Regulation of Wingless Secretion, Distribution and Signaling

Transcription

1

2 Regulation of Wingless Secretion, Distribution and Signaling A dissertation submitted to the Division of Research and Advanced Studies of the University of Cincinnati in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (Ph.D.) in the Molecular and Developmental Biology Graduate Program of the College of Medicine 2012 by Xiaofang Tang B.S., Tsinghua University, 2006 Members of the Committee Include: Xinhua Lin, Ph.D., Chair Kenneth Campbell, Ph.D. Tiffany Cook, Ph.D. Brain Gebelein, Ph.D. John Monaco, Ph.D.

3 ABSTRACT The evolutionarily conserved Wnt (Wingless and INT-1) family proteins are secreted cysteinerich glycoproteins essential for embryonic patterning and adult homeostasis. Wnt signaling is highly regulated in all aspects, including the biogenesis and processing of active Wnt ligands, Wnt secretion and gradient formation on the cell surface and in the extracellular matrix, and perception and signal transduction within the signal-receiving cells. Dysregulation of Wnt signaling underlies many human diseases, in particular, cancers. To gain deeper insights into Wnt signaling, I used Drosophila as a model system and focused on the best studied Drosophila Wnt homolog, Wingless (Wg). My studies have shed light on three aspects of the regulation of Wg/Wnt signaling. First, I systematically analyzed the roles of two major post-translational modifications of Wg. By using multiple in vitro and in vivo systems, my work provides solid and thorough data toward the question how lipid modification and N- glycosylation contribute to Wingless secretion and signaling. Furthermore, I investigated the process of Wntless (Wls) trafficking and its role in Wingless secretion. I found that Wls undergoes ubiquitination on the cell surface. Importantly, from a genetic RNAi screen, I identified two essential components in the control of Wls ubiquitiation, the E3 ligase Su(dx) and the deubiquitinating enzyme USP8. My work suggests that Wls ubiquitination is involved in the trafficking of Wls and the sorting of Wg following Wls endocytosis. Finally, I identified a novel component essential in the signal transduction of canonical Wg/Wnt signalling, the hyperplastic discs (hyd). Further epistasis analysis indicates that hyd acts in parallel with or downstream of Armadillo (Arm) to regulate nuclear Arm activity. Taken together, this dissertation work will help us to better understand the orchestrated regulation of Wg/Wnt pathway at multiple levels. ii

4 iii

5 ACKNOWLEDGEMENTS I would like to give a heartfelt thanks to Dr. Xinhua Lin for his exceptional mentorship, guidance and support during my graduate studies. Lin not only helped me to acquire the basic knowledge and fundamental experimental skills in the fields of biological sciences, but more importantly, he guided me step by step the way to think about science and to do research. I am very grateful for his leadership by example as he continuously demonstrates his genuine enthusiasm and excellent qualities as a scientist and researcher. I would like to acknowledge my colleagues in Lin lab in CCHMC, including the current members, Lorraine Ray, Tanya Belenkaya, Jia You and previous members, Yihui Wu, Dong Yan, Bo Zhou, Ying Ye, Ying Feng, Yongfei Yang, Feifei Zhang and Hongzhu Liu. I would also like to thank the students in Lin lab in China including Guolun Wang, Qinzhu Huang and Xiaolan Fan. It has been a great pleasure and rewarding experience to work with them. I am truly grateful to my committee members Dr. Kenneth Campbell, Dr. Tiffany Cook, Dr. Brian Gebelein, Dr. John Monaco, and the former members Dr. Iain Cartwright and Dr. Wallace Ip for their valuable discussions and constructive suggestions on my projects and on this manuscript. Especially, I want to thank Dr. Brain Gebelein for his kind mentoring during my rotation and for his continuous support in the last years. I would like to thank many MDB students, staff and faculty members for their friendship and their efforts to create a supportive and cooperative scientific environment, which is essential for my professional development. I am also thankful to the fly community for sharing reagents. iv

6 Finally, my deepest gratitude goes to my families who, as always, have given me unflagging love and unreserved support throughout my life. In particular, I would like to thank my wonderful husband Qinghang Meng for his support, encouragement, help and love at every stage of my PhD studies. I would also like to thank my son, Ethan Fanchen Meng, who is the origin of my motivation and happiness. I dedicate this thesis to Qinghang and Ethan with all my love. v

7 TABLE OF CONTENTS TITLE PAGE ABASTRACT ACKNOWLEDGEMENTS TABLE OF COTENTS LIST OF FIGUES AND TABLES LIST OF SYMBOLS CHAPTER I Introduction Wnt as a morphogen in development Post-translational modifications of Wnts Wls and the retromer complex in the secretion of Wnts Lipoproteins and HSPGs in the diffusion and gradient formation of Wnts Reception of Wnt signals Wnt secretion and signaling in human diseases References Figures i ii iv CHAPTER II Roles of N-glycosylation and lipidation in Wingless secretion and signaling Abstract Introduction Materials and Methods Results 1. N-glycosylation is dispensable for Wg signaling and secretion 2. S239, but not C93, is required for Wg signaling 3. WgS239A has reduced affinity for Frizzled 2 receptor

8 4. Removal of double lipidation abolishes Wls-dependent Wg secretion Discussion Acknowledgements References Figures CHAPTER III Role(s) of ubiquitination and deubiquitination in Wls-dependent Wingless secretion Abstract Introduction Materials and Methods Results 1. Wls undergoes ubiquitination on the cell surface 2. Ubiquitination of Wls regulates the release and transport of Wg 3. Identification of E3 ligase and deubiquitinase for Wls by an RNAi screen Su(dx) and USP8 regulates ubiquitination and deubiquitination of Wls respectively 5. Su(dx) regulates the release of Wg Discussion Acknowledgements References Figures CHAPTER IV Role(s) of hyd in the nuclear signaling of Wingless Abstract Introduction

9 Materials and Methods 120 Results 1. Identification of hyd as a novel component required for Wg signaling 2. Hyd functions differentially in Wg signaling in various developmental contexts 3. Hyd acts downstream of or in parallel with Arm to regulate nuclear Arm activity 4. Effects of hyd in Wg signaling in wing disc cells depend on its E3 ligase activity 5. Identification of the interacting partner of hyd involved in Wg signaling Discussion Acknowledgements References Figures CHAPTER V Conclusions and Perspectives References

10 LIST OF FIGURES AND TABLES Chapter I Figure 1. Reciprocal signaling between Wg- and Hh-producing cells during Drosophila embryogenesis. Figure 2. Drosophila wing disc and the fate map. Figure 3. Schematic overview of mouse Wnt3a and Drosophila Wingless proteins. Figure 4. Models of Wnt secretion and distribution. Figure 5. Model of canonical Wnt signaing. Chapter II Figure 1. Signaling activities of wild-type and mutated Wg in cultured S2 cells and embryos. Figure 2. Signaling activities of wild-type and mutated Wg in the wing imaginal discs. Figure 3. WgS239A is secreted by S2 cells and the wing disc cells Figure 4. The weaker binding of WgS239A with dfz2 receptor. Figure 5. Removal of double lipidation abolishes Wg signaling activity. Figure 6. WgCS is retained in the producing cells. Figure 7. Lipidation promotes the interaction of Wg with Wls. Sup. Figure 1. Diagram of plasmid construction and the post-translational modification of Wg variants Sup. Figure 2. The HA tag in combination with the removal of lipidation at C93 abolishes the signaling activities of Wg 9

11 Sup. Figure 3. Wg mutant cuticle phenotype rescued by expression of Wg variants driven by wg Gal4 Chapter III Figure 1. Wls is ubiquitinated on the cell surface. Figure 2. Wls ubiquitination is important for efficient Wg secretion in S2 cells. Figure 3. Wls ubiquitination is important for Wg secretion and signaling in the Drosophila wing. Figure 4. Wls regulates Wg trafficking following endocytosis. Figure 5. Identification of Su(dx) and USP8 in the control of Wls levels in an RNAi screen. Figure 6. Su(dx) and USP8 are the E3 ligase and deubiquitinating enzyme for Wls respectively. Figure 7. Su(dx) regulates Wg secretion in both S2 cells and the Drosophila wing. Figure 8. Model of Wls trafficking and Wg secretion. Sup. Figure 1. WglacZ reporter levels are not altered upon Su(dx) over-expression or RNAi. Chapter IV Figure 1. hyd is required for Wg signaling in the Drosophila wing disc. Figure 2. hyd is not a universal transcription factor in the wing disc. Figure 3. hyd is not absolutely required for Wg signaling in patterning the embryonic cuticles. Figure 4. Staining of hyd antibody in the wing disc. Figure 5. hyd acts downstream of or in parallel with Arm to regulate Arm activity. Figure 6. E3-dependent function of hyd in Wg signaling in the wing disc. Table 1. List of hyd associated factors identified using mass spectrometry. Sup. Figure 1. The schematic diagram of UBR5 cdna assembly from ESTs and Exons. 10

12 LIST OF SYMBOLS Ap Arm Arr Edd Dally Dll Dlp Dpp Dvl ECM En ER Fz Apterous Armadillo Arrow E3 ligase identified by differential display Division abnormally delayed Distalless Dally-like Decapentaplegic Disheveled extracellular matrix Engrailed endoplasmic reticulum Frizzled Fz2 Frizzled 2 GAG Hh HSPG Hyd Lgs LPP Porc Pygo RNAi glycosaminoglycan hedgehog heparan sulfate proteoglycan hyperplastic discs legless lipoprotein particle porcupine pygopus RNA interference 11

13 Sens Su(dx) TGN Vg Wg Wls Wnt Senseless suppressor of deltex trans-golgi network Vestigial Wingless Wntless Wingless and INT-1 A P D V Anterior Posterior Dorsal Ventral 12

14 CHAPTER I INTRODUCTION 13

15 One of the best studied morphogen families is Wnt. Wnt proteins are members of a highly conserved family of secreted cysteine-rich glycoproteins that play a central role in development and disease. In the past three decades, intensive studies have been conducted to elucidate how Wnt molecules are produced, secreted, transported and received in target cells to trigger signaling events. Many Wnt pathway components have been discovered and the Wnt-induced signal-transduction cascades have been well studied. Recently, more attention has been drawn to the process of Wnt maturation, sorting and secretion. Especially in the past decade, many important advances have been made, including the characterization of Wnt post-translational modifications, the involvement of LPPs (lipoprotein particles) in Wnt trafficking and the discovery of Wls and the retromer complex in Wnt secretion. The recent advances in Wnt research have added extra levels of complexity and have posed outstanding questions to be answered in the Wnt field. Wnt as a morphogen in development During the development of multi-cellular organisms, many of the cell-to-cell communication processes are mediated by morphogens which are diffusible signaling molecules that provide cells in the morphogenetic field with positional information and trigger cellular responses in a concentration-dependent manner. Wnt has been recognized as one of the best known morphogens in development. The first Wnt gene, mouse Wnt1 (originally named Int-1) was discovered in 1982 as a gene activated in mouse mammary tumour virus (MMTV)-induced breast tumors (Nusse and Varmus, 1982). The best characterized Wnt gene, Drosophila Wg, was originally identified as a recessive mutation affecting wing and haltere development (Sharma and Chopra, 1976) and later was found to function as a segment polarity gene involved in embryonic patterning (Nusslein-Volhard and Wieschaus, 1980). It was not until 1987 that Wg was shown to 14

16 be a homolog of Wnt1 based on the similarity of amino-acid sequence (Rijsewijk et al., 1987). Since the discovery of the first Wnt gene, researchers have identified Wnt homologs in all multicellular organisms studied, for example, most mammalian genomes including mouse and human harbor 19 Wnt genes, Xenopus has 16 Wnt genes, Drosophila has 7 and C. elegans has 5. Even sponges have a few Wnt genes while single-cell organisms have none, suggesting the profound importance of Wnt signaling during the evolution of multicellular animals (Petersen and Reddien, 2009). A lot of insights into the mechanisms of Wnt actions have emerged from the studies with the founding Wnt member, Drosophila Wg, which has been implicated in a variety of developmental processes, including epidermis patterning, tracheal morphogenesis, neuroblast determination and differentiation, maintenance of intestinal stem cells and follicle stem cells and patterning of imaginal discs (Lin et al., 2008; Siegfried and Perrimon, 1994; Song and Xie, 2003; Wodarz and Nusse, 1998). The role of Wg as a short-range inducer and long-range morphogen is particularly well explored in the patterning of embryonic ventral epidermis and larval wing imaginal discs. At early embryogenesis (stage 9-10), Wg is expressed in the posterior row of cells at each parasegment of the ectodermal epithelial sheet (Fig. 1). Wg is secreted and acts on two rows of posterior neighboring cells which express another signaling molecule Hedgehog (Hh). The function of Wg at short range helps maintain the expression of Hh and Hh in turn acts on Wgexpressing cells to enhance Wg transcription (Sanson, 2001) (Fig. 1). The reciprocal signaling between Wg and Hh establishes the boundary between each parasegment. Later at stage 12, Wg forms a concentration gradient anterior to its expressing cells due to its active degradation in Hhexpressing cells (Dubois et al., 2001) (Fig. 1). The long-range Wg morphogen then gives 15

17 positional information to the anterior cells to produce the protein Naked cuticle (Sanson, 2001; Sanson et al., 1999). The larval wing imaginal disc is the tissue most commonly used to study the function of Wg as a morphogen (Strigini and Cohen, 1999; Vincent and Briscoe, 2001; Zecca et al., 1996). A wing imaginal disc is a two-sided sac-like structure composed of a columnar epithelial layer and an overlying squamous epithelial layer (Fig. 2). The former represents the disc proper and differentiates later into wing, hinge and notum while the latter is often referred to as the peripodial membrane and contributes to the integument cuticle. In the wing imaginal disc, Wg expression is induced in a narrow strip of cells at the dorsal-ventral (DV) compartment boundary (Fig. 2). From its site of synthesis, Wg spreads symmetrically and forms a long-range extracellular gradient. As a morphogen, Wg activates target gene expression in a dose-dependent manner: close to the Wg source, high-level target genes such as senseless (sens), achaete, and neuralized are induced; in a broader range up to 20 cell diameters, the distalless (dll) gene is expressed; in most of the prospective wing, the low-level target gene, vestigial (vg) is expressed. In this thesis work, I focused on the regulation of Wg pathway in Drosophila and studied its signaling activities in embryonic cuticle patterning and wing development. Post-translational modifications of Wnts As a common structural characteristic, Wnts contain several charged residues and a relatively high number of conserved cysteines (23-25 on average) which might be involved in the establishment of intra- and inter- molecular disulfide bonds and thus be important for the proper folding and multimerization of Wnt proteins (Coudreuse and Korswagen, 2007; Miller, 2002) (Fig. 3). In contrast to predictions made based on their primary amino-acid sequences, Wnt 16

18 proteins are more hydrophobic and insoluble. These characteristics have long hampered the isolation of active Wnts. The first successful attempt in Wnt purification was made by the Nusse group in 2003 (Willert et al., 2003). From their work, they isolated active products of mouse Wnt3a and Drosophila Wnt8 genes. Moreover, they found that both molecules were palmitoylated at a conserved cysteine residue (C77 in Wnt3a) and this modification was essential for Wnt signaling activity. Subsequent work revealed that Drosophila Wg, murine Wnt5a, as well as chick Wnt1 and Wnt3a are all palmitoylated at the corresponding cysteine residues (Galli et al., 2007; Kurayoshi et al., 2007; Miura and Treisman, 2006; Willert et al., 2003). More recently, Takada et al. reported that mouse Wnt3a was also lipid-modified by palmitoleic acid at a conserved serine residue(s239) (Takada et al., 2006). Therefore, Wnts are potentially acylated at two conserved sites: one palmitate at an N-terminal cysteine and one palmitoleic acid at an internal serine (Fig. 3). The only exception so far is WntD, a recently characterized Drosophila Wnt family member (Ching et al., 2008; Ganguly et al., 2005; Gordon et al., 2005). WntD does not undergo lipid modification and it takes a secretion route different from other Wnts which will be discussed later (Ching et al., 2008). Many lines of evidence suggest that lipid modifications play essential roles in Wnt secretion and signaling. In vertebrates, generally, palmitate at cysteine is required for Wnt action whereas palmitoleic acid at serine is necessary for Wnt secretion. Point mutations of the palmitoylated cysteine in Wnt3a, Wnt1 and Wnt5a do not interfere with their secretion but strongly decrease their signaling activity in cell-based assays (Galli et al., 2007; Kurayoshi et al., 2007; Willert et al., 2003). Takada et al. demonstrated that Wnt3a defective in serine palmitoleoylation is not secreted from cells but rather is retained in the endoplasmic reticulum (ER) (Takada et al., 2006), suggesting a possible role of this residue in protein folding and intracellular transport. However, 17

19 the recent report using Drosophila Wg disagreed on the exact roles of two lipid adducts (Franch- Marro et al., 2008a). In this study, it is found that removal of palmitate moiety at the conserved cysteine residue (C93) causes inefficient exit of Wg from ER in the wing imaginal discs although this mutant can be readily secreted in cultured Drosophila S2 cells. On the other hand, mutation of the equivalent serine site (S209) causes no major defect in secretion and membrane association but results in poor signaling activities. How is lipid modification involved in Wnt secretion and signaling activity? While it is still unclear on the aspect of Wnt secretion, current data argue that acylation contributes to Wnt signaling activity by facilitating its interaction with the Frizzled receptor (Cong et al., 2004; Komekado et al., 2007; Kurayoshi et al., 2007; Willert et al., 2003). Another post-translational modification of Wnts is N-glycosylation, in which N-linked oligosaccharide chains are attached to the peptide backbone (Fig. 3). Unlike lipid modification, the number and position of glycosylation sites seems to be flexible and its function is poorly understood. In the early studies, it was demonstrated that replacement of all four asparaginelinked glycosylation sites did not affect Wnt1-induced antocrine or paracrine signaling in tissue culture system, indicating that glycosylation was not essential for either secretion or signaling of Wnts (Mason et al., 1992). However, the Kikuchi group recently argued that in the case of Wnt3a and Wnt5a, glycosylation precedes lipid modification and is important for Wnt secretion but not for their actions (Komekado et al., 2007; Kurayoshi et al., 2007). Given the discrepancy in the literacture, my thesis work helps to better understand the respective functions of Wnt lipidation and glycosylation by providing systematic evaluation of their in vivo roles in specific developmental contexts. 18

