed 4 times to match the four times life science is
More informationFINAL VERSION_ Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea
Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea LS1: From Molecules to Organisms: Structures and Processes LS1.A: Structure and Function How do the structures
More informationFIG S1: Plot of rarefaction curves for Borrelia garinii Clp A allelic richness for questing Ixodes
FIG S1: Plot of rarefaction curves for Borrelia garinii Clp A allelic richness for questing Ixodes ricinus sampled in continental Europe, England, Scotland and grey squirrels (Sciurus carolinensis) from
More informationIntroduction to Biology with Lab
Introduction to Biology with Lab Course Text/Materials Mader, Sylvia S. Inquiry into Life, 12th edition, McGraw-Hill, 2008, ISBN: 9780073309330 [find and buy the text: Straighterline.com/textbooks] Custom
More informationSex and virulence in Escherichia coli: an evolutionary perspective
Blackwell Publishing LtdOxford, UKMMIMolecular Microbiology0950-382X; Journal compilation 2006 Blackwell Publishing Ltd? 2006?? Original ArticleSex and virulencet. Wirth et al. Molecular Microbiology (2006)
More information8. Population genetics of prokaryotes
8. Population genetics of prokaryotes Henrik Christensen, Department of Veterinary Disease Biology Faculty of Health Sciences, Copenhagen University hech@life.ku.dk 21-1-13 8.1. Prokaryotic populations.
More informationComparison of 61 E. coli genomes
Comparison of 61 E. coli genomes Center for Biological Sequence Analysis Department of Systems Biology Dave Ussery! DTU course 27105 - Comparative Genomics Oksana s 61 E. coli genomes paper! Monday, 23
More informationAntibiotic Resistance in Escherichia coli Iron Transport Mutants
Bowling Green State University ScholarWorks@BGSU Honors Projects Honors College Fall 12-11-2017 Antibiotic Resistance in Escherichia coli Iron Transport Mutants Madeline Brandt mbrandt@bgsu.edu Follow
More informationPhylogenetics in the Age of Genomics: Prospects and Challenges
Phylogenetics in the Age of Genomics: Prospects and Challenges Antonis Rokas Department of Biological Sciences, Vanderbilt University http://as.vanderbilt.edu/rokaslab http://pubmed2wordle.appspot.com/
More informationEvolution and pathogenicity in the deadly chytrid pathogen of amphibians. Erica Bree Rosenblum UC Berkeley
Evolution and pathogenicity in the deadly chytrid pathogen of amphibians Erica Bree Rosenblum UC Berkeley Emerging infectious disease Emerging infectious disease EID events have risen significantly over
More informationHow the host sees and responds to pathogens
How the host sees and responds to pathogens David A. Relman, Stanford University IOM Forum on Microbial Threats March 17, 2005 Issues Pathogens and commensals: conserved patterns and pathways Sources of
More informationMicrobial analysis with STAMP
Microbial analysis with STAMP Conor Meehan cmeehan@itg.be A quick aside on who I am Tangents already! Who I am A postdoc at the Institute of Tropical Medicine in Antwerp, Belgium Mycobacteria evolution
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationGenetically Engineering Yeast to Understand Molecular Modes of Speciation
Genetically Engineering Yeast to Understand Molecular Modes of Speciation Mark Umbarger Biophysics 242 May 6, 2004 Abstract: An understanding of the molecular mechanisms of speciation (reproductive isolation)
More informationWhole genome sequencing (WGS) as a tool for monitoring purposes. Henrik Hasman DTU - Food
Whole genome sequencing (WGS) as a tool for monitoring purposes Henrik Hasman DTU - Food The Challenge Is to: Continue to increase the power of surveillance and diagnostic using molecular tools Develop
More informationSupplementary Figures.