20 The enzyme most likely to be responsible for Wnt lipid modification is the ER protein Porcupine (Porc). Porc was first identified in Drosophila as a segment polarity gene (van den Heuvel et al., 1993), which encodes a conserved multiple-pass transmembrane protein in the family of membrane-bound O-acyltransferases (MBOATs) (Hofmann, 2000). Despite the lack of direct evidence, the role of Porc as the lipid-modifying enzyme of Wnt is supported by three lines of evidence. First, Porc controls the hydrophobicity levels of Wnts: in the absence of Porc, Wg becomes less hydrophobic (Zhai et al., 2004) while when Porc is overexpressed, Wnt1 and Wnt3a are more hydrophobic (Galli et al., 2007). Second, the Porc-binding domain in Wnt sequence contains the conserved palmitoylated cysteine residue (Fig. 3) (Tanaka et al., 2002). Third, Porc loss-of-function mutations phenocopy mutations of Wnt acylation and show similar disrupted secretion of Wg and Wnt3a (Takada et al., 2006; van den Heuvel et al., 1993). Very recently, a new post-translational modification of Wnt has been suggested following the identification of the Wnt-specific protease, Tiki1 (Zhang et al., 2012). Tiki1-mediated cleavage leads to oxidation and oligomerization of Wnts, a format which shows normal secretion but minimized receptor binding capacity. Wls and the retromer complex in the secretion of Wnts In addition to Porc, Wls (also known as Evenness interrupted or Sprinter) is another key regulator for Wnt secretion (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006) (reviewed in Fig. 4). The initial identification of Wls was made in Drosophila by three independent groups (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). As a multipass transmembrane protein, Wls has been shown to localize in components of the secretory pathway, including the Golgi apparatus, plasma membrane and endosomes, suggesting a role for Wls in Wnt trafficking downstream of Porc (Banziger et al., 2006; Bartscherer et al., 2006; 19

21 Belenkaya et al., 2008; Franch-Marro et al., 2008b; Port et al., 2008; Yang et al., 2008). Indeed, mutations of Wls result in cell-autonomous accumulation of Wg and therefore failure in target gene activation in embryos and wing imaginal discs (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). Particularly, in the absence of Wls, Wg is accumulated in the Golgi and it can no longer reach the cell surface (Banziger et al., 2006). Furthermore, coimmunoprecipitation experiments confirm that Wls physically interacts with Wnt proteins (Banziger et al., 2006). All of the data lead to a model that Wls helps Wnt transport from Golgi to the plasma membrane for secretion but the underlying mechanism is still unknown. As an evolutionarily conserved protein family, Wls and its homologs in C. elegans, planarian, mouse and Xenopus have been shown to regulate the secretion of various Wnt ligands both in vitro and in vivo (Adell et al., 2009; Banziger et al., 2006; Fu et al., 2009; Kim et al., 2009). Interestingly, recent work uncovered that mouse Wls is a direct target of the canonical Wnt pathway during embryonic axis formation (Fu et al., 2009), suggesting a feedback mechanism underlying the reciprocal regulation of Wls and Wnt. As mentioned before, Drosophila WntD is the only lipidunmodified Wnt member. Actually, it is also the only Wnt member which can be efficiently secreted without Wls action (Ching et al., 2008). The secretion of WntD, however, does maintain the requirement of Rab1, which is an ER-to-Golgi trafficking component (Ching et al., 2008). This observation strongly argues that the unpalmitoylated WntD takes a different secretion mode subsequent to its Golgi entrance. First identified in yeast decades ago, the retromer was recently implicated in the same Wnt secretion pathway as Wls. The retromer is an evolutionarily conserved multi-subunit complex, consisting of two smaller complexes, the cargo recognition Vps26-Vps29-Vps35 heterotrimer and a membrane-targeting SNX heterodimer or homodimer (Seaman, 2005; Seaman et al., 1998; 20

22 Verges, 2007). It has been shown that the retromer mediates various intracellular transporting processes, including endosome-golgi trafficking of yeast hydrolase transporter Vps10 and mammalian cation-independent mannose-6-phosphate receptor, and transcytosis of the polymeric immunoglobulin receptor (Seaman, 2005; Seaman et al., 1997; Seaman et al., 1998; Verges et al., 2004).The function of the retromer complex in Wnt signaling was first uncovered in C. elegans by two independent groups (Coudreuse et al., 2006; Prasad and Clark, 2006). In C. elegans, mutations in components of the retromer complex, especially Vps35, shows disrupted Wnt signaling and by epistatic assays both groups established the role of the retromer in Wntproducing cells (Coudreuse et al., 2006; Prasad and Clark, 2006). Of note, Coudreuse and colleagues observed a much stronger impairment in long-range Wnt signaling versus short-range Wnt signaling and more importantly a loss of Wnt gradient (Coudreuse et al., 2006), arguing a role for the retromer in packaging and/or transporting Wnt for secretion. The similarity of Wnt signaling defects in the retromer and wls mutants suggest that they may act together to facilitate Wnt secretion. This hypothesis is supported by parallel studies from five independent groups. Our group and others have demonstrated that the retromer complex regulates Wls stability by preventing it from degradation in the lysosomes (Belenkaya et al., 2008; Franch-Marro et al., 2008b; Pan et al., 2008; Port et al., 2008; Yang et al., 2008). Wls is internalized from the plasma membrane by a clathrin-dependent endocytosis (Belenkaya et al., 2008; Pan et al., 2008; Port et al., 2008; Yang et al., 2008) and can be recycled back to the trans- Golgi network (TGN) as shown by antibody-uptake assays (Belenkaya et al., 2008; Franch- Marro et al., 2008b). Interference of AP-2, Rab5 and dynamin function causes accumulation of Wls on the cell surface, increase in total Wls levels and reduced amount of Wls in the Golgi, indicating roles in recycling of Wls following endocytosis from the cell surface (Belenkaya et al., 21

23 2008; Franch-Marro et al., 2008b; Pan et al., 2008; Port et al., 2008; Yang et al., 2008). An interaction between Wls and the retromer complex has been proposed based on co-localization in endocytic vesicles and co-immunoprecipitation assays (Belenkaya et al., 2008; Franch-Marro et al., 2008b; Port et al., 2008; Yang et al., 2008). By analogy with the previous reported role of the retromer in selective recycling of cargo receptors, it is proposed that the retromer supports Wnt secretion by retrieving Wls from endosomes to the Golgi after its clathrin-mediated endocytosis. So far, the function of the retromer in Wls recycling is shown to be conserved in C. elegans (Pan et al., 2008; Yang et al., 2008), Drosophila (Belenkaya et al., 2008; Franch-Marro et al., 2008b; Port et al., 2008), Xenopus (Kim et al., 2009) and mammalian cells (Belenkaya et al., 2008; Franch-Marro et al., 2008b; Port et al., 2008). Given the essential roles of Wls in Wnt secretion, it is expectable that the trafficking of Wls is tightly regulated and investigation into this process will shed light on the mechanisms underlying Wnt secretion. Indeed, in my studies, I uncovered a novel post-translational modification of Wls, ubiquitination, and I further found that Wls ubiquitination is not only involved in controlling Wls levels and trafficking but also plays an important role in Wg sorting after endocytosis. Lipoproteins and HSPGs in the diffusion and gradient formation of Wnts As mentioned before, Wnt proteins are hydrophobic due to attachment of lipid moieties. In vitro purified Wnt proteins are poorly diffusible and insoluble, which seems inconsistent with the in vivo role of Wnt in tissue patterning. During development, Wnt molecules act both as a shortrange inducer and a long-range morphogen which spreads in long distances to activate expression of different target genes at different threshold levels. Therefore, it has been speculated that a dedicated secretion route exists in addition to the unregulated bulk flow pathway. While the later releases poorly mobile molecules close to the source of production, the 22

24 former produces specifically packed morphogens for efficient spreading and long-range signaling. The existence of such a dedicated pathway has been implicated in the secretion of Hh (Gallet et al., 2003). In this study, they found that in the Drosophila embryonic epithelium, Hh forms large punctate structures and the movement of these puncta segregates away from a secreted form of GFP. As the morphogen family of Hh shares significant structural (both are lipid modified) and functional similarities with Wnt (Nusse, 2003), Wnt may take a similar route in secretion. Moreover, the discovery of Wls as a specific player in Wnt-producing cells hints again at specific cellular machinery dedicated to controlling Wnt release. Interestingly, the functional equivalent of Wls in Hh secretion is the multipass transmembrane protein Dispatched, which contains a sterol-sensing domain potentially interacting with the cholesterol modification of Hh (Burke et al., 1999). The last evidence resides in the association of Wnt with lipid rafts (Zhai et al., 2004). Lipid rafts are specialized detergent-resistant membrane microdomains which are shown to act as platforms for the sorting and trafficking of particular subgroups of proteins (Le Roy and Wrana, 2005; Rietveld et al., 1999; Schmidt et al., 2001). Importantly, the Basler group recently reported that in Drosophila, a major component of membrane microdomains, Reggie-1/Flotillin-2, promotes the secretion and spreading of Wnt and Hh especially for longrange signaling (Katanaev et al., 2008). This result consistently supports the view that targeting to lipid rafts may direct Wnt to specialized sorting and secretion route. How could Wnt overcome its hydrophobic nature and achieve effective secretion and diffusion in vivo? Generally, two models have been proposed (reviewed in Fig. 4). In the first model, acylated Wnts may form micelle-like multimers with the lipid chains facing interior. This multimeric complex has recently been suggested by the sucrose-density gradient experiments with secreted Wnts from tissue-cultured cells (Katanaev et al., 2008). Although Wnt 23

25 oligomerization is ambiguous, the formation of Hh oligomers has been much better demonstrated. In addition to previous biochemical evidence (Chen et al., 2004; Gallet et al., 2006; Zeng et al., 2001), Neha Vyas and colleagues predicted based on FRET microscopy that Hh forms nanoscale oligomers which requires the electrostatic interaction between Hh molecules (Vyas et al., 2008). Another model for the movement of lipid-modified morphogens involves the association of Wnt with the lipoprotein particles (LPPs), which was demonstrated in Drosophila and originally termed argosomes (Greco et al., 2001; Panakova et al., 2005). LPPs consist of a hydrophobic core of lipids, surrounded by a hydrophilic monolayer harboring specific apolipoproteins (Rodenburg and Van der Horst, 2005). In Drosophila, LPPs are derived from the fat body and are found in endocytic compartments in the secreting cell and in the extracellular space of wing imaginal discs (Kutty et al., 1996; Panakova et al., 2005). Both Wnt and Hh are shown to associate with LPPs and this association is important for morphogen spreading and activation of long-range signaling. In the Drosophila wing epithelium, loss of lipoproteins reduces the range of spreading and signaling of Wg and Hh (Panakova et al., 2005). In the mammalian tissue culture system, it was recently shown that Wnt3a is released on high-density lipoprotein particles (Neumann et al., 2009). HSPGs are cell-surface and extracellular-matrix macromolecules consisting of a protein core attached by heparin sulfate (HS) glycosaminoglycan (GAG) chains (Bernfield et al., 1999; Esko and Selleck, 2002). Over the past decades, studies in Drosophila and vertebrates have demonstrated that HSPGs are involved in several signaling pathways, including Wnt, Hh, transforming growth factor-β (TGFβ) and fibroblast growth factor (FGF). The function of HSPGs in Wnt signaling was first revealed by the characterization of sugarless (sgl) (Binari et al., 1997; Hacker et al., 1997; Haerry et al., 1997) and sulfateless (sfl) (Lin and Perrimon, 1999), 24

26 both of which are important enzymes involved in HS biosynthesis. sgl and sfl mutants develop Wg-dependent embryonic defects (Hacker et al., 1997; Lin and Perrimon, 1999) and loss of Sfl activity results in reduced Wg target gene expression and extracellular Wg levels (Baeg et al., 2001; Lin and Perrimon, 1999). In subsequent research, other enzymes, such as the EXT proteins, are also shown to be involved in Wg/Wnt signaling and distribution (Lin, 2004). To date, various studies support the idea that HSPGs regulate Wnt signaling and its gradient formation via their attached HS GAG chains. Existing evidence, especially that from Drosophila, suggests that glypican core proteins also play important roles in regulating the gradient formation of morphogens, including Wnt and Hh. The Drosophila genome encodes two glypicans (division abnormally delayed [Dally] and Dally-like [dlp]) (Baeg et al., 2001; Khare and Baumgartner, 2000; Nakato et al., 1995). It has been shown that Dally and Dlp play cooperative and distinct roles in regulating Wg signaling and distribution. First, Dally-Dlp double mutants exhibit stronger reduction in Wg signaling and extracellular deposition in the embryos and wing discs than either alone (Baeg et al., 2001; Han et al., 2005). Second, as opposed to the positive role of Dally in Wg signaling (Lin and Perrimon, 1999), Dlp shows biphasic activities, functioning to repress short-range Wg signaling but activate longrange Wg signaling (Baeg et al., 2004; Franch-Marro et al., 2005; Kirkpatrick et al., 2004). Concerning the distinct functions of Dally and Dlp, HSPG core proteins may contribute to Wnt signaling much more than being a carrier for HS GAG chains. Indeed it was recently demonstrated that in Drosophila wing discs Dlp core protein has similar biphasic activity as wild-type Dlp (Yan et al., 2009). How do HSPGs modulate Wnt distribution? Current data supports roles of HSPGs in controlling the spreading of morphogens along the epithelial cell surface through a restricted diffusion 25

27 mechanism in which the secreted morphogen molecules move while interacting with their receptors and other ECM proteins especially HSPGs (Baeg et al., 2004; Han et al., 2005; Hufnagel et al., 2006; Lin, 2004; Strigini and Cohen, 2000). In the restricted diffusion, HSPGs may play two roles in regulating Wnt movement. First, Wnt movement may be mediated by transferring between HSPGs, especially HS GAG chains. Alternatively, HSPGs control Wnt stability to ensure it moves across a field of cells without being degraded. The two mechanisms may be coupled in Wnt gradient formation. Particularly, it was recently reported that membraneassociated glypicans recruit LPPs in the wing disc cells (Eugster et al., 2007), adding another level of complexity to Wnt gradient formation. In addition to a role in Wnt planar transportation, HSPGs can also regulate Wnt apical/basolateral distribution in epithelial cells. As mentioned before, the apicobasal trafficking of Dlp was recently shown to be involved in the basolateral redistribution of apically secreted Wg in polarized wing disc cells (Gallet et al., 2008). Reception of Wnt signals In history, most of the understanding on the mechanisms underlying Wnt signal transduction was obtained based on a combined approach including genetics in Drosohphila and C. elegans, ectopic gene expression in Xenopus embryos and biochemistry in cell culture. Wnt signals through three major pathways in target cells: the canonical, planar cell polarity (PCP), and Ca 2+ pathways. Signaling through the noncanonical PCP and Wnt/Ca 2+ pathways is involved in cell polarity and cell movements (Veeman et al., 2003). Signaling through the canonical β-catenin pathway (Fig. 5) underlies the regulation of tissue patterning, growth and cell fate specification (van Amerongen and Nusse, 2009). Here I focus on the canonical Wg/Wnt pathway and dissect it into three sequential steps including receptor interaction on the plasma membrane, control of 26

28 β-catenin stability in the cytoplasm and transactivation of target genes in the nucleus. Each step in the signal cascade is tightly regulated at many levels. To initiate Wnt signaling, Wnt ligands bind to members of the Frizzled (Fz) family on the receiving cells. The Fz family proteins are seven-pass transmembrane molecules with a large extracellular N-terminal cysteine-rich domain (CRD) which confers multiple binding surfaces for Wnt ligands (Bhanot et al., 1996). In binding Wnts, Fzs cooperate with LRP family members which are single-pass transmembrane molecules (Arrow in Drosophila and LRP5/6 in vertebrates) (Pinson et al., 2000; Tamai et al., 2000; Wehrli et al., 2000). Upon ligand binding, the cytoplasmic tail of LRP is phosphorylated by at least two kinases, GSK3 and CK1(Davidson et al., 2005; Zeng et al., 2005). The phosphorylation of LRP is crucial for the recruitment and binding of Axin. Wnt signaling also controls the phosphorylation status of Dishevelled (Dvl) a cytoplasmic protein that physically interacts with Fz (Wallingford and Habas, 2005). The Fzbound Dvl and the LRP-bound Axin may cooperatively mediate downstream activation events by heterodimerization through their respective DIX (Dishevelled-Axin) domains. In the absence of Wnt signal, the major signaling component β-catenin is maintained at low levels through the action of a destruction complex composed of factors including the scaffolding protein Axin, APC, CK1 and GSK3(MacDonald et al., 2009). The phosphorylation of β-catenin by CK1 and GSK3 provides the degron motif which can be recognized by β-trcp, an F-box protein of SCF ubiquitin E3 ligase. As a consequence, β-catenin is ubiquitinated and degraded through the ubiquitin-proteosome pathway (Aberle et al., 1997). Interestingly, as opposed to the function of kinases, protein phosphatases, PP2A as an example, have also been suggested to regulate β-catenin stability (Price, 2006). Following receptor activation, the kinase activity of the destruction complex is inhibited and this process involves the recruitment of Axin to the 27

29 phosphorylated tail of LRP and/or Fz-bound Dvl. Consequently, β-catenin is stabilized in a hypo-phosphorylated form and translocate to the nucleus, where it binds to the LEF/TCF transcription factors (Behrens et al., 1996; Molenaar et al., 1996). The ultimate outcome of Wnt signaling is the expression of Wnt target genes controlled by the transcription factor complex composed of β-catenin and LEF/TCF family proteins. There is one member of the TCF family in Drosophila and four in vertebrates, including LEF-1, TCF-1, TCF- 3 and TCF-4. Despite their distinct expression patterns, different TCFs bind to similar DNA recognition sequences referred to as Wnt response elements (WREs) (van de Wetering et al., 1997). In the default state, the pioneering nuclear TCFs occupy WRE and constitutively prevent target gene activation. For this purpose, TCF recruits the Groucho transcriptional repressor, which functions with the histone deacetylases (HDACs) to stimulate the compression of local chromatin and to inhibit transcription (Cavallo et al., 1998; Roose et al., 1998). On Wnt ligand binding, β-catenin displaces Groucho and functions as a scaffold to recruit an auxiliary machinery of coactivators to induce Wnt target gene expression. Within the β-catenin/tcf complex, three other key players are BCL-9/legless, pygopus and CBP (Kramps et al., 2002; Parker et al., 2002; Thompson et al., 2002). The transactivation potential of β-catenin is largely dependent on its interacting partners, especially those crucial chromatin factors. For example, β- catenin binds histone acetyltransferase (HAT) proteins CBP and p300, the SWI2/SNF2 family protein BRG1 (an ATPase that shuffles or even disassembles histone octamers), and parafibromin/hyrax (homologs of yeast Cdc73, a component in the PAF1 complex which engages with RNA Pol II, histone monoubiquitination and histone methylation) (reviewed in (Mosimann et al., 2009). Interestingly, as suggested by my thesis work, hyperplastic discs (hyd) 28

30 may act as a novel nuclear factor that controls the transcriptional output of β-catenin in the wing imagical discs, although further work is needed to fully understand the molecular mechasnisms. Wnt secretion and signaling in human diseases As mentioned before, Wnt signaling controls virtually all aspects of embryonic development and also regulates the homeostatic self-renewal in multiple adult tissues. In light of its critical roles, it is not surprising that Wnt signaling is highly regulated at many levels and interruption in each step could lead to human diseases. The first connection of Wnt signaling with human disease was established in the early 1990s by the discovery of APC in a hereditary cancer syndrome termed familial adenomatous polyposis (FAP) (Kinzler et al., 1991; Nishisho et al., 1991). Since then, many disease connections have been uncovered in the last two decades. Defects in Wnt production are associated with human diseases. Approximately 50% of human non-small cell lung carcinoma cell lines and primary tumors have upregulated WNT ligand expression (Akiri et al., 2009). In the work leading to the discovery of Wnt1, MMTV is inserted into the Wnt1 locus to drive its constitutive expression in certain breast tumors (Nusse and Varmus, 1982). Later, genes coding for other Wnt members including Wnt3 and Wnt10B were also found to carry the MMTV insertions (Tekmal and Keshava, 1997). Specific SNPs in Wnt5B (Kanazawa et al., 2004) and Wnt10B (Christodoulides et al., 2006) have been linked with increased risk for type II diabetes. Mutations in the human Porc gene are associated with focal dermal hypoplasia (FDH) (Grzeschik et al., 2007; Wang et al., 2007), also named Goltz disease, which is characterized by abnormalities in the skin, teeth, skeleton and digestive system. Recent work also suggests that Wls may play a role in the progression of glioma in mouse and human cell lines (Augustin et al., 2012). 29

31 Wnt signaling is regulated at the receptor levels. Various natural Wnt inhibitors act to antagonize Wnt signaling: secreted Frizzled-related proteins (sfrps) and Wnt inhibitory protein (WIF) can bind Wnts (Bovolenta et al., 2008); Dickkopf (DKK) (Glinka et al., 1998)and the WISE/SOST families can bind LRP5/6. There are also secreted Wnt agonists including Norrin (product of NDP gene) and R-spondins (Rspos), which can activate Wnt signaling through binding the Fz/LRP complex. Mutations in LRP5, Fz9 and SOST have all been linked with bone disease (Balemans et al., 2001; Brunkow et al., 2001; Gong et al., 2001; Wang et al., 1999). NDP mutations cause Norrie disease, an X-linked disorder characterized by hypovascularization of the retina and a severe loss of visual function (Dickinson et al., 2006). Rspo gene mutations have also been found in hereditary syndromes in humans, including RSPO1 in XX sex reversal with palmoplantar hyperkaratosis (Parma et al., 2006) and RSPO4 in autosomal-recessive anonychia and hyponychia congenita (Blaydon et al., 2006). Dysfunction of the destruction complex and the β-catenin/tcf transcriptional machinery is also implicated in human diseases especially cancers. Mutation in the APC gene is the most common mutation in colon cancers. Germline mutations of APC cause familiar adenomatous polyposis (FAP) (Kinzler et al., 1991; Nishisho et al., 1991). Axin2 mutations underlie some rare cases of colorectal cancers (Liu et al., 2000) and tooth agenesis (Lammi et al., 2004). Inactivating mutations in LEF-1 occur in sebaceous skin tumors (Takeda et al., 2006) and TCF-4 was recently found to be disrupted in some cases of colon cancers (Bass et al., 2011). Activating β- catenin mutations, first described in colon cancer and melanoma (Rubinfeld et al., 1997), widely occurs in a variety of solid tumors (Reya and Clevers, 2005). Since the discovery of the first Wnt member in early 1980s, our understanding about the action and regulation of Wnt pathways has been greatly advanced. However, as mentioned before, 30

32 many questions remain to be answered in the Wnt field. By focusing on the best studied Drosophila Wnt member Wg, I investigated the regulation of Wg pathway in three aspects: first, regarding Wnt processing and maturation, I did systematic analysis of the roles of N- glycosylation and lipidation on Wg secretion and signaling in both cultured cells and in vivo systems; second, regarding Wls-mediated Wnt secretion, I found that Wls undergoes ubiquitination and this post-translational modification is important to the sorting and release of Wg ligands; finally, from a genetic RNAi screen, I identified a novel member of Wg signaling, hyd, and defined its role in regulating the transcriptional output of Arm. 31

33 References Adell, T., E. Salo, et al. (2009). "Smed-Evi/Wntless is required for beta-catenin-dependent and - independent processes during planarian regeneration." Development 136(6): Baeg, G. H., X. Lin, et al. (2001). "Heparan sulfate proteoglycans are critical for the organization of the extracellular distribution of Wingless." Development 128(1): Baeg, G. H., E. M. Selva, et al. (2004). "The Wingless morphogen gradient is established by the cooperative action of Frizzled and Heparan Sulfate Proteoglycan receptors." Dev Biol 276(1): Baena-Lopez, L. A., I. Rodriguez, et al. (2008). "The tumor suppressor genes dachsous and fat modulate different signalling pathways by regulating dally and dally-like." Proc Natl Acad Sci U S A 105(28): Banziger, C., D. Soldini, et al. (2006). "Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins from signaling cells." Cell 125(3): Bartscherer, K., N. Pelte, et al. (2006). "Secretion of Wnt ligands requires Evi, a conserved transmembrane protein." Cell 125(3): Belenkaya, T. Y., Y. Wu, et al. (2008). "The retromer complex influences Wnt secretion by recycling wntless from endosomes to the trans-golgi network." Dev Cell 14(1): Bernfield, M., M. Gotte, et al. (1999). "Functions of cell surface heparan sulfate proteoglycans." Annu Rev Biochem 68: Binari, R. C., B. E. Staveley, et al. (1997). "Genetic evidence that heparin-like glycosaminoglycans are involved in wingless signaling." Development 124(13): Bishop, J. R., M. Schuksz, et al. (2007). "Heparan sulphate proteoglycans fine-tune mammalian physiology." Nature 446(7139): Bornemann, D. J., S. Park, et al. (2008). "A translational block to HSPG synthesis permits BMP signaling in the early Drosophila embryo." Development 135(6): Burke, R., D. Nellen, et al. (1999). "Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-modified hedgehog from signaling cells." Cell 99(7): Capurro, M. I., Y. Y. Xiang, et al. (2005). "Glypican-3 promotes the growth of hepatocellular carcinoma by stimulating canonical Wnt signaling." Cancer Res 65(14): Chen, M. H., Y. J. Li, et al. (2004). "Palmitoylation is required for the production of a soluble multimeric Hedgehog protein complex and long-range signaling in vertebrates." Genes Dev 18(6): Chen, R. L. and A. D. Lander (2001). "Mechanisms underlying preferential assembly of heparan sulfate on glypican-1." J Biol Chem 276(10): Ching, W., H. C. Hang, et al. (2008). "Lipid-independent secretion of a Drosophila Wnt protein." J Biol Chem 283(25): Cong, F., L. Schweizer, et al. (2004). "Wnt signals across the plasma membrane to activate the beta-catenin pathway by forming oligomers containing its receptors, Frizzled and LRP." Development 131(20): Coudreuse, D. and H. C. Korswagen (2007). "The making of Wnt: new insights into Wnt maturation, sorting and secretion." Development 134(1): Coudreuse, D. Y., G. Roel, et al. (2006). "Wnt gradient formation requires retromer function in Wnt-producing cells." Science 312(5775):

34 Esko, J. D. and S. B. Selleck (2002). "Order out of chaos: assembly of ligand binding sites in heparan sulfate." Annu Rev Biochem 71: Esko, J. D. and L. Zhang (1996). "Influence of core protein sequence on glycosaminoglycan assembly." Curr Opin Struct Biol 6(5): Eugster, C., D. Panakova, et al. (2007). "Lipoprotein-heparan sulfate interactions in the Hh pathway." Dev Cell 13(1): Filmus, J. and M. Capurro (2008). "The role of glypican-3 in the regulation of body size and cancer." Cell Cycle 7(18): Franch-Marro, X., O. Marchand, et al. (2005). "Glypicans shunt the Wingless signal between local signalling and further transport." Development 132(4): Franch-Marro, X., F. Wendler, et al. (2008). "In vivo role of lipid adducts on Wingless." J Cell Sci 121(Pt 10): Franch-Marro, X., F. Wendler, et al. (2008). "Wingless secretion requires endosome-to-golgi retrieval of Wntless/Evi/Sprinter by the retromer complex." Nat Cell Biol 10(2): Fu, J., M. Jiang, et al. (2009). "Reciprocal regulation of Wnt and Gpr177/mouse Wntless is required for embryonic axis formation." Proc Natl Acad Sci U S A 106(44): Fujise, M., S. Izumi, et al. (2001). "Regulation of dally, an integral membrane proteoglycan, and its function during adult sensory organ formation of Drosophila." Dev Biol 235(2): Gallet, A., R. Rodriguez, et al. (2003). "Cholesterol modification of hedgehog is required for trafficking and movement, revealing an asymmetric cellular response to hedgehog." Dev Cell 4(2): Gallet, A., L. Ruel, et al. (2006). "Cholesterol modification is necessary for controlled planar long-range activity of Hedgehog in Drosophila epithelia." Development 133(3): Gallet, A., L. Staccini-Lavenant, et al. (2008). "Cellular trafficking of the glypican Dally-like is required for full-strength Hedgehog signaling and wingless transcytosis." Dev Cell 14(5): Galli, L. M., T. L. Barnes, et al. (2007). "Porcupine-mediated lipid-modification regulates the activity and distribution of Wnt proteins in the chick neural tube." Development 134(18): Ganguly, A., J. Jiang, et al. (2005). "Drosophila WntD is a target and an inhibitor of the Dorsal/Twist/Snail network in the gastrulating embryo." Development 132(15): Gerlitz, O. and K. Basler (2002). "Wingful, an extracellular feedback inhibitor of Wingless." Genes Dev 16(9): Giraldez, A. J., R. R. Copley, et al. (2002). "HSPG modification by the secreted enzyme Notum shapes the Wingless morphogen gradient." Dev Cell 2(5): Goodman, R. M., S. Thombre, et al. (2006). "Sprinter: a novel transmembrane protein required for Wg secretion and signaling." Development 133(24): Gordon, M. D., M. S. Dionne, et al. (2005). "WntD is a feedback inhibitor of Dorsal/NF-kappaB in Drosophila development and immunity." Nature 437(7059): Greco, V., M. Hannus, et al. (2001). "Argosomes: a potential vehicle for the spread of morphogens through epithelia." Cell 106(5): Hacker, U., X. Lin, et al. (1997). "The Drosophila sugarless gene modulates Wingless signaling and encodes an enzyme involved in polysaccharide biosynthesis." Development 124(18):

35 Haerry, T. E., T. R. Heslip, et al. (1997). "Defects in glucuronate biosynthesis disrupt Wingless signaling in Drosophila." Development 124(16): Han, C., D. Yan, et al. (2005). "Drosophila glypicans Dally and Dally-like shape the extracellular Wingless morphogen gradient in the wing disc." Development 132(4): Hofmann, K. (2000). "A superfamily of membrane-bound O-acyltransferases with implications for wnt signaling." Trends Biochem Sci 25(3): Hufnagel, L., J. Kreuger, et al. (2006). "On the role of glypicans in the process of morphogen gradient formation." Dev Biol 300(2): Katanaev, V. L., G. P. Solis, et al. (2008). "Reggie-1/flotillin-2 promotes secretion of the longrange signalling forms of Wingless and Hedgehog in Drosophila." Embo J 27(3): Kato, M., H. Wang, et al. (1998). "Physiological degradation converts the soluble syndecan-1 ectodomain from an inhibitor to a potent activator of FGF-2." Nat Med 4(6): Khare, N. and S. Baumgartner (2000). "Dally-like protein, a new Drosophila glypican with expression overlapping with wingless." Mech Dev 99(1-2): Kim, H., S. M. Cheong, et al. (2009). "Xenopus Wntless and the retromer complex cooperate to regulate XWnt4 secretion." Mol Cell Biol 29(8): Kirkpatrick, C. A., B. D. Dimitroff, et al. (2004). "Spatial regulation of Wingless morphogen distribution and signaling by Dally-like protein." Dev Cell 7(4): Komekado, H., H. Yamamoto, et al. (2007). "Glycosylation and palmitoylation of Wnt-3a are coupled to produce an active form of Wnt-3a." Genes Cells 12(4): Kramer, K. L. and H. J. Yost (2003). "Heparan sulfate core proteins in cell-cell signaling." Annu Rev Genet 37: Kreuger, J., L. Perez, et al. (2004). "Opposing activities of Dally-like glypican at high and low levels of Wingless morphogen activity." Dev Cell 7(4): Kurayoshi, M., H. Yamamoto, et al. (2007). "Post-translational palmitoylation and glycosylation of Wnt-5a are necessary for its signalling." Biochem J 402(3): Kutty, R. K., G. Kutty, et al. (1996). "Molecular characterization and developmental expression of a retinoid- and fatty acid-binding glycoprotein from Drosophila. A putative lipophorin." J Biol Chem 271(34): Le Roy, C. and J. L. Wrana (2005). "Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling." Nat Rev Mol Cell Biol 6(2): Lin, X. (2004). "Functions of heparan sulfate proteoglycans in cell signaling during development." Development 131(24): Lin, X. and N. Perrimon (1999). "Dally cooperates with Drosophila Frizzled 2 to transduce Wingless signalling." Nature 400(6741): Lin, X. and N. Perrimon (2002). "Developmental roles of heparan sulfate proteoglycans in Drosophila." Glycoconj J 19(4-5): Mason, J. O., J. Kitajewski, et al. (1992). "Mutational analysis of mouse Wnt-1 identifies two temperature-sensitive alleles and attributes of Wnt-1 protein essential for transformation of a mammary cell line." Mol Biol Cell 3(5): Miller, J. R. (2002). "The Wnts." Genome Biol 3(1): REVIEWS3001. Miura, G. I. and J. E. Treisman (2006). "Lipid modification of secreted signaling proteins." Cell Cycle 5(11): Nakato, H., T. A. Futch, et al. (1995). "The division abnormally delayed (dally) gene: a putative integral membrane proteoglycan required for cell division patterning during 34

36 postembryonic development of the nervous system in Drosophila." Development 121(11): Neumann, S., D. Y. Coudreuse, et al. (2009). "Mammalian Wnt3a is released on lipoprotein particles." Traffic 10(3): Nusse, R. (2003). "Wnts and Hedgehogs: lipid-modified proteins and similarities in signaling mechanisms at the cell surface." Development 130(22): Nybakken, K. and N. Perrimon (2002). "Heparan sulfate proteoglycan modulation of developmental signaling in Drosophila." Biochim Biophys Acta 1573(3): Pan, C. L., P. D. Baum, et al. (2008). "C. elegans AP-2 and retromer control Wnt signaling by regulating mig-14/wntless." Dev Cell 14(1): Panakova, D., H. Sprong, et al. (2005). "Lipoprotein particles are required for Hedgehog and Wingless signalling." Nature 435(7038): Port, F., M. Kuster, et al. (2008). "Wingless secretion promotes and requires retromer-dependent cycling of Wntless." Nat Cell Biol 10(2): Prasad, B. C. and S. G. Clark (2006). "Wnt signaling establishes anteroposterior neuronal polarity and requires retromer in C. elegans." Development 133(9): Rietveld, A., S. Neutz, et al. (1999). "Association of sterol- and glycosylphosphatidylinositollinked proteins with Drosophila raft lipid microdomains." J Biol Chem 274(17): Rodenburg, K. W. and D. J. Van der Horst (2005). "Lipoprotein-mediated lipid transport in insects: analogy to the mammalian lipid carrier system and novel concepts for the functioning of LDL receptor family members." Biochim Biophys Acta 1736(1): Sanderson, R. D., Y. Yang, et al. (2004). "Heparan sulfate proteoglycans and heparanase-- partners in osteolytic tumor growth and metastasis." Matrix Biol 23(6): Schmidt, K., M. Schrader, et al. (2001). "Regulated apical secretion of zymogens in rat pancreas. Involvement of the glycosylphosphatidylinositol-anchored glycoprotein GP-2, the lectin ZG16p, and cholesterol-glycosphingolipid-enriched microdomains." J Biol Chem 276(17): Seaman, M. N. (2005). "Recycle your receptors with retromer." Trends Cell Biol 15(2): Seaman, M. N., E. G. Marcusson, et al. (1997). "Endosome to Golgi retrieval of the vacuolar protein sorting receptor, Vps10p, requires the function of the VPS29, VPS30, and VPS35 gene products." J Cell Biol 137(1): Seaman, M. N., J. M. McCaffery, et al. (1998). "A membrane coat complex essential for endosome-to-golgi retrograde transport in yeast." J Cell Biol 142(3): Stigliano, I., L. Puricelli, et al. (2009). "Glypican-3 regulates migration, adhesion and actin cytoskeleton organization in mammary tumor cells through Wnt signaling modulation." Breast Cancer Res Treat 114(2): Strigini, M. and S. M. Cohen (2000). "Wingless gradient formation in the Drosophila wing." Curr Biol 10(6): Takada, R., Y. Satomi, et al. (2006). "Monounsaturated fatty acid modification of Wnt protein: its role in Wnt secretion." Dev Cell 11(6): Tanaka, K., Y. Kitagawa, et al. (2002). "Drosophila segment polarity gene product porcupine stimulates the posttranslational N-glycosylation of wingless in the endoplasmic reticulum." J Biol Chem 277(15): Tao, Q., C. Yokota, et al. (2005). "Maternal wnt11 activates the canonical wnt signaling pathway required for axis formation in Xenopus embryos." Cell 120(6):

37 Topczewski, J., D. S. Sepich, et al. (2001). "The zebrafish glypican knypek controls cell polarity during gastrulation movements of convergent extension." Dev Cell 1(2): Traister, A., W. Shi, et al. (2007). "Mammalian Notum induces the release of glypicans and other GPI-anchored proteins from the cell surface." Biochem J. van den Heuvel, M., C. Harryman-Samos, et al. (1993). "Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein." Embo J 12(13): Verges, M. (2007). "Retromer and sorting nexins in development." Front Biosci 12: Verges, M., F. Luton, et al. (2004). "The mammalian retromer regulates transcytosis of the polymeric immunoglobulin receptor." Nat Cell Biol 6(8): Vyas, N., D. Goswami, et al. (2008). "Nanoscale organization of hedgehog is essential for longrange signaling." Cell 133(7): Willert, K., J. D. Brown, et al. (2003). "Wnt proteins are lipid-modified and can act as stem cell growth factors." Nature 423(6938): Yan, D., Y. Wu, et al. (2009). "The core protein of glypican Dally-like determines its biphasic activity in wingless morphogen signaling." Dev Cell 17(4): Yang, P. T., M. J. Lorenowicz, et al. (2008). "Wnt signaling requires retromer-dependent recycling of MIG-14/Wntless in Wnt-producing cells." Dev Cell 14(1): Zeng, X., J. A. Goetz, et al. (2001). "A freely diffusible form of Sonic hedgehog mediates longrange signalling." Nature 411(6838): Zhai, L., D. Chaturvedi, et al. (2004). "Drosophila wnt-1 undergoes a hydrophobic modification and is targeted to lipid rafts, a process that requires porcupine." J Biol Chem 279(32):

38 Figures Figure 1. Reciprocal signaling between Wg- and Hh-producing cells during Drosophila embryogenesis. 37

39 Figure 2. Drosophila wing disc and the fate map. Schemes of (A) xy and (B) cross-section xz views of mid-to-late-third instar wing discs. The wing disc pouch, hinge and notum regions are indicated. A representation of the Wingless expression domain is shown in green. 38

40 Figure 3. Schematic overview of mouse Wnt3a and Drosophila Wingless proteins, showing the approximate positions of cysteine residues (black vertical lines). Both Wnts are acylated probably by Porcupine which binds Wnts at the corresponding region. Two lipids are appended to Wnts: one palmitate to the N-terminal cysteine and one palmitoleic acid to the internal serine. Wnts also harbor several potential N-glycosylation sites as indicated. The signal sequence is represented by the boxed area in the N-terminus. 39

41 Figure 4. Models of Wnt secretion and distribution. (a)wnt synthesized in the endoplasmic reticulum undergoes N-glycosylation and acylation by the ER enzyme Porcupine. (b)in the Golgi apparatus, Wls binds Wnt and helps its delivery to the cell surface by an unknown mechanism. The efficient secretion of Wnt may involve Wnt oligomerization and its association with lipoprotein particles. (c)secreted Wnt is enriched in Reggie-1/Flotillin-2 containing lipid rafts and can be internalized into endocytic vesicles dependent or independent from the endocytosis of Wls, glypican and lipoprotein. (d)internalized Wnt may be rerouted for basolateral secretion. (e)after dissociation with Wnt, Wls, otherwise degraded in the lysosome, is recycled by the retromer complex to the trans-golgi network. (f)wnt after secretion moves in the extracellular space possibly in the form of Wnt oligomers and/or Wnt-lipoprotein complex. (g)the cell surface glypicans facilitate the restricted diffusion and gradient formation of Wnt across a field 40

42 of cells. (h)when captured by Frizzled and the coreceptor LRP, Wnt induces a series of signaling events in the receiving cells in a concentration-dependent manner. 41

43 Figure 5. Model of canonical Wnt signaing. See text for details. 42

44 CHAPTER II Roles of N-glycosylation and lipidation in Wingless secretion and signaling Xiaofang Tang a*, Yihui Wu b*, Tatyana Y. Belenkaya a, Qinzhu Huang c, Lorraine Ray a, Jia Qu c, Xinhua Lin a,b a Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, and The Graduate Program in Molecular and Developmental Biology, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA b State Key Laboratory of Biomembrane and Membrane Biotechnology, and Key Laboratory of Stem Cell and Developmental Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, , China c Wenzhou Medical College, Wenzhou, Zhejiang, , China * These two authors contributed equally to this work Published as Tang, X., et al., Roles of N-glycosylation and lipidation in Wg secretion and signaling. Dev Biol, (1): p (* equal contribution: Xiaofang Tang designed the experiments, performed analysis in the embryos and wing discs and wrote the manuscript; Yihui Wu cloned different Wg variants and performed assays with S2 cells.) 43

45 Abstract Wnt members act as morphogens essential for embryonic patterning and adult homeostasis. Currently, it is still unclear how Wnt secretion and its gradient formation are regulated. In this study, we examined the roles of N-glycosylation and lipidation/acylation in regulating the activities of Wingless (Wg), the main Drosophila Wnt member. We show that Wg mutant devoid of all the N-glycosylations exhibits no major defects in either secretion or signaling, indicating that N-glycosylation is dispensable for Wg activities. We demonstrate that lipid modifications at Serine 239 (S239) rather than that at Cysteine 93 (C93) plays a more important role in regulating Wg signaling in multiple developmental contexts. Wg S239 mutant exhibits a reduced ability to bind its receptor, Drosophila Frizzled 2 (dfz2), suggesting that S239 is involved in the formation of a Wg/receptor complex. Importantly, while single Wg C93 or Wg S239 mutants can be secreted, removal of both acyl groups at C93 and S239 renders Wg incapable of reaching the plasma membrane for secretion. These data argue that lipid modifications at C93 and S239 play major roles in Wg secretion. Further experiments demonstrate that two acyl attachment sites in the Wg protein are required for the interaction of Wg with Wntless (Wls, also known as Evi or Srt), the key cargo protein involved in Wg secretion. Together, our data demonstrate the in vivo roles of N-glycosylation and lipid modification in Wg secretion and signaling. 44

46 Introduction The Wnt family members comprise an evolutionarily conserved class of secreted signaling molecules which control growth and patterning in various developmental contexts and maintenance of tissues in adult homeostasis (Cadigan and Liu, 2006; Cadigan and Peifer, 2009; Clevers, 2006; Logan and Nusse, 2004). De-regulated Wnt signaling has been implicated in a variety of developmental abnormalities and cancers (Logan and Nusse, 2004; MacDonald et al., 2009; Polakis, 2007). Normal cells require an orchestrated program of actions to tightly and precisely control Wnt activities. Various studies have shown that post-translational modifications of Wnt proteins play critical roles in many aspects of Wnt regulation, including ligand secretion, extracellular distribution and receptor activation. However, it is less clear about the roles of posttranslational modifications in regulating Wnt activities in specific developmental contexts. As a common structural characteristic, Wnts contain a high number of conserved cysteines (23-25 on average), suggesting that the formation of intra- and inter- molecular disulfide bonds may be important for the proper folding and multimerization of Wnt proteins. In addition to disulfide bonding, two major types of post-translational modifications, lipidation/acylation and N- glycosylation have been reported on most Wnt members. It has been shown that Drosophila Wingless (Wg), murine Wnt1, Wnt3a and Wnt5a, as well as chick Wnt1 and Wnt3a are all palmitoylated at the first conserved cysteine residue (C93 in Wg) (Doubravska et al., 2011; Galli et al., 2007; Kurayoshi et al., 2007; Miura and Treisman, 2006; Willert et al., 2003). Wnt3a has been reported to be lipid-modified by palmitoleic acid at a second site, serine 209, which is also conserved among Wnt members (S239 in Wg) (Takada et al., 2006). Therefore, two acyl groups can be attached to Wnts: one palmitate at an N-terminal cysteine and one palmitoleic acid at an internal serine. The only exception known so far is WntD, a Drosophila Wnt family member 45

47 which does not have the conserved serine and does not undergo any lipid modification (Ching et al., 2008). In vertebrates, studies from cell-based assays about the role of lipidation argued that palmitate at cysteine is essential for Wnt signaling (Galli et al., 2007; Kurayoshi et al., 2007; Miura and Treisman, 2006; Willert et al., 2003) while palmitoleic acid at serine is required for Wnt secretion (Takada et al., 2006). However, it has been recently reported that in several cellular contexts, murine Wnt1 and Wnt3a lacking the cysteine-linked palmitate can still signal (Doubravska et al., 2011). Many lines of evidence strongly argue that Wnt lipid modification is controlled by the endoplasmic reticulum (ER) protein Porcupine (Porc). Porc encodes a conserved multiple-pass transmembrane protein in the family of membrane-bound O-acyltransferases (MBOATs) (Hofmann, 2000). Porc loss-of-function mutations phenocopy mutations of Wnt acylation and show similar disrupted secretion of Wnt3a (Takada et al., 2006; van den Heuvel et al., 1993). After post-translational modifications, mature Wnt proteins exit from the ER and are secreted in a pathway that requires the function of the carrier protein, Wls (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). Wls is a multi-pass transmembrane protein and has been shown to be localized in the ER, Golgi apparatus and on the plasma membrane (Banziger et al., 2006; Bartscherer et al., 2006; Belenkaya et al., 2008; Coombs et al., 2010; Yang et al., 2008). After released from the cell surface, Wnt molecules reach receiving cells by a facilitated movement involving lipoprotein particles and heparan sulfate proteoglycans (HSPG, Dally and Dlp in Drosophila) (Baeg et al., 2001; Franch-Marro et al., 2005; Han et al., 2004; Han et al., 2005; Lin, 2004; Neumann et al., 2009; Panakova et al., 2005). Various studies have indicated that Wnts can be N-glycosylated, in which multiple asparagine residues of Wnts are appended with N-linked oligosaccharide chains. Unlike lipid modification, 46

48 different Wnt members vary in the number and position of glycosylation sites and the roles of glycosylation also seem to be unconserved within the Wnt family. Particularly, it has been demonstrated that replacement of all N-glycosylation sites does not affect Wnt1-induced autocrine or paracrine signaling in several cellular contexts, indicating that glycosylation is not essential for either secretion or signaling (Doubravska et al., 2011; Mason et al., 1992). However, in the case of Wnt3a and Wnt5a, the Kikuchi group argued that glycosylation precedes lipid modification and is important for Wnt secretion but not for Wnt actions (Komekado et al., 2007; Kurayoshi et al., 2007). Most available data regarding the activities of Wnt lipidation and N-glycosylation were obtained from cell-based assays (Komekado et al., 2007; Kurayoshi et al., 2007; Takada et al., 2006; Willert et al., 2003). As a common practice, Wnt members and its mutant derivatives are usually examined by using specific epitope tags which may complicate the interpretation of results. Thus, to fully understand the respective functions of Wnt lipidation and glycosylation, we need to evaluate their roles by using non-tagged proteins and examining their in vivo activities in specific developmental contexts. In the present study, we aim to investigate how N-glycosylation and lipidation contribute to Wg signaling and secretion using Drosophila embryos and wing imaginal discs as in vivo systems. During embryonic and wing development, Wg acts as both a short-range inducer and a longrange morphogen to regulate tissue patterning (Clevers, 2006; Kohn and Moon, 2005). After release from its origin, Wg forms a graded distribution throughout the area of receiving cells where it binds to the receptors of the Frizzled family (mainly Frizzled 2, dfz2) to activate downstream signaling. In this paper, we generated Wg mutant variants defective in lipidation or glycosylation and analyzed their signaling properties in embryos and wing imaginal discs. Our 47

49 data show that glycosylation-deficient Wg can be secreted and still maintains major signaling activity. However, although palmitate at C93 is not absolutely required for secretion or signaling, palmitoleic acid at S239 contributes significantly to signaling activity. Importantly, our results indicate that Wg binding to Wls requires at least one of the two lipid adducts and that loss of dual lipidation disrupts Wg-Wls interaction, thereby disabling Wg secretion through the dedicated secretory route. Our results also clarified some controversial issues in previous functional studies about the roles of lipidation in Wg signaling and secretion. 48

50 Materials and Methods Wg transgenes and constructs The C93A, S239A and N103Q mutations were introduced into full-length Wingless using the GeneTailor Site-directed mutagenesis kit from Invitrogen and were verified by sequencing. The C93A mutation was also introduced to UAS-HAWg (from Gary Struhl) using the same protocol. The N414S mutation was cloned from the construct pcasper-hs WgN414S (Tanaka et al., 2002). All constructs were cloned into the puast vector for expression in transgenic flies. wg IG22 (van den Heuvel et al., 1993) is used as Wingless null allele and UAS-Wg E1 (Brennan et al., 1999) is used for over-expression of wild-type Wingless. Fly genetics Ectopic expression of Wg transgenes was achieved by the Gal4/UAS system (Brand and Perrimon, 1993). da Gal4, hh Gal4, dpp Gal4, ap Gal4, and sim Gal4 strains were described in Flybase. y w flp; Act>y+>Gal4 UAS-GFP (Ito et al., 1997) was used to induce the expression of Wg transgenes in GFP-marked random clones in the wing discs. To achieve co-expression of Wls-V5 with Wg or WgCS in the wing discs, UAS-Wg transgene/hs-wls-v5; hh Gal4 tub1a-gal80 ts larvae were kept at 18 C until third instar to block Gal4, then shifted to 30 C to allow Gal4 expression, heat-shocked for 2 hrs at 37 C to induce Wls-V5 expression and kept at 30 C for the rest of time (about 3-4 hrs) before dissection. To ectopically express Wg transgenes (or arm.s10) in Wg null background, sim Gal4 wg IG22 /CyoActGFP recombinants were generated and crossed with wg IG22 ; UAS-Wg transgenes(or UAS-arm.S10)/T(2;3)SM6a-TM6B. In the next generation, embryos with the desired heteroallelic genotypes (sim Gal4 wg IG22 /wg IG22 ; UAS-Wg transgenes/+) were identified without 49

51 ambiguity by excluding GFP embryos. UAS-arm.S10 was described in Flybase. Imaginal disc and embryo immunostaining Fixation and antibody staining of imaginal discs and embryos were performed as described (Belenkaya et al., 2002b; Belenkaya et al., 2008). Fixation and antibody staining in cultured cells were performed as described (Belenkaya et al., 2008). Extracellular Wg staining was performed as described (Strigini and Cohen, 2000). Polyclonal guinea pig anti-wg antibody was generated against a CBP fusion protein of Wg corresponding to amino acid residues of the whole protein. Other primary antibodies used include mouse anti-wg 4D4 (Iowa Developmental Studies Hybridoma Bank; IDSHB), guinea pig anti-senseless (Nolo et al., 2000), Rabbit anti-fz2 (Mathew et al., 2005), rabbit anti-hrs (Santa Cruz), rabbit anti-giantin (Covance), rabbit anti- Calnexin (Stressgen) and mouse anti-v5 (invitrogen). Luciferase assay Drosophila S2 cells were used in the luciferase reporter assay. Transfections were performed in 24-well plates using Effectene transfection reagent (QIAGEN). For autocrine activation luciferase assay, TOPFlash-like luciferase reporter dtf12 (DasGupta et al., 2005) and the normalization vector Po1IIIRL (40:1 ratio) were transfected along with plasmids expressing dfz2 and equal amounts of plasmids expressing different Wingless variants respectively. 48 hours later, cells were lysed and luciferase activities were measured using Dual-Luciferase Assay Kits (Promega). For paracrine activation luciferase assay, the donor cells were co-transfected with different Wg expression vectors and Po1IIIRL normalization vectors while the receiving cells were co-transfected with dtf12 and a plasmid encoding dfz2. 40 hours later, the donor cells and the receiving cells were mixed together and co-cultured for another 24 hours before the luciferase activities were measured. 50

52 Cell Culture, co-immnoprecipitation (co-ip), and Western Blotting Drosophila S2 cells were maintained as described (Belenkaya et al., 2008). Coimmunoprecipitation in S2 cells was performed as described (Belenkaya et al., 2008). The primary antibodies used for western blotting were rabbit anti-v5 (Sigma, 1:1000), mouse anti-v5 (Invitrogen, 1:1000) and mouse anti-wg 4D4 (IDSHB, 1:400). Band intensity in the immunoblot membranes was quantified using Labworks image analysis software (UVP Inc., CA). Data collected from three independent experiments were subject to statistical analysis. Cell labelling Drosophila S2 cells transfected with a plasmid encoding V5 tagged-dfz2 were reseeded into an 8-well chamber slide (Lab-Tek II). Conditioned media from cells transfected with plasmids encoding Wg or WgC93A or WgS239A were collected and applied to dfz2-expressing cells in individual wells respectively. The cells were incubated on ice for 3 hrs before immunostaining. Identical staining procedures and confocal settings were used to examine the levels of dfz2 expression and Wg accumulation in each sample. Confocal images of single sections were captured and the fluorescence intensity was quantified using Photoshop (Adobe Systems, San Jose, CA). 51

53 Results 1. N-glycosylation is dispensable for Wg signaling and secretion Wg protein was reported to have two major N-glycosylation sites, Asn103 and Asn414 (N103, N414) (Tanaka et al., 2002). To examine the in vivo functions of these two N-glycosylation sites, we generated Wg mutants containing single or double amino acid substitutions, WgN103Q (N103 converted to Gln), WgN414S (N414 converted to Ser) and WgNN (combination of N103Q and N414S) (Supplementary Fig.1A). Consistent with previous report, while wild-type Wg exhibits two additional glycosylated bands in Western blots, WgNN was detected as a single non-glycosylated band in both transfected S2 cells and in wing disc cells (Supplementary Figs. 1B-D), indicating that Wg is normally glycosylated at N103 and N414. We first examined the activities of Wg variants in cultured Drosophila S2 cells by luciferase assays. To trigger autocrine Wg signaling, S2 cells were co-transfected with a dfz2-expressing plasmid, a luciferase reporter plasmid and expression constructs encoding either wild-type or mutant Wg proteins. To activate paracrine Wg signaling, donor cells expressing different Wg variants were co-cultured with receiving cells transfected with a dfz2-expressing plasmid and a luciferase reporter plasmid. Glycosylation-deficient Wg variants can activate downstream signaling in both assays (Figs. 1A, B) although a relatively mild reduction was observed when compared to wild-type Wg (reduced by 20% for autocrine signaling and 40% for paracrine signaling). To further evaluate the in vitro observations, we generated transgenic flies expressing Gal4- inducible wild-type Wg or various Wg mutants deficient in certain post-translational modifications. All transgenic lines express comparable levels of Wg proteins, which is confirmed 52

54 by Western blots and immuno-staining (data not shown). Consistent with the data from cell culture, three lines of evidence suggest that N-glycosylation is not essential for Wg signaling in multiple developmental contexts. First, Wg proteins deficient in single or double glycosylations are capable of patterning embryonic epidermis via autocrine signaling. The ventral cuticles of wild-type embryos are characteristic of a repeated pattern of denticle belts interspersed by naked cuticles (Fig. 1C). It has been shown that activation of the Wg pathway is sufficient for the formation of naked cuticles (Lawrence et al., 1996; Noordermeer et al., 1994). As expected, daughterless-gal4 (da Gal4 )-driven over-expression of wild-type Wg resulted in replacement of ventral belts with naked cuticles (Fig. 1D). Similar cuticle phenotypes were obtained with da Gal4 - driven expression of all three glycosylation mutants (Figs. 1G-I). Since da Gal4 is ubiquitously expressed in the embryos (Wodarz et al., 1995), this result indicates that non-glycosylated Wg is active in Wg autocrine signaling. Second, under more stringent conditions, we examined Wg paracrine signaling induced by different Wg variants in embryonic cuticle patterning. single minded (sim) is a gene specifically expressed in the midline neuroepithelium of the embryos (Thomas et al., 1988) (Fig. 1K). sim Gal4 -driven expression of wild-type Wg can rescue the formation of naked cuticles in the ventral ectoderm of Wg-null embryos (Fig. 1N). Here paracrine Wg signaling is required for the rescuing effect as Wg ligands need to act cell-nonautonomously in the neighboring tissue. As such, armadillo.s10 (arm.s10) which induces cellautonomous constitutively-active Wg signaling independent of a Wg ligand (Pai et al., 1997), failed to restore naked cuticle formation (Fig. 1M). However, the unglycosylated Wg, WgNN, retained a reduced yet significant degree of rescuing capacity which was reflected by a smaller range of naked cuticles formed in the ventral midline (Fig. 1Q). Third, we compared the ability of wild-type and mutant Wg proteins to induce downstream gene expression in the wing 53

55 imaginal discs. In the third-instar larval wing disc, Wg is produced in a narrow strip of cells along the dorsoventral (DV) border. In regions proximal to the border, the short-range target Senseless (Sens) is expressed (Figs. 2A, B-B ). In this analysis, WgNN displayed signaling activity similar to wild-type Wg, demonstrated by strong induction of ectopic Sens expression (Figs. 2C-C, F-F ). Taken together, the above results suggest that N-glycosylation is dispensable for Wg secretion and signaling. 2. S239, but not C93, is required for Wg signaling Using similar assays, we also examined the effects of lipidation on Wg signaling activities. Single acyl-deficient Wg was made by replacement of the essential residues with alanine; Cys93 to Ala in WgC93A and Ser239 to Ala in WgS239A, respectively (Supplementary Fig. 1A). Both lipidation mutants are produced and modified normally as they show glycosylation patterns similar to that of the wild-type counterpart (Supplementary Fig. 1B). In cultured S2 cells, only a mild reduction of luciferase activities was observed in WgC93A in both autocrine and paracrine assays (Figs. 1A, B). Similarly, WgC93A was able to induce the formation of naked cuticles in the embryos via cell-autonomous signaling (Fig. 1E) and cell-non-autonomous signaling (Fig. 1O). Furthermore, in wing discs, WgC93A functioned to stimulate Sens expression similar to that in wild-type Wg (Figs. 2C-D ). Together, these data demonstrate that WgC93A still maintains major Wg signaling activities, suggesting that palmitoylation at C93 is not essential for Wg signaling. Importantly, we found that in contrast, WgS239A mutants showed poor signaling activities. In S2 cells, WgS239A acts weakly to stimulate the Wg luciferase reporter in both autocrine and paracrine activation assays (Figs. 1A, B). Consistent with these data, in the embryos, expression of WgS239A was not able to activate the downstream signaling required for the formation of 54

56 naked cuticles (Figs. 1F, P). Further analysis in the wing discs revealed only residual signaling activity of this mutant as reflected by the minimal levels of ectopic Sens induction (Figs. 2E-E ). Taken together, both in vitro and in vivo results argue that S239, but not C93 is important for Wg signaling. 3. WgS239A has reduced affinity for Frizzled 2 receptor As shown above, WgS239A displayed markedly reduced signaling activities. Next, we examined the mechanisms underlying these signaling defects. One hallmark for normal Wg signaling is Wg punctuates in the receiving cells due to endocytosis following receptor interaction (Figs. 3A-A ). The absence of such punctuate structures in cells surrounding S239A-expressing clones (Figs 3C-C ) implies one possibility that Wg lacking the critical serine cannot be secreted normally and therefore fails to reach the cell surface to initiate downstream signaling, similar to the serine mutant of Wnt3a (Takada et al., 2006). To test this, we employed an extracellular staining protocol which only detects proteins on the cell surface and in the extracellular matrix (ECM). Following protein expression in the dorsal compartment of the wing discs by ap Gal4, we assessed the pool of secreted Wg by the extracellular staining and the pool of total Wg by conventional staining (Figs. 3E-E ). HA-tagged WgC93A, which has been shown to be retained in the ER (Franch-Marro et al., 2008a), was included as a negative control. As expected, no signal of HA- WgC93A was detected by extracellular staining (Figs. 3G-G ). Contrary to this, we observed similar extracellular accumulation of wild-type Wg and WgS239A in the dorsal compartment (Figs. 3E-F ). In a second experiment, we examined secreted WgS239A protein in S2 cells. WgS239A could be retrieved from both the cell lysate and the conditioned medium of transfected S2 cells to the same extent as wild-type Wg and WgC93A mutant (Fig. 3H). 55

57 Together, these data strongly suggest that WgS239A is still able to progress through the secretory pathway and be secreted from its producing cells. As WgS239A secretion is not blocked, we ask whether the poor action of WgS239A is due to its disrupted interaction with dfz2 receptors. We adapted two assays to examine Wg-dFz2 interaction. First, we conducted a co-immunoprecipitation (co-ip) experiment to examine the complex formation between WgS239A and dfz2. We co-expressed full-length V5-tagged dfz2 with WgC93A, WgS239A or its wild-type counterpart in S2 cells. The portion of dfz2 interacting with Wg was detected by Western blotting in the immunoprecipitate of Wg from the cellular lysate. We observed a dramatic reduction in dfz2 binding when S239 is mutated, while some reduction was also found in WgC93A mutant (Fig. 4A and quantification in 4B). We further examined the interaction of Wg and WgS239A with dfz2 using a cell-labeling assay. In this assay, S2 cells transfected with a dfz2-expressing plasmid were split into three samples, each of which was incubated for a short period with similar amounts of wild-type Wg, WgC93A or WgS239A respectively (confirmed by western blots shown in Fig. 4F). Cells were alive and minimal endocytosis could occur as samples were kept in ice-cold water during incubation. Expression of dfz2 caused accumulation of exogenous Wg on the cell surface, which was revealed by extracellular staining. Representative data were shown in Figs. 4C-E and quantified in Fig. 4G. Consistent with co-ip results, similar levels of dfz2 trapped considerably more wildtype Wg than WgS239A mutant (Figs. 4B-C ). Although we cannot exclude other roles of S239 in Wg signaling, our data presented here suggest that acylation of Wg at S239 is involved in promoting binding to the dfz2 receptor. 4. Removal of double lipidation abolishes Wls-dependent Wg secretion 56

58 The observation that both WgC93A and WgS239A can be secreted normally led us to test the secretion and signaling of the double-acyl-deficient Wg, WgC93AS239A (WgCS). WgCS failed to signal in both S2 cells and in embryos (Figs. 5A, B). Similarly, in the wing disc, the signaling activity of WgCS was also completely abolished (Figs. 5C-C ). Importantly, we found that WgCS failed to reach the surface of the wing disc cells and cultured S2 cells when examined by the extracellular staining protocol (Figs. 6A-D ). Consistently, WgCS was absent from the medium of the S2 cells transfected with the expression construct (Fig. 6E). Taking all of these data together, we conclude that lipidation of Wg is essential for its secretion, and single lipidation at either C93 or S239 is sufficient to fulfill this requirement. In light of the essential role of Wls in Wg secretion, we next tested whether reduction of lipidation alters the interaction between Wls and Wg. In wing disc cells co-expressing wild-type Wg and V5-tagged Wls, these two proteins co-localized well in vesicular structures (Figs. 7A- A ), possibly representing secretory vesicles. In addition, co-expression of wild-type Wg caused an apical redistribution of Wls (Fig. 7A ) (Port et al., 2008). In contract, WgCS shows reduced co-lozalization with Wls and fails to redistribute Wls (Figs. 7D-D ), providing another piece of evidence for impaired interaction. The physical interaction between Wg and Wls was further tested in S2 cells by co-ip assay. Western blot analysis revealed that while normal binding to Wls maintained after removal of a single lipid modification, a double lipidation deficiency abolished the Wg-Wls interaction (Fig. 7E, F). Therefore, our study suggests that the overall lipidation levels at C93 and S239 are required for the interaction of Wg with Wls, and therefore for Wg secretion. 57

59 Discussion Lipidation and N-glycosylation are widely found in many Wnt members. In this paper, we systematically analyzed the in vivo roles of all known post-translational modifications of Wg. The principal findings of this study include: (1) Wg mutant devoid of all N-glycosylations exhibits no major defects in either secretion or signaling; (2) lipidation at S239 but not at C93 is critical for Wg signaling; (3) while WgC93A and WgS239A mutants can be secreted, removal of both acyl groups renders Wg incapable of interacting with Wls, resulting in its secretion defect. Roles of N-glycosylation in Wg signaling Consistent with the recent work on mouse Wnt1(Doubravska et al., 2011), un-glycosylated Wg in our assays can be readily secreted and can actively signal in cultured cells and in various developmental contexts. Although we did observe some reduction in signaling compared to wildtype Wg, the fact that wg Gal4 -driven expression of WgNN in wg mutant background can significantly restore naked cuticle formation strongly argues that WgNN is fairly functional (Supplementary Fig. 3F). Previous studies demonstrated that glycosylation deficient Wnt3a and Wnt5a are defective in secretion (Komekado et al., 2007; Kurayoshi et al., 2007). Thus our results, along with the previous study on Wnt1, strongly suggest that the involvement of glycosylation in secretion is not a common mechanism among different Wnt members. It is important to note that Wg glycosylation patterns are virtually identical among wild-type Wg, WgC93A, WgS239A and WgCS (Figs. 3H, 6E), indicating that Wg can be glycosylated even in the absence of lipidation at C93 and S239. On the other hand, un-glycosylated Wg probably undergoes normal lipid modification, as a deficiency in lipidation of this Wg mutant would be expected to cause signaling and/or secretion defects. Thus, based on our data and other studies 58

60 on Wnt1, we suggest that lipidation and N-glycosylation are likely to be two independent processes, at least for the modifications which occur at sites examined in this paper. Roles of lipidation in Wg signaling Previous work suggests that palmitate at the conserved cysteine is dedicated to signaling activity by affecting the affinity for Frizzled receptors (Franch-Marro et al., 2008a; Galli et al., 2007; Komekado et al., 2007; Kurayoshi et al., 2007), while palmitoleic acid at the conserved serine is dedicated to secretion (Takada et al., 2006). Here we show that Wg lipidation at S239, but not at C93 appears to be important for Wg signaling. Our results also show that Wg secretion is impaired only when both sites are mutated. The differences between our results and the previous data suggest that despite the similar role in Wnt signaling (to promote Frizzled interaction), the nature and site(s) of lipid modification might be flexible among different Wnt members. In addition, a recent study on mouse Wnt1 and Wnt3a suggest that lipidation at the essential serine is a prerequisite for the subsequent lipid attachment at the cysteine residue (Doubravska et al., 2011). However, based on the different behaviours of WgC93A, WgS239A and WgCS, our data suggest that lipid modifications at these two sites are mutually independent. We show that WgS239A has a markedly reduced ability to interact with dfz2, suggesting that lipidation at S239 promotes binding to dfz2, thereby regulating Wg signaling activity. The impaired WgS239A-dFz2 interaction is the main mechanism underlying the signalling defects of WgS239A, at least for its cell-autonomous action. It is also worth to note that the binding of WgC93A with dfz2 is also significantly reduced, which might be one reason why this mutant is not as active as wild-type. It is still possible that the acyl group at S239 may regulate other aspects of the Wg pathway. For example, palmitoleic acid at S239 may act to facilitate binding to HSPGs and/or lipoproteins particles, which have been shown to help establish the Wg gradient 59

61 (Baeg et al., 2001; Han et al., 2005; Lin, 2004; Panakova et al., 2005). Consistent with this, although WgS239A can reach the cell surface, it cannot spread as effectively as wild-type Wg to neighbouring cells (Fig. 3F). Further studies are needed to determine other roles of S239 in Wg signaling. Role of lipidation in Wg secretion One important observation of this work is that removal of both lipid adducts at C93 and S239 sites renders Wg incapable of secretion. Importantly, we show that WgCS mutant exhibits a drastic reduction in its interaction with the Wls protein, arguing that a failure to interact with Wls might be a major mechanism underlying the secretion defect of WgCS in both cultured cells and the wing discs. However, the requirement of S239 for Wls recognition is somewhat different in vivo and in cultured cells: WgS239A interacts with Wls normally (Figs. 7E, F) and is secreted readily by S2 cells (Fig. 3H), while its colocalization with Wls and its effect on Wls relocalization are both defective in wing disc cells (Figs. 7C, C ), although it can still reach the cell surface (Fig. 3F). One possible explanation is that polarized cells may have a more stringent requirement for Wls recognition and Wg routing for secretion. Lipidation is probably a general requirement for Wnt binding to Wls as Wnt3A mutation at S209, Porcupine inhibition by either SiRNA or chemical inhibitors also lead to impaired Wnt-Wls interaction (Chen et al., 2009; Coombs et al., 2010). Intriguingly, recent work proposed a model that the first intralumenal loop of Wls contains a lipid-binding fold which is also present in the palmitate-binding lipocalin family of proteins (Coombs et al., 2010). Therefore, lipidation could be directly involved in the physical interaction of Wg with Wls. It appears that Wnts are designated to a dedicated secretory route which necessitates both the action of Wls and lipid modifications of Wnts. In support of this view, routing signal from the type I membrane protein Neurotactin could not shunt Wg to 60

62 other Wls-independent secretory pathways (Banziger et al., 2006). In addition, a new Wnt member, WntD, which does not undergo any lipid-modification process, bypasses the dedicated secretion pathway and is secreted independent of Wls function (Ching et al., 2008). HAWgC93A and WgC93Y show strong loss of function Previous work demonstrated that a cysteine to alanine mutation at C93 impaired the signaling capacity of HA-tagged Wg and this HAWgC93A was defective in secretion in the wing disc cells but not in S2 cells (Franch-Marro et al., 2008a). In contrast, we found that without any tag, WgC93A was considerably active in signaling in Drosophila embryos, wing discs and cultured S2 cells. We have carefully re-examined the activity of HAWgC93A and confirmed the published data (Figs. 1A, 1J, 3G-G ). Thus, the unexpected discrepancy results from the HA tag insertion. In support of this view, we found that replacement of the HA tag by GFP in HAWgC93A can generate similar defects (data not shown). Together, these data suggest that insertion of specific protein tag such as HA and GFP at the N-terminal region of Wg might change its conformation and subsequently interfere with its activity. Another inconsistency in the literature comes from the wg S21 allele, which changes C93 into a tyrosine, is reported to be a strong loss of function allele (Willert et al., 2003). Indeed, when we examined WgC93Y in our systems, no signaling activities were detected in cultured cells (Supplementary Figs. 2A, B), embryos (data not shown) or wing discs (Supplementary Fig. 2E ). Considering the remarkable signaling capacity of WgC93A, it is safe to conclude that while lipidation at C93 is not as important for protein function, a Cys to Tyr substitution may be deleterious for other reason(s). Interestingly, another WgS239 mutant, WgS239D, behaves indistinguishably from WgS239A (Supplementary Figs. 2A, B, F ), further proving the necessity of lipidation at WgS239 for a 61

63 functional protein. Thus, our data suggest that caution must be taken in functional studies when employing amino acid substitutions, and when introducing mutations in tagged proteins. Acknowledgements We thank the following: H. Bellen, S. Cumberledge and the Iowa Developmental Studies Hybridoma Bank (IDSHB) for antibodies; G. Struhl and T. Kadowaki for plasmids; G. Struhl and the Bloomington Stock Center for Drosophila stocks. This work was supported by grants from NIH (2R01 GM and 1R01GM087517), the National Basic Research Program of China (2011CB943901), and the Knowledge Innovation Program of the Chinese Academy of Sciences KSCX2-YW-R

64 References Baeg, G. H., X. Lin, et al. (2001). "Heparan sulfate proteoglycans are critical for the organization of the extracellular distribution of Wingless." Development 128(1): Banziger, C., D. Soldini, et al. (2006). "Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins from signaling cells." Cell 125(3): Bartscherer, K., N. Pelte, et al. (2006). "Secretion of Wnt ligands requires Evi, a conserved transmembrane protein." Cell 125(3): Belenkaya, T. Y., C. Han, et al. (2002). "pygopus Encodes a nuclear protein essential for wingless/wnt signaling." Development 129(17): Belenkaya, T. Y., Y. Wu, et al. (2008). "The retromer complex influences Wnt secretion by recycling wntless from endosomes to the trans-golgi network." Dev Cell 14(1): Brand, A. H. and N. Perrimon (1993). "Targeted gene expression as a means of altering cell fates and generating dominant phenotypes." Development 118(2): Brennan, K., T. Klein, et al. (1999). "Wingless modulates the effects of dominant negative notch molecules in the developing wing of Drosophila." Dev Biol 216(1): Cadigan, K. M. and Y. I. Liu (2006). "Wnt signaling: complexity at the surface." J Cell Sci 119(Pt 3): Cadigan, K. M. and M. Peifer (2009). "Wnt signaling from development to disease: insights from model systems." Cold Spring Harb Perspect Biol 1(2): a Chen, B., M. E. Dodge, et al. (2009). "Small molecule-mediated disruption of Wnt-dependent signaling in tissue regeneration and cancer." Nat Chem Biol 5(2): Ching, W., H. C. Hang, et al. (2008). "Lipid-independent secretion of a Drosophila Wnt protein." J Biol Chem 283(25): Clevers, H. (2006). "Wnt/beta-catenin signaling in development and disease." Cell 127(3): Coombs, G. S., J. Yu, et al. (2010). "WLS-dependent secretion of WNT3A requires Ser209 acylation and vacuolar acidification." J Cell Sci 123(Pt 19): DasGupta, R., A. Kaykas, et al. (2005). "Functional genomic analysis of the Wnt-wingless signaling pathway." Science 308(5723): Doubravska, L., M. Krausova, et al. (2011). "Fatty acid modification of Wnt1 and Wnt3a at serine is prerequisite for lipidation at cysteine and is essential for Wnt signalling." Cell Signal 23(5): Franch-Marro, X., O. Marchand, et al. (2005). "Glypicans shunt the Wingless signal between local signalling and further transport." Development 132(4): Franch-Marro, X., F. Wendler, et al. (2008). "In vivo role of lipid adducts on Wingless." J Cell Sci 121(Pt 10): Galli, L. M., T. L. Barnes, et al. (2007). "Porcupine-mediated lipid-modification regulates the activity and distribution of Wnt proteins in the chick neural tube." Development 134(18): Goodman, R. M., S. Thombre, et al. (2006). "Sprinter: a novel transmembrane protein required for Wg secretion and signaling." Development 133(24): Han, C., T. Y. Belenkaya, et al. (2004). "Distinct and collaborative roles of Drosophila EXT family proteins in morphogen signalling and gradient formation." Development 131(7):

65 Han, C., D. Yan, et al. (2005). "Drosophila glypicans Dally and Dally-like shape the extracellular Wingless morphogen gradient in the wing disc." Development 132(4): Hofmann, K. (2000). "A superfamily of membrane-bound O-acyltransferases with implications for wnt signaling." Trends Biochem Sci 25(3): Ito, K., W. Awano, et al. (1997). "The Drosophila mushroom body is a quadruple structure of clonal units each of which contains a virtually identical set of neurones and glial cells." Development 124(4): Kohn, A. D. and R. T. Moon (2005). "Wnt and calcium signaling: beta-catenin-independent pathways." Cell Calcium 38(3-4): Komekado, H., H. Yamamoto, et al. (2007). "Glycosylation and palmitoylation of Wnt-3a are coupled to produce an active form of Wnt-3a." Genes Cells 12(4): Kurayoshi, M., H. Yamamoto, et al. (2007). "Post-translational palmitoylation and glycosylation of Wnt-5a are necessary for its signalling." Biochem J 402(3): Lawrence, P. A., B. Sanson, et al. (1996). "Compartments, wingless and engrailed: patterning the ventral epidermis of Drosophila embryos." Development 122(12): Lin, X. (2004). "Functions of heparan sulfate proteoglycans in cell signaling during development." Development 131(24): Logan, C. Y. and R. Nusse (2004). "The Wnt signaling pathway in development and disease." Annu Rev Cell Dev Biol 20: MacDonald, B. T., K. Tamai, et al. (2009). "Wnt/beta-catenin signaling: components, mechanisms, and diseases." Dev Cell 17(1): Mason, J. O., J. Kitajewski, et al. (1992). "Mutational analysis of mouse Wnt-1 identifies two temperature-sensitive alleles and attributes of Wnt-1 protein essential for transformation of a mammary cell line." Mol Biol Cell 3(5): Mathew, D., B. Ataman, et al. (2005). "Wingless signaling at synapses is through cleavage and nuclear import of receptor DFrizzled2." Science 310(5752): Miura, G. I. and J. E. Treisman (2006). "Lipid modification of secreted signaling proteins." Cell Cycle 5(11): Neumann, S., D. Y. Coudreuse, et al. (2009). "Mammalian Wnt3a is released on lipoprotein particles." Traffic 10(3): Nolo, R., L. A. Abbott, et al. (2000). "Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila." Cell 102(3): Noordermeer, J., J. Klingensmith, et al. (1994). "dishevelled and armadillo act in the wingless signalling pathway in Drosophila." Nature 367(6458): Pai, L. M., S. Orsulic, et al. (1997). "Negative regulation of Armadillo, a Wingless effector in Drosophila." Development 124(11): Panakova, D., H. Sprong, et al. (2005). "Lipoprotein particles are required for Hedgehog and Wingless signalling." Nature 435(7038): Polakis, P. (2007). "The many ways of Wnt in cancer." Curr Opin Genet Dev 17(1): Port, F., M. Kuster, et al. (2008). "Wingless secretion promotes and requires retromer-dependent cycling of Wntless." Nat Cell Biol 10(2): Strigini, M. and S. M. Cohen (2000). "Wingless gradient formation in the Drosophila wing." Curr Biol 10(6): Takada, R., Y. Satomi, et al. (2006). "Monounsaturated fatty acid modification of Wnt protein: its role in Wnt secretion." Dev Cell 11(6):

66 Tanaka, K., Y. Kitagawa, et al. (2002). "Drosophila segment polarity gene product porcupine stimulates the posttranslational N-glycosylation of wingless in the endoplasmic reticulum." J Biol Chem 277(15): Thomas, J. B., S. T. Crews, et al. (1988). "Molecular genetics of the single-minded locus: a gene involved in the development of the Drosophila nervous system." Cell 52(1): van den Heuvel, M., C. Harryman-Samos, et al. (1993). "Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein." Embo J 12(13): Willert, K., J. D. Brown, et al. (2003). "Wnt proteins are lipid-modified and can act as stem cell growth factors." Nature 423(6938): Wodarz, A., U. Hinz, et al. (1995). "Expression of crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila." Cell 82(1): Yang, P. T., M. J. Lorenowicz, et al. (2008). "Wnt signaling requires retromer-dependent recycling of MIG-14/Wntless in Wnt-producing cells." Dev Cell 14(1):

67 Figures Figure 1. Signaling activities of wild-type and mutated Wg in cultured S2 cells and embryos. (A) Autocrine activation luciferase assay. Cells were co-transfected with plasmids encoding Wg (or Wg mutants), dfz2, Renilla luciferase and Firefly luciferase. Cell lysates were processed for topflash assay. (B) Paracrine activation luciferase assay. Donor cells were transfected with plasmids encoding Wg (or Wg mutants) and Renilla luciferase. Receiving cells were transfected with plasmids encoding dfz2 and Firefly luciferase. After two groups of cells were mixed and cocultured for a certain period, cell lysates were processed for topflash assay. In 66

68 both A and B, relative luciferase activities are reflected by the ratio of Firefly luciferase activity versus Renilla luciferase activity of the same sample lysate. (C-J) Autocrine Wg signaling in the embryos. Ventral cuticles of embryos over-expressing wild-type Wg or Wg mutants under the control of da Gal4. All embryos shown in this paper are oriented anterior to the left. (K-Q) Paracrine Wg signaling in the embryos. (K) Immuno-staining of GFP reporter indicates the expression of sim Gal4 in the ventral midline of the embryo. (L) Denticles are fused and form a lawn in Wg null embryos. (M-Q) Cuticle preparations from Wg null embryos rescued by armadillo.s10 (M), wild-type Wg (N), WgC93A (O), WgS239A (P) or WgNN (P) under the control of sim Gal4. 67

69 Figure 2. Signaling activities of wild-type and mutated Wg in the wing imaginal discs. (A) Schematic drawing of wing disc in the late third instar larvae showing A/P and D/V compartments. (B-B ) Wg-dependent Sens expression in the wild-type wing disc is in two narrow stripes abutting Wg-expressing cells. All confocal images in this paper are captured as single optical sections. (C-F ) Sens expression induced by wild-type Wg and Wg mutants. The expression of Wg variants (red) was driven by dpp Gal4 along the anterior-posterior boundary. 68

70 Sens activation indicates the short-range Wg signaling (green). All discs in this paper are oriented as shown in Figure 2A. 69

71 Figure 3. WgS239A is secreted by S2 cells and the wing disc cells. (A-D ) In somatic clones in the wing discs, wild-type and mutated Wg are expressed under the control of act Gal4. Note that the punctated structures are missing in cells surrounding the clones in C. (E-G ) Extracellular 70

72 distribution of wild-type Wg and lipidation mutants in wing discs. Wild-type and mutated Wg were over-expressed in the dorsal compartment of the wing disc under the control of ap Gal4. The extracellular distribution of Wg was detected by mouse monoclonal antibody and a guinea pig polyclonal antibody was applied to detect the overall expression levels of Wg. (H) Secretion of wild-type Wg and lipidation mutants in S2 cells. S2 cells were transfected with wild-type Wg and two lipidation mutants respectively. Both conditioned medium and lysate were collected and processed for Western blots. 71

73 Figure 4. The weaker binding of WgS239A with dfz2 receptor. (A) Co-IP assay. S2 cells were transfected with plasmids encoding wild-type Wg (or WgS239A) and V5-tagged dfz2 (dfz2-v5). Cell lysates were immunoprecipitated and then analyzed by Western blotting with the antibodies indicated. IP, immunoprecipitation; IB, Immunoblot. (B) Quantification of the intensity of the co-precipitated dfz2 bands from co-ip assay in A. The relative intensity (ratio of mutants to wild-type) is shown as mean±s.d. (n= 3, *P<0.05, ** p<0.01 and *** p<0.001, t-test) 72

74 (C-E ) Cell labeling assay. S2 cells transfected with a dfz2-v5 expression vector were equally split into three samples. Each sample was incubated with the conditioned medium containing similar amount of wild-type Wg (C-C ) or WgC93A (D-D ) or WgS239A (E-E ). Wg proteins trapped on the cell surface by dfz2 were determined by Wg staining. (F) Amount of Wg variants in the conditioned media in the cell labeling assay was determined by Western blotting. Similar protein levels were detected. (G) Quantification of the Wg accumulation in cell labeling assay. Fluorescence intensities of Wg were normalized to the expression levels of dfz2 in individual cells. The relative dfz2 binding (ratio of mutants to wild-type) is shown as mean±s.d. (n[field of view]=5 7, *P<0.05, ** p<0.01 and *** p<0.001, t-test) 73

75 Figure 5. Removal of double lipidation abolishes Wg signaling activity. The signaling activities of WgCS were examined by the luciferase reporter in S2 cells (A), cuticle patterning in embryos (B) and Sens induction in wing imaginal discs (C-C ). Same experiments were done as shown in Figure 1 and Figure 2. 74

76 Figure 6. WgCS is retained in the producing cells. (A-B ) Extracellular distribution of wildtype Wg (A-A ) and WgCS (B-B ) in transfected S2 cells. (C-D ) Extracellular distribution of wild-type Wg (C-C ) and WgCS (D-D ) in wing discs. Expression of Wg variants in the wing disc was driven by ap Gal4. The membrane-associated WgCS was barely detectable in transfected cells and in wing disc cells. (E) Secretion of wild-type Wg and WgCS in S2 cells. Minimal amount of WgCS was present in the conditioned medium. A dsred expression vector was cotransfected and blotted as a control for transfection efficiency. 75

77 Figure 7. Lipidation promotes the interaction of Wg with Wls. (A-D ) Subcellular localization of Wls-V5 co-expressed with wild-type Wg or lipidation mutants in wing disc cells. Regions far from endogenous Wg pool at the DV boundary were selected for images. (E) Co-IP of Wls with Wg variants. S2 cells were transfected with plasmids encoding V5-tagged Wls without (panel 1) or with one of the four Wg variants (panel 2-4). Cell lysates were 76

78 immunoprecipitated and then analyzed by Western blotting with the antibodies indicated. (F) Quantification of the intensity of the co-precipitated Wls bands from co-ip assay in E. The relative intensity (ratio of mutants to wild-type) is shown as mean±s.d. (n= 3, ** p<0.01) 77

79 Sup. Figure 1. Diagram of plasmid construction and the post-translational modification of Wg variants. (A) Schematic diagram of Wg proteins, indicating specific mutated sites. (B) Cell lysates from S2 cells transfected with plasmids expressing wild-type or mutant Wg were collected and processed for Western blots. Note that the two glycosylated bands (bands 2 and 3) are present in wild-type Wg, WgC93A and WgS239A but are missing in WgNN. (C) Cell lysates from S2 cells transfected with plasmids expressing wild-type or mutant Wg were collected and split equally into two portions. Both mock treated and PNGase F (Peptide-N-Glycosidase F, an enzyme which removes N-glycosylation) treated samples were analyzed by Western blots. (D) Wing discs with the genotype vg Gal4 /UAS-Wg variants were lysed in SDS buffer and the lysates were processed for Western blots. A PNGase F treated sample (WgN414S) was included. Wing discs of vg Gal4 /+ were used as the control. About 40 discs were used for each sample. The asterisk indicates the band from endogenous Wg. 78

80 Sup. Figure 2. The HA tag in combination with the removal of lipidation at C93 abolishes the signaling activities of Wg. The signaling activities of Wg variants in transfected S2 cells were determined by autocrine activation luciferase assay (A) and paracrine activation luciferase 79

81 assay (B). (C-F ) In the wing discs, ectopic expression of Wg mutants was driven by dpp Gal4 and Sens induction was examined by immunostaining. 80

82 Sup. Figure 3. Wg mutant cuticle phenotype rescued by expression of Wg variants driven by wg Gal4. Cuticle preparation from wild-type embryos (A), Wg null embryos (B) and Wg null embryos rescued by wild-type Wg (C), WgC93A (D), WgS239A (E) or WgNN (F) under the control of wg Gal4. 81

83 Chapter III Role(s) of ubiquitination and deubiquitination in Wls-dependent Wingless secretion Xiaofang Tang a, Lorraine Ray a, Guolun Wang b, Xinhua Lin a,b a Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, and The Graduate Program in Molecular and Developmental Biology, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA b State Key Laboratory of Biomembrane and Membrane Biotechnology, and Key Laboratory of Stem Cell and Developmental Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, , China 82

84 Abstract Secreted Wnt molecules are generally involved in development, adult homeostasis and diseases. It has been demonstrated that Wnt secretion requires the dedicated cargo receptor Wntless (Wls) which transfers Wnt from the Golgi to the plasma membrane. After endocytosis, Wls is subject to lysosome-dependent degradation and the retromer complex recycles Wls from endosomes to the trans-golgi network (TGN). Despite the current understanding about Wls-mediated Wg secretion, it is still unclear how Wls helps Wnt release from the producing cells. Particularly, given the hydrophobic nature of Wnt molecules, how Wls aids in the preparation of functional and diffusible Wnts remains a mystery. Here we provide evidence that the Drosophila Wls undergoes ubiquitination on the cell surface and the ubiquitin modification is important to control Wls stability and intracellular trafficking. We show that the ubiquitination-free form of Wls accumulates inside of the cells and fails to stimulate effective Wg secretion both in the wing disc and in cultured S2 cells. Furthermore, from a genetic RNAi screen, we identified two essential components in the control of Wls ubiquitiation, the E3 ligase Su(dx) and the deubiquitinating enzyme USP8. Consistently, reduction of Su(dx) function stabilizes Wls and meanwhile impairs Wg secretion. Taken together, our study demonstrates a novel role of ubiquitination in the trafficking of Wls and the rerouting of Wg following Wls endocytosis. 83

85 Introduction During development, Wnt molecules act as morphogens which can spread several cell diameters to control tissue patterning (Neumann and Cohen, 1997; Strigini and Cohen, 2000; Zecca et al., 1996). In the Drosophila wing imaginal disc, Wingless (Wg) expression is induced in a narrow strip of cells at the dorsal-ventral (DV) compartment boundary. From its site of synthesis, Wg spreads symmetrically and forms a long-range extracellular gradient. As a morphogen, Wg activates target gene expression in a dose-dependent manner: close to the Wg source, high-level target genes such as senseless (sens), achaete, and neuralized are induced; in a broader range up to 20 cell diameters, the distalless (dll) gene is expressed; in most of the prospective wing, the low-level target gene, vestigial (vg) is expressed. As a paradox to its long-range distribution, Wnt proteins undergo porcupine-mediated lipid modification and are rather hydrophobic, leading to their tight association with the plasma membrane (Takada et al., 2006; Willert et al., 2003). There must be a mechanism to help Wnts travel through the aqueous extracellular environment. And it is likely that Wnts as they go through the secretory route are packaged in a way that facilities the subsequent spreading after release from the producing cells. Recently, as more and more studies have been directed to the Wnt secretory routes, it is increasingly evident that Wnts are secreted via a dedicated transport program. Following lipidation in the endoplasmic reticulum (ER), Wnts are exported to the Golgi with the help of p24 proteins (Buechling et al., 2011; Port et al., 2011). Subsequently, Wntless (Wls, also known as Evi or Srt) binds Wnts and helps send Wnt proteins from the Golgi apparatus to the cell surface. It has been demonstrated that the function of Wls in Wnt secretion is conserved from C. elegans to Drosophila and vertebrates (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006). As a specific cargo receptor, Wls recognizes Wnts in a way 84

86 dependent on their lipid modifications (Coombs et al., 2010; Herr and Basler, 2012; Tang et al., 2012). After endocytosis, the retromer complex recycles Wls from endosomes to the trans-golgi network (TGN) by retrograde transport (Belenkaya et al., 2008; Franch-Marro et al., 2008b; Pan et al., 2008; Port et al., 2008; Yang et al., 2008). This process depends on the endosomal sorting nexin 3 (SNX3), which functions as a cargo specific component in the retromer complex (Harterink et al., 2011; Zhang et al., 2011), and MTM-6/MTM-9 myotubularin lipid phosphatases complex, which functions to dephosphorylate phosphatidylinositol-3-phosphate (Silhankova et al., 2010). Furthermore, recent work suggested that endosomal entry is also important for the release of Wnts from Wls in secretory particles (Coombs et al., 2010), which raised the importance of further investigations into the processes of Wls trafficking and their roles in Wnt secretion. Very interestingly, recent work proposed a model of the secretion of active Wg in exosomes in the wing discs and in cultured S2 cells. Exosomes are secreted membranous microvesicles that are produced in multivesicular bodies (MVBs) and released into the extracellular space (Johnstone, 2006; Simons and Raposo, 2009). They isolated exosomes from cultured cells by biochemical fractionation and found both Wg and Wls in these microvesicles (Beckett et al., 2012; Gross et al., 2012). There is also evidence demonstrating that Wg loading on to exosomes depends on Wls activity and ESCRT-regulated MVB function (Beckett et al., 2012; Gross et al., 2012). However, since Wls depletion blocks Wg progression in the secretory route at steps as early as Golgi, and many proteins involved in exosome generation generally affect cellular trafficking machinery, it is difficult to further investigate Wnt secretion on exosomes and how important the process is. Here we provide evidence that the Drosophila Wls is ubiquitinated on the cell surface and ubiquitination is important to control Wls levels and its trafficking following endocytosis. 85

87 Moreover, ubiquitination of Wls regulates Wg secretion probably through rerouting Wg after its internalization from the plasma membrane. Specifically, we genetically identified the main enzymes involved in Wls ubiquitination, the E3 ligase Su(dx) and the deubiquitinating enzyme USP8. Both molecules are conserved between Drosophila and vertebrates. Su(dx), a membranebound HECT E3 ligase, was identified as a negative regulator of Notch signalling possibly through promoting Notch ubiquitination, endocytosis and degradation (Cornell et al., 1999; Fedoroff et al., 2004; Fostier et al., 1998; Jennings et al., 2007; Mazaleyrat et al., 2003). USP8 is an endosomal deubiquitinating enzyme whose activities have been shown to help shunt internalized membrane proteins from lysosomal degradation to recycling (Alwan and van Leeuwen, 2007; Niendorf et al., 2007; Row et al., 2007; Row et al., 2006). Several substrates of USP8 have been reported, including receptor tyrosine kinases (RTKs), ligand-activated epidermal growth factor receptor (EGFR) and Frizzled 2 (Fz2) and Smoothened (Alwan and van Leeuwen, 2007; Mizuno et al., 2005; Mukai et al.; Niendorf et al., 2007; Row et al., 2007; Row et al., 2006). Consistent with this, subsequent experiments with Su(dx) and USP8 established roles of these two molecules in the control of Wg transport via regulating Wls trafficking. 86

88 Materials and Methods Wls constructs and transgenes The following Wls variants bear mutations to the Drosophila Wls gene as indicated: Wls- 1(Y435A), Wls9KR (K338R, K412R, K420R, K442R, K455R, K463R, K468R, K540R, K590R), Wls9KR (all 9KR mutations plus Y435A). All mutations were introduced using QuikChange Multi Site-Directed Mutagenesis Kit (STRATAGENE) according to the manufacturer s protocol. All Wls mutants were subcloned into the puast-attb vector and injected into 51C site on the second chromosome for expression in transgenic flies. The constructs pmt-gal4, pmt-su(dx) and pmt-su(dx)δhect were requested from Dr. Martin Baron and have been previously described (Djiane et al., 2011). The constructs puast- HAUSP8 and puast-hausp8c>s were requested from Dr. Jianhang Jia and have been previously described (Xia et al., 2012). Luciferase assay for Wg secretion To examine the effects of expression of certain proteins on Wg secretion, we used the WgRluc/sFluc system as described before (Port et al., 2011). Briefly, Drosophila S2 cells in 12- well plates were transfected with WgRluc (Wg-renilla luciferase fusion protein) and sfluc (a secreted form of Firefly luciferase) together with pac-gal4 and UAS-transgene. Luciferase activities were measured using Dual-Luciferase Assay Kits (Promega) in both the conditioned medium and cell lysate 48 hours after transfection. Fly genetics Ectopic expression of transgenes and RNAi was achieved by the Gal4/UAS system (Brand and Perrimon, 1993). engal4, engal4 UAS-dcr2, hhgal4, apgal4, WglacZ strains were described in 87

89 Flybase and crosses were kept at 25 C. y w flp; Act>y+>Gal4 UAS-CD8GFP (Ito et al., 1997) was used to induce the expression of Wg transgenes in CD8GFP-marked random clones in the wing discs. UAS-Su(dx) and UAS-Su(dx)ΔHECT flies were requested from Dr. Martin Baron and have been previously described (Djiane et al., 2011). The UAS-USP8 and UAS-USP8C>S were requested from Dr. Jianhang Jia and have been previously described (Xia et al., 2012). Su(dx) RNAi line (v21814) and USP8 RNAi lines (v8931 and v107623, similar phenotypes when crossed with Gal4 lines) were purchased from Vienna Drosophila RNAi Center (VDRC). srt was used as a null allele of Wls and has been previously described (Goodman et al., 2006). The two Su(dx) alleles Su(dx)32 and Su(dx)2 were obtained from the Bloomington Drosophila Stock Center. A null allele of Su(dx) was generated by P element mediated imprecise excision from P(SUPor-P)Su(dx)KG02902, which deletes 1800 bp including the start codon and the first three exons. The USP8 knockout allele was requested from Dr. Satoshi Goto (Mukai et al., 2010). Imaginal disc clones of mutant cells marked by the absence of CD8-GFP marker were generated by the FLP-FRT method as described (Belenkaya et al., 2002a). Cell Culture, Transfection, Immunoprecipitation, Western Blot Drosophila S2 cells were maintained as described (Belenkaya et al., 2008). Transfections were carried out using Effectene transfection reagent (Qiagen). Co-immunoprecipitation in S2 cells was performed as described (Belenkaya et al., 2008). The primary antibodies used for western blotting were rabbit anti-wls (Port et al., 2008), rat anti-ha 3F10 (Roche) and mouse anti ubiquitin P4D1 (Santa Cruz). To induce transgenes cloned in pmt vector (pmt-gal4, pmt- Su(dx) and pmt-su(dx)δhect), CuSO 4 (0.5mM final concentration) was added to the cells 24 hours after transfection and the cells were grown for another 24 hours before being lysed. 88

90 Hot lysis protocol was used to examine the levels of ubiquitinated Wls. S2 cells were transfected with Wls or its variants and then lysed with denaturing buffer (1% SDS, 20 mm Tris, ph 7.5, 1 mm EDTA) and incubated at 100 C for 5 min. After shearing with 27G needle for 3-5 times, the lysates were boiled again at 100 C for 3 min. Supernatants were collected after centrifugation at 15,000 rpm and then subjected to immunoprecipitation with Wls antibody after 7-fold dilution with regular lysis buffer (1% Triton X-100, 20 mm Tris, ph 7.5, 1 mm EDTA, 150 mm NaCl). Imaginal disc and cell immunostaining Fixation and antibody staining of imaginal discs were performed as described (Belenkaya et al., 2002b; Belenkaya et al., 2008). Fixation and antibody staining in cultured cells were performed as described (Belenkaya et al., 2008). Extracellular Wg staining was performed as described (Strigini and Cohen, 2000). Primary antibodies used include mouse anti-wg 4D4 (Iowa Developmental Studies Hybridoma Bank; IDSHB), guinea pig anti-wg (Tang et al., 2012) and rabbit anti-wls (Port et al., 2008). 89

91 Results 1. Wls undergoes ubiquitination on the cell surface This study was initiated from a single observation that Drosophila Wls protein displayed high molecular weight smears when examined by Western blot, implying that Wls could potentially be ubiquitinated. To further explore this possibility, we examined Wls ubiquitination in S2 cells using an immunoprecipitation assay. We found that in cells cotransfected with an HA-tagged Ubiquitin construct (HAUb), Wls ubiquitination was detected by an anti-ha antibody meanwhile Wls could also be retrieved from the immunoprecipitate of HA antibody (Fig. 1A), further proving that Wls indeed undergoes ubiquitination. Ubiquitination of proteins regulates numerous biological processes including intracellular trafficking, protein function and degradation (Hicke and Dunn, 2003; Mukhopadhyay and Riezman, 2007; Staub and Rotin, 2006; Traub and Lukacs, 2007). Ubiquitination is a reversible post-translational modification in which a 76 amino acid ubiquitin polypeptide is primarily attached to certain lysine residue(s) in target proteins or in ubiquitin itself. To investigate the roles of Wls ubiquitination, we made an ubiquitination-free form of Wls by converting all nine intracellular lysines into arginines, namely Wls9KR. Moreover, in light of the importance of intracellular trafficking in the control of Wls levels, we also made an internalization-defective Wls variant, Wls-1, which has disrupted endocytosis motif (mutated from YEGL to AEGL) (Gasnereau et al., 2011). Likewise, Wls9KR-1 is made which bears the combination of internalization mutation and all nine lysine conversions and is supposed to be defective in both ubiquitination and endocytosis. Western blotting data with lysates from S2 cells transfected with these constructs is shown in Fig. 2. First, consistent with previous findings (Gasnereau et al., 2011), blockage of Wls endocytosis by mutating the conserved internalization signal led to Wls 90

92 stabilization (compare Fig.1B lane 3 to lane 2, top panel). Second, removal of ubiquitination by 9KR mutations also stabilized Wls (compare Fig. 1B lane 4, 5 to lane 2, top panel). Third, Wls ubiquitination could be readily detected by a commercial anti-ub (P4D1) antibody, and the ubiquitinated Wls proteins were dramatically stabilized by the internalization defect of Wls-1 (compare Fig. 1B lane 3 to lane 2, middle panel), suggesting that Wls is ubiquitinated on the plasma membrane and ubiquitination leads to protein degradation follow endocytosis. Finally, mutations at nine lysine residues indeed removed the majority of Wls ubiquitination (compare Fig. 1B lane 5 to lane 3, middle panel) and shifted Wls bands to smaller molecular weights (compare Fig. 1B lane 4 to lane 2, top panel), indicating that all or some of these lysine residues are the primary sites for Wls ubiquitination. The presence of residual ubiquitination levels in Wls9KR and Wls9KR-1 might result from lysine-independent ubiquitin modifications, such as polyubiquitin attachment at the amino-terminus as reported in some noncanonical cases (Chen et al., 2010; Ikeda et al., 2002; Li et al., 2009; Sadeh et al., 2008). It is interesting to note that although 9KR mutation removes most ubiquitination, the mutant protein still showed smeary banding pattern (Fig. 1B lane 4,5 top panel), suggesting the existence of some unknown modification(s). 2. Ubiquitination of Wls regulates the release and transport of Wg We have shown biochemically that Wls is ubiquitinated. As Wls is essential for Wg secretion both in vivo and in cultured cells, we next set up to investigate whether Wls ubiquitination plays any role in the regulation of Wg release. For this purpose, we first compared the capacity of different Wls variants to promote Wg secretion in S2 cells. In Wg-luciferase reporter assay, S2 cells were transfected with the reporter luciferase Wg-Renilla luciferase (WgRluc), the control luciferase a secreted form of Firefly luciferase (sfluc) together with expression constructs 91

93 encoding wild-type or mutant Wls. Wg secretion was calculated as the relative luciferase activity of WgRluc/sFluc in the conditioned medium to exclude the potential effects on general secretion or cell survival. As shown in Fig. 2A, Wls-1 stimulated Wg secretion to a lesser extent compared to its wild-type counterpart, which is in agreement with the role of endocytosis in Wls recycling (Gasnereau et al., 2011). The ubiquitination-deficient forms of Wls, Wls9KR and Wls9KR-1, also showed significantly reduced activities (30% reduction for 9KR and 40% for 9KR-1), indicating the importance of Wls ubiquitination in Wg secretion. This notion is further strengthened by examination with S2 cells co-expressing Wg and Wls proteins. In comparison, Wls9KR-expressing S2 cells accumulated more Wg intracellularly and secreted less onto the cell surface and the extracellular matrix as revealed by extracellular staining (Fig. 2B). We next moved on to the wing discs to define the in vivo roles of Wls ubiquitination. Here we used a previously reported Wls mutant allele, srt , to reduce the interference from endogenous Wls. Since srt (Goodman et al., 2006) homozygotes are lethal at third-instar larval stage, we expressed different Wls variants by hhgal4 driver in srt heterozygous background and dissected the wing discs for immuno-staining. As shown in Fig. 3B, Wg colocalized with ectopically expressed wild-type Wls in small punctate structures that decreased in number with increasing distance from the Wg source, displaying a gradient of secreted Wg (Strigini and Cohen, 2000). There were less Wg-positive punctate structures in discs expressing Wls-1, indicating reduced levels of secreted Wg. However, no colocalization was observed for Wg with either Wls9KR or Wls9KR-1 and there were fewer small puncta outside of Wgproducing cells. Interestingly, in these two samples with ubiquitination-defective Wls, some big particles were detected especially in the Wg-secreting cells, indicating a defect in the intracellular sorting of Wg. Consistent with a role of Wg signaling in wing growth and margin 92

94 bristle formation, the adult flies showed distinctive wing phenotypes. Compared to the control fly, flies with hhgal4-driven expression of Wls9KR and Wls9KR-1 showed reduced posterior wing size and a decrease in the number of margin bristles (note that the stronger defects with Wls9KR-1 as indicated by the wing notch phenotype), which is typical for reduced/loss of Wg signaling. There are two possibilities associated with the Wg sorting defects in Wls-9KR flies: the defects could occur during Wls-mediated transport of Wg from Golgi to the plasma membrane or in the later rerouting steps following Wg internalization. To distinguish these two possibilities, we examined Wg transport in clones of cells outside the Wg source (Fig. 4). We found that overexpression of Wls did not make major change to the Wg gradient. In comparison, Wg-receiving cells with an over-expression of Wls9KR accumulates notable amount of intracellular Wg. Since Wls expression has no effect on Wg transcription, the accumulated Wg must come from extracellular distribution that gets retained for some reason after internalization, supporting the role of Wls ubiquitination in the later rerouting of Wg. Taken together, our data demonstrated that Wls ubiquitination is important to regulate the intracellular sorting of Wg after endocytosis and therefore is important to control Wg gradient formation and signaling activities. 3. Identification of E3 ligase and deubiquitinase for Wls by an RNAi screen The process of protein ubiquitination is catalyzed by the sequential action of three distinct enzymes: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligases (E3). While E3 ligases specify the timing and substrate selection of ubiquitination reactions, deubiquitinating enzymes (DUB) remove ubiquitin moieties from substrates with less 93

95 specificity. To better understand the process of Wls ubiquitination, we carried out a genetic RNAi screen with potential E3 ligases and deubiquitinases in the Drosophila genome. We screened about 200 E3 ligase genes and 33 DUBs in the genome-wide Drosophila RNAi libraries from Vienna Drosophila RNAi Center (VDRC) and National Institute of Genetics (NIG). Briefly, we induced posterior-compartment-specific knockdown of each candidate gene in the wing imaginal disc by crossing corresponding UAS-RNAi lines with engal4 driver. The effects of RNAi on Wls levels and Wg secretion were determined by immunostaining of wing discs with Wls and Wg antibodies. From this screening, we identified two new regulators, the deubiquitinating enzyme UBPY/ubiquitin-specific protease 8 (USP8) and the E3 ligase Suppressor of deltex (Su(dx)). Consistent with the aforementioned role of ubiquitination in the control of Wls levels, RNAimediated knockdown of USP8 markedly reduced the levels of endogenous Wls (Fig. 5A-A ) while depletion of Su(dx) led to dramatic stabilization of endogenous Wls (Fig. 5B-B ). Further analysis using null alleles of Su(dx) and USP8 uncovered similar effects on Wls (Fig. 5C-D ). Su(dx) is a HECT-type E3 ligase and it has been shown to regulate the endocytic trafficking of Notch and to influence the outcome of signaling (Cornell et al., 1999; Fedoroff et al., 2004; Fostier et al., 1998; Jennings et al., 2007; Mazaleyrat et al., 2003). In agreement with the cell surface ubiquitination of Wls, Su(dx) has a C2 membrane targeting domain and it has been shown that Su(dx) can be recruited from cytoplasm to the plasma membrane (Djiane et al., 2011). USP8 is an endosomal deubiquitinating enzyme which helps reroute the internalized substrate from lysosomal degradation to recycling (Alwan and van Leeuwen, 2007; Mizuno et al., 2005; Mukai et al.; Niendorf et al., 2007; Row et al., 2007; Row et al., 2006). Altogether, our data and the current knowledge about these two molecules support a model (Fig. 8) that Su(dx) mediates 94

96 Wls ubiquitination on the cell surface through which it regulates Wls trafficking and Wg secretion; USP8 deubiquitinates Wls in the endosomes and helps shunt Wls to retromerdependent recycling. 4. Su(dx) and USP8 regulates ubiquitination and deubiquitination of Wls respectively To provide more direct evidence for the enzymatic activities of Su(dx) (or USP8) in Wls ubiquitination (or deubiquitination), we examined the ubiquitination patterns of Wls proteins in the case of gain/loss of Su(x) (or USP8) function. USP8C>S bears a mutation at the essential catalytic cysteine, leading to the loss of its deubiquitinating activity (Xia et al., 2012). We found that co-expression of wild type USP8 reduced Wls ubiquitination levels and stabilized Wls, which is consistent with the screen results (Fig. 6A, two top panels). However, co-expression of the enzyme-dead form enhanced the levels of ubiquitinated Wls and caused Wls destabilization (Fig. 6A, two top panels), suggesting a dominant negative effect of USP8C>S on endogenous USP8. In agreement with this hypothesis, Wls can pull down a similar amount of USP8 and USP8CS. This co-ip result indicates that loss of enzymatic activity does not block the interaction between Wls and USP8CS, providing the evidence for potential competition between endogenous USP8 and USP8CS. Similar experiments were carried out to test the function of Su(dx) as an E3 ligase for Wls. The ubiquitination levels of membrane-retained form of Wls, Wls-1, is dramatically increased when Su(dx) is co-expressed (Fig. 6B), in support of its E3 ligase activity. Interestingly, co-expression of Su(dx)ΔHECT, a mutant form lacking the entire catalytic HECT domain, slightly reduced Wls-1 ubiquitination, indicating a dominant negative effect over its endogenous wild type counterpart similar to that of USP8C>S. It is worth to note that neither the levels of total proteins nor that of the residual ubiquitinated portion associated with Wls9KR-1 mutant was 95

97 altered upon Su(dx) modulation. This data suggests that the ubiquitination of KR mutants might be an event independent from the regulation of Wls by Su(dx) which acts via the nine lysine residues. 5. Su(dx) regulates the release of Wg If Su(dx) is indeed the E3 ligase responsible for Wls ubiquitination as we suggested, one will expect a role of Su(dx) in Wg secretion. Since Su(dx) has been shown to regulate other substrates including Notch which is upstream of Wg transcription in the wing disc, we first use S2 cells which do not express endogenous Wg (according to modencode Cell Line Expression Data) to eliminate the interference from Notch signaling (Fig. 7A). Ectopic expression of Su(dx) significantly enhanced WgRluc secretion in S2 cells (about 75% increase), consistent with the previous observation that Wls is more competent than Wls9KR in promoting Wg secretion. However, co-expression of the E3-defective form of Su(dx) can induce WgRluc secretion 3-fold of that in the control cells. This enhancement in WgRluc reporter secretion in Su(dx)ΔHECT samples could be possibly due to the enhanced stability of endogenous Wls (Fig. 6C, left middle panel, compare lane 3 to lane 1), which in this case is critical for the secretion of relatively large amount of ectopic Wg within the cells. Although Su(dx) is a negative regulator of Notch signaling, it is reported that in wing discs from Su(dx) homozygous mutant flies, expression of the WglacZ reporter appeared wild type instead of being increased, indicating undisturbed Wg transcription (Mazaleyrat et al., 2003). Similarly, in wing discs with modulated Su(dx) activity, while alterations in Wls levels are easy to appreciate, no obvious change can be seen in Wg transcription as reflected by normal WglacZ reporter levels (Supplementary Fig. 1). Moreover, over-expression of Su(dx) driven by engal4 led to an over growth of the affected posterior cells, a phenotype similar to but stronger than that 96

98 observed in the over-expression of wild type Wls (Fig. 7C to Fig. 3C). This is also contradictory to a possible undergrowth phenotype predicted from reduced Wg transcription, further arguing that the effect of Su(dx) on Wls levels and Wg secretion is independent from its role in Notch signaling. Likewise, over-expression of Su(dx)ΔHECT phenocopies the wing defects associated with over-expression of Wls9KR, consistent with the positive role of ubiquitination in Wg secretion. To directly monitor Wg secretion and distribution, we modulated Su(dx) levels in the wing disc by cdna over-expression and RNAi and examined the resulting effects by immune-staining. apgal4 instead of engal4 was used to drive transgene expression for easier comparison. As shown in Fig. 7B, dorsal expression of Su(dx) increased the number of small Wg-positive particles and the range of Wg distribution in the receiving cells, while opposite effects were seen when Su(dx)ΔHECT was over-expressed. This observation further supports our conclusion that ubiquitination of Wls by Su(dx) positively controls Wg secretion in the wing disc cells. 97

99 Discussion Since the discovery of Wls as a specialized Wg cargo receptor in 2006 (Banziger et al., 2006; Bartscherer et al., 2006; Goodman et al., 2006), the process of Wnt secretion is attracting the interest of more and more researchers in the Wnt field. However, how Wls regulates Wnt secretion and in what format Wnt is released is unclear yet. In the present study, we uncovered a novel function of ubiquitination in the control of Wls trafficking in Drosophila. Particularly, we found that the ubiquitination status of Wls regulates the release of Wg for a long-range distribution. Taken together with very recent findings on Wg/Wnt exosomal transport, our work helped close a major gap on the exosome model of Wg secretion, that is, how Wls controls the exosomal sorting of Wg/Wnt. Wls undergoes reversible ubiquitination Our data strongly argues that Wls is ubiquitinated. First, Wls demonstrated high-molecularweight smears which can be detected by ubiquitin antibody on Western blots. Second, major ubiquitination of Wls disappeared after mutation of cytoplasmic lysine residues, suggesting some or all of these amino acids are the ubiquitin attachment sites on Wls. Finally, we identified Su(dx) and USP8 as the E3 ligase and deubiquitinating enzyme for Wls respectively. Although more biochemical studies are still required, our work proposes Wls as a novel substrate for their enzymatic activity and through this relationship links them to the regulation of Wg secretion. These two proteins have already been shown to work in multiple biological processes, and the use of general machinery with certain specificity is a common strategy in cellular regulation, such as the multi-function retromer complex. 98

100 When all cytoplasmic lysines are mutated, Wls can still be ubiquitinated in some way. Considering that Su(dx) has no effect on the residual ubiquitination of Wls9KR and Su(dx) mutant phenocopied the defects associate with Wls9KR, we speculate that the ubiquitination of Wls9KR is unrelated to Wg sorting which is controlled by Su(dx)-mediated ubiquitination on cytoplasmic lysines. Currently, we have no idea about the nature and role of the non-canonical ubiquitination which occurs outside of the nine lysine residues. However, the fact that treatment with the proteasome inhibitor MG132 (data not shown) could stabilize Wls provides one possibility that it may be involved in the control of Wls proteasomal degradation. Further experiments are needed to explore this possibility. Role of ubiquitination in the control of Wls and Wg trafficking Our biochemical assays with Wls variants and with modulated Su(dx) (or USP8) activities suggest that ubiquitination reduces Wls levels. However, our WgRluc secretion assay and genetic evidence indicates that the ubiquitination makes Wls more competent to help Wg secretion. Based on these observations and the MVB resorting of Wg in the exosome hypothesis, we propose that ubiquitination of Wls can function as a sorting signal to direct Wls together with the bound Wg to MVB where Wg is rerouted onto exosomes. USP8 can stabilize Wls by stimulating efficient recycling and this step is probably upstream of SNX3 and retromerdependent event, although epistasis analysis is needed to further prove it. As we have discussed, ubiquitination of Wls plays a dual role for Wg secretion: it provides less but more active vehicles for Wg. When the ubiquitination levels of Wls are altered, the actual effect on Wg secretion depends on the relative abundance of cargo receptor Wls versus cargo Wg. In the wing disc where endogenous Wls is sufficient to engage all Wg, the quality of the vehicle becomes the limiting factor for Wg transport. Therefore, over-expression of 99

101 Su(dx)ΔHECT inhibits Wg secretion and signaling. By contrast, in WgRluc secretion assay, the endogenous Wls is not enough to bind all over-expressed WgRluc, increased Wls levels by overexpression of Su(dx)ΔHECT becomes beneficial for Wg secretion. Does ubiquitination of Wls function in the early endocytosis steps? Although a classical endocytosis motif has been identified within Wls sequence and experimentally proved active, it is possible for the cell to in parallel use ubiquitination to regulate Wls internalization, considering endocytosis of Wls is such a critical step not only to control Wls recycling but also to regulate Wg rerouting. Consistent with this idea, Wls9KR-1 seems more stable yet less active compared to Wls-1 and Wls9KR. Also, as shown in Fig. 3 A, Wls9KR-1 is more strictly membrane localized than Wls-1, suggesting the additive effect of ubiquitination and classical endocytosis motif in the control of Wls internalization. One discrepancy between our biochemical data from S2 cells and the genetic data from wing discs is that compared to Wls, Wls9KR is more stable in S2 cells (Fig. 1B) but is less stable in the Wg-expressing wing disc cells (Fig. 3A). This is probably due to the stabilizing effect of Wg expression on wild type Wls. This stabilization and apical redistribution of Wls was first reported by Fillip Port et al and they proved that it is resulted from the presence of Wg protein per se rather than Wg signaling activity (Port et al., 2008). They attributed it to the enhanced accumulation of Wls in the Golgi in the early secretion route. Later, this view was challenged by the study with Wls endocytosis motif which showed that Wls becomes comparably stable in the absence of Wg when the endocytosis motif is mutated. The later work argues that the stabilization event occurs after Wls internalization. Now the distinctive stability of Wls9KR in S2 cells (with no Wg expression) and Wg-expressing wing disc cells suggests that the stabilizing 100

102 effect of Wg is also dependent on Wls ubiquitination. We therefore propose that Wg stabilizes Wls in the endosomes where most unbound Wls is quickly sorted to the lysome for degradation. The revised exosome model for Wg/Wnt secretion The first evidence in Wg secretion on exosomes came from studies in Drosophila neuromuscular junctions (NMJ). It is shown that Wls is secreted together with Wg on exosomes for transsynaptic delivery (Koles et al., 2012; Korkut et al., 2009). Very recently, independent work from two groups has expanded the exosomal secretion model to S2 cells and wing imaginal discs (Beckett et al., 2012; Gross et al., 2012). Despite the discrepancy in experimental results in the wing disc, they both showed in the Wg-expressing S2 cells and Wnt3A-expressing L cell or HEK293 cells, Wls and Wg/Wnt3A were co-purified in microvesicles from the culture supernatant by fractionation. These microvesicles displayed all common characteristics of exosomes. The secretion of Wls in exosomes in S2 cells is most likely Wg-independent as the amount of Wls present in exosomes is similar (Beckett et al., 2012). As for whether the secretion of Wg in exosomes is Wls dependent, neither of these groups provided strong evidence although one showed the colocalization of Wls and Wg in MVB in wing disc cells (Gross et al., 2012). It is technically difficult to address this question as depletion of Wls causes retention of Wg in Golgi, leaving it impossible to analyze the later endosomal sorting events. On this point, the Wls9KR mutant makes a perfect tool and our studies provide the otherwise missing evidence to support the requirement of Wls in Wg exosomal secretion. The revised exosome model is depicted in Fig. 8 with the integration of Wls ubiquitination. Exosomal Wg is proved to be active and able to travel extracellularly (Beckett et al., 2012; Gross et al., 2012). However, this format of Wg packaging is not the only one present in the secreted Wg pool (Beckett et al., 2012; Gross et al., 2012). Indeed, several other models for Wg release 101

103 and extracellular transport have been proposed, including formation of Wnt micelles and direct loading onto long filopodia (cytonemes) (Ramirez-Weber and Kornberg, 1999), transportation via argosomes or lipoprotein particles (LPPs) (Greco et al., 2001; Panakova et al., 2005) and binding with lipid-masking chaperone proteins (Mulligan et al., 2012). To figure out the relative contribution of different Wg formats to the signaling activity and the extracellular Wg gradient will be a major question in the field. To answer this question, a reliable and specific method is required to inhibit exosome formation. Although several factors have been identified in forming Wg-related exosome including Rab5, Rab11and Ykt6 (Beckett et al., 2012; Gross et al., 2012; Koles et al., 2012), they are usually general regulators of cellular trafficking processes and may directly and indirectly affect steps in Wg/Wnt secretion and reception other than exosome formation. Since Wls is a dedicated cargo receptor for Wg secretion, to modulate Wls ubiquitination will be the ideal choice to control the exosomal Wg pool for further studies. Acknowledgements We thank the following: the Iowa Developmental Studies Hybridoma Bank (IDSHB) for antibodies; Martin Baron, Konrad Basler and Jianghang Jia for plasmids; Martin Baron, Jianghang Jia, VDRC, NIG and the Bloomington Stock Center for Drosophila stocks. This work is funded by NIH grant (2R01GM A1). 102

104 References Alwan, H. A. and J. E. van Leeuwen (2007). "UBPY-mediated epidermal growth factor receptor (EGFR) de-ubiquitination promotes EGFR degradation." J Biol Chem 282(3): Banziger, C., D. Soldini, et al. (2006). "Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins from signaling cells." Cell 125(3): Bartscherer, K., N. Pelte, et al. (2006). "Secretion of Wnt ligands requires Evi, a conserved transmembrane protein." Cell 125(3): Beckett, K., S. Monier, et al. (2012). "Drosophila S2 cells secrete Wingless on exosome-like vesicles but the Wingless gradient forms independently of exosomes." Traffic. Belenkaya, T. Y., C. Han, et al. (2002). "pygopus Encodes a nuclear protein essential for wingless/wnt signaling." Development 129(17): Belenkaya, T. Y., C. Han, et al. (2002). "pygopus Encodes a nuclear protein essential for wingless/wnt signaling." Development 129(17): Belenkaya, T. Y., Y. Wu, et al. (2008). "The retromer complex influences Wnt secretion by recycling wntless from endosomes to the trans-golgi network." Dev Cell 14(1): Brand, A. H. and N. Perrimon (1993). "Targeted gene expression as a means of altering cell fates and generating dominant phenotypes." Development 118(2): Buechling, T., V. Chaudhary, et al. (2011). "p24 proteins are required for secretion of Wnt ligands." EMBO Rep 12(12): Chen, D., J. Shan, et al. (2010). "Transcription-independent ARF regulation in oncogenic stressmediated p53 responses." Nature 464(7288): Coombs, G. S., J. Yu, et al. (2010). "WLS-dependent secretion of WNT3A requires Ser209 acylation and vacuolar acidification." J Cell Sci 123(Pt 19): Cornell, M., D. A. Evans, et al. (1999). "The Drosophila melanogaster Suppressor of deltex gene, a regulator of the Notch receptor signaling pathway, is an E3 class ubiquitin ligase." Genetics 152(2): Djiane, A., H. Shimizu, et al. (2011). "Su(dx) E3 ubiquitin ligase-dependent and -independent functions of polychaetoid, the Drosophila ZO-1 homologue." J Cell Biol 192(1): Fedoroff, O. Y., S. A. Townson, et al. (2004). "The structure and dynamics of tandem WW domains in a negative regulator of notch signaling, Suppressor of deltex." J Biol Chem 279(33): Fostier, M., D. A. Evans, et al. (1998). "Genetic characterization of the Drosophila melanogaster Suppressor of deltex gene: A regulator of notch signaling." Genetics 150(4): Franch-Marro, X., F. Wendler, et al. (2008). "Wingless secretion requires endosome-to-golgi retrieval of Wntless/Evi/Sprinter by the retromer complex." Nat Cell Biol 10(2): Gasnereau, I., P. Herr, et al. (2011). "Identification of an endocytosis motif in an intracellular loop of Wntless protein, essential for its recycling and the control of Wnt protein signaling." J Biol Chem 286(50): Goodman, R. M., S. Thombre, et al. (2006). "Sprinter: a novel transmembrane protein required for Wg secretion and signaling." Development 133(24): Gross, J. C., V. Chaudhary, et al. (2012). "Active Wnt proteins are secreted on exosomes." Nat Cell Biol 14(10): Harterink, M., F. Port, et al. (2011). "A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion." Nat Cell Biol 13(8):

105 Herr, P. and K. Basler (2012). "Porcupine-mediated lipidation is required for Wnt recognition by Wls." Dev Biol 361(2): Hicke, L. and R. Dunn (2003). "Regulation of membrane protein transport by ubiquitin and ubiquitin-binding proteins." Annu Rev Cell Dev Biol 19: Ikeda, M., A. Ikeda, et al. (2002). "Lysine-independent ubiquitination of Epstein-Barr virus LMP2A." Virology 300(1): Ito, K., W. Awano, et al. (1997). "The Drosophila mushroom body is a quadruple structure of clonal units each of which contains a virtually identical set of neurones and glial cells." Development 124(4): Jennings, M. D., R. T. Blankley, et al. (2007). "Specificity and autoregulation of Notch binding by tandem WW domains in suppressor of Deltex." J Biol Chem 282(39): Johnstone, R. M. (2006). "Exosomes biological significance: A concise review." Blood Cells Mol Dis 36(2): Koles, K., J. Nunnari, et al. (2012). "Mechanism of evenness interrupted (Evi)-exosome release at synaptic boutons." J Biol Chem 287(20): Korkut, C., B. Ataman, et al. (2009). "Trans-synaptic transmission of vesicular Wnt signals through Evi/Wntless." Cell 139(2): Li, H., K. Okamoto, et al. (2009). "Lysine-independent turnover of cyclin G1 can be stabilized by B'alpha subunits of protein phosphatase 2A." Mol Cell Biol 29(3): Mazaleyrat, S. L., M. Fostier, et al. (2003). "Down-regulation of Notch target gene expression by Suppressor of deltex." Dev Biol 255(2): Mizuno, E., T. Iura, et al. (2005). "Regulation of epidermal growth factor receptor downregulation by UBPY-mediated deubiquitination at endosomes." Mol Biol Cell 16(11): Mukai, A., M. Yamamoto-Hino, et al. "Balanced ubiquitylation and deubiquitylation of Frizzled regulate cellular responsiveness to Wg/Wnt." Embo J 29(13): Mukai, A., M. Yamamoto-Hino, et al. (2010). "Balanced ubiquitylation and deubiquitylation of Frizzled regulate cellular responsiveness to Wg/Wnt." EMBO J 29(13): Mukhopadhyay, D. and H. Riezman (2007). "Proteasome-independent functions of ubiquitin in endocytosis and signaling." Science 315(5809): Mulligan, K. A., C. Fuerer, et al. (2012). "Secreted Wingless-interacting molecule (Swim) promotes long-range signaling by maintaining Wingless solubility." Proc Natl Acad Sci U S A 109(2): Neumann, C. J. and S. M. Cohen (1997). "Long-range action of Wingless organizes the dorsalventral axis of the Drosophila wing." Development 124(4): Niendorf, S., A. Oksche, et al. (2007). "Essential role of ubiquitin-specific protease 8 for receptor tyrosine kinase stability and endocytic trafficking in vivo." Mol Cell Biol 27(13): Pan, C. L., P. D. Baum, et al. (2008). "C. elegans AP-2 and retromer control Wnt signaling by regulating mig-14/wntless." Dev Cell 14(1): Panakova, D., H. Sprong, et al. (2005). "Lipoprotein particles are required for Hedgehog and Wingless signalling." Nature 435(7038): Port, F., G. Hausmann, et al. (2011). "A genome-wide RNA interference screen uncovers two p24 proteins as regulators of Wingless secretion." EMBO Rep 12(11): Port, F., M. Kuster, et al. (2008). "Wingless secretion promotes and requires retromer-dependent cycling of Wntless." Nat Cell Biol 10(2):

106 Ramirez-Weber, F. A. and T. B. Kornberg (1999). "Cytonemes: cellular processes that project to the principal signaling center in Drosophila imaginal discs." Cell 97(5): Row, P. E., H. Liu, et al. (2007). "The MIT domain of UBPY constitutes a CHMP binding and endosomal localization signal required for efficient epidermal growth factor receptor degradation." J Biol Chem 282(42): Row, P. E., I. A. Prior, et al. (2006). "The ubiquitin isopeptidase UBPY regulates endosomal ubiquitin dynamics and is essential for receptor down-regulation." J Biol Chem 281(18): Sadeh, R., K. Breitschopf, et al. (2008). "The N-terminal domain of MyoD is necessary and sufficient for its nuclear localization-dependent degradation by the ubiquitin system." Proc Natl Acad Sci U S A 105(41): Silhankova, M., F. Port, et al. (2010). "Wnt signalling requires MTM-6 and MTM-9 myotubularin lipid-phosphatase function in Wnt-producing cells." EMBO J 29(24): Simons, M. and G. Raposo (2009). "Exosomes--vesicular carriers for intercellular communication." Curr Opin Cell Biol 21(4): Staub, O. and D. Rotin (2006). "Role of ubiquitylation in cellular membrane transport." Physiol Rev 86(2): Strigini, M. and S. M. Cohen (2000). "Wingless gradient formation in the Drosophila wing." Curr Biol 10(6): Takada, R., Y. Satomi, et al. (2006). "Monounsaturated fatty acid modification of Wnt protein: its role in Wnt secretion." Dev Cell 11(6): Tang, X., Y. Wu, et al. (2012). "Roles of N-glycosylation and lipidation in Wg secretion and signaling." Dev Biol 364(1): Traub, L. M. and G. L. Lukacs (2007). "Decoding ubiquitin sorting signals for clathrindependent endocytosis by CLASPs." J Cell Sci 120(Pt 4): Willert, K., J. D. Brown, et al. (2003). "Wnt proteins are lipid-modified and can act as stem cell growth factors." Nature 423(6938): Xia, R., H. Jia, et al. (2012). "USP8 promotes smoothened signaling by preventing its ubiquitination and changing its subcellular localization." PLoS Biol 10(1): e Yang, P. T., M. J. Lorenowicz, et al. (2008). "Wnt signaling requires retromer-dependent recycling of MIG-14/Wntless in Wnt-producing cells." Dev Cell 14(1): Zecca, M., K. Basler, et al. (1996). "Direct and long-range action of a wingless morphogen gradient." Cell 87(5): Zhang, P., Y. Wu, et al. (2011). "SNX3 controls Wingless/Wnt secretion through regulating retromer-dependent recycling of Wntless." Cell Res 21(12):

107 Figures Figure 1. Wls is ubiquitinated on the cell surface. (A) S2 cells were transfected with Wls alone or Wls together with HAUb. Cell lysates were immunoprecipitated and a western blot was performed with the indicated antibody. (B) S2 cells were transfected with control vector or constructs encoding different Wls variants. Cell lysates were immunoprecipitated and a western blot was performed with the indicated antibody. dsred was co-transfected as a control for transfection efficiency. IP, immunoprecipitation; IB, immunoblot. 106

108 Figure 2. Wls ubiquitination is important for efficient Wg secretion in S2 cells. (A) Luciferase assay for WgRluc secretion. S2 cells were transfected with pac-wgrluc, pac-sfluc, pac-gal4 and constructs encoding different Wls variants. 48hrs after transfection, Wg secretion was assayed by relative luciferase activity of WgRluc/sFluc in the conditioned medium. (B) S