Supplementary Figures. Supplementary Figure 1 The extended compartment model. Sub-compartment C (blue) and 1-C (yellow) represent the fractions of allele carriers and non-carriers in the focal patch, respectively,
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationAssociative and Endophytic Nitrogen-fixing Bacteria and Cyanobacterial Associations
Associative and Endophytic Nitrogen-fixing Bacteria and Cyanobacterial Associations Edited by Claudine Elmerich Institut Pasteur, Paris, France and William E. Newton Department of Biochemistry Virginia
More informationEvolution of Populations. Populations evolve. Changes in populations. Natural selection acts on individuals differential survival. Populations evolve
Evolution of Populations Doonesbury - Sunday February 8, 2004 Populations evolve Natural selection acts on individuals differential survival differential reproductive success survival of the fittest who
More informationText of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
More informationInheritance part 1 AnswerIT
Inheritance part 1 AnswerIT 1. What is a gamete? A cell with half the number of chromosomes of the parent cell. 2. Name the male and female gametes in a) a human b) a daisy plant a) Male = sperm Female
More informationTHE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18
THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE Introduction: The identification of bacteria is important in order for us to differentiate one microorganism
More information4. Identify one bird that would most likely compete for food with the large tree finch. Support your answer. [1]
Name: Topic 5B 1. A hawk has a genetic trait that gives it much better eyesight than other hawks of the same species in the same area. Explain how this could lead to evolutionary change within this species
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationNGSS UNIT OVERVIEW EVOLUTION
UNIT SPECIFIC RESOURCES TEACHER RESOURCES IV NGSS UNIT OVERVIEW EVOLUTION Performance Expectation MS-LS4-1: Analyze interpret data for patterns in the fossil record that document the existence, diversity,
More informationUsing Evolutionary Approaches To Study Biological Pathways. Pathways Have Evolved
Pathways Have Evolved Using Evolutionary Approaches To Study Biological Pathways Orkun S. Soyer The Microsoft Research - University of Trento Centre for Computational and Systems Biology Protein-protein
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationIntroduction to polyphasic taxonomy
Introduction to polyphasic taxonomy Peter Vandamme EUROBILOFILMS - Third European Congress on Microbial Biofilms Ghent, Belgium, 9-12 September 2013 http://www.lm.ugent.be/ Content The observation of diversity:
More informationMicrobiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
More informationChapter 6 Population and Community Ecology. Thursday, October 19, 17
Chapter 6 Population and Community Ecology Module 18 The Abundance and Distribution of After reading this module you should be able to explain how nature exists at several levels of complexity. discuss
More informationStudying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life
Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationChapter 8. Biogeographic Processes. Upon completion of this chapter the student will be able to:
Chapter 8 Biogeographic Processes Chapter Objectives Upon completion of this chapter the student will be able to: 1. Define the terms ecosystem, habitat, ecological niche, and community. 2. Outline how
More informationKingdom Monera Bacteria
Kingdom Monera Bacteria Common bacteria Prokaryotes Strep throat Anthrax Chlamydia E. coli Meningitis Salmonella Micrococcus(intestinal) Streptococcus mutans Haemophilusinfluenzae Cellphonious bacterious
More informationAround the dynamics of bacterial genomes
Around the dynamics of bacterial genomes Eduardo P. C. Rocha erocha@pasteur.fr Unité Génétique des Génomes Bactériens, CNRS URA2171,Institut Pasteur Atelier de BioInformatique, Université Pierre et Marie
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationInterpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually
More informationEvolution 1 Star. 6. The different tools used during the beaks of finches lab represented. A. feeding adaptations in finches
Name: Date: 1. ccording to modern evolutionary theory, genes responsible for new traits that help a species survive in a particular environment will usually. not change in frequency. decrease gradually
More informationDr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
More informationLife Science FROM MOLECULES TO ORGANISMS: STRUCTURES AND PROCESSES
FROM MOLECULES TO ORGANISMS: STRUCTURES AND PROCESSES HS-LS1-1 Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential
More informationGENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF EVOLUTION Evolution is a process through which variation in individuals makes it more likely for them to survive and reproduce There are principles to the theory
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationHorizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
More informationVariation of Traits. genetic variation: the measure of the differences among individuals within a population
Genetic variability is the measure of the differences among individuals within a population. Because some traits are more suited to certain environments, creating particular niches and fits, we know that
More informationUNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology
UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance
More informationRisk Assessment of Staphylococcus aureus and Clostridium perfringens in ready to eat Egg Products
Risk Assessment of Staphylococcus aureus and Clostridium perfringens in ready to eat Egg Products Introduction Egg products refer to products made by adding other types of food or food additives to eggs
More informationThe following pages outline the major elements of the course and when you can expect each to be covered. Assessment
A level biology The course we offer at Robert Smyth Academy is OCR Biology A which a two year linear course. Details of the course can be found at http://www.ocr.org.uk/qualifications/as-a-levelgce-biology-a-h020-h420-from-2015/
More informationB. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae.
Microbiology - Problem Drill 09 - The Prokaryotes No. 1 of 10 1. Bacillus anthraces is most closely associated with which of the following? (A) Botulism poisoning (B) Anthrax (C) Gangrene (D) Diphtheria
More informationWheat Genetics and Molecular Genetics: Past and Future. Graham Moore
Wheat Genetics and Molecular Genetics: Past and Future Graham Moore 1960s onwards Wheat traits genetically dissected Chromosome pairing and exchange (Ph1) Height (Rht) Vernalisation (Vrn1) Photoperiodism
More informationApproved Courses for General Science students with Major/Minors in Biological Sciences
Approved Courses for General Science students with Major/Minors in Biological Sciences List C: Physiology, cell and developmental biology BIOIN 301 Bioinformatics. * (fi 6) (first term, 3-0-0). Introduction
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More informationThe Evolution of Infectious Disease
The Evolution of Infectious Disease Why are some bacteria pathogenic to humans while other (closely-related) bacteria are not? This question can be approached from two directions: 1.From the point of view
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationGuided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms
Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was
More informationTheory a well supported testable explanation of phenomenon occurring in the natural world.
Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common
More information# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp
Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus
More informationEVOLUTIONARY BRANCHING VIA REPLICATOR-MUTATOR EQUATIONS
Monday, July 23rd, 14:20 EVOLUTIONARY BRANCHING VIA REPLICATOR-MUTATOR EQUATIONS Mario E. Veruete mario.veruete@umontpellier.fr Institut Montpéllierain Alexander Grothendieck, CNRS, Université de Montpellier
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationChapter 27: Evolutionary Genetics
Chapter 27: Evolutionary Genetics Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand what the term species means to biology. 2. Recognize the various patterns
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More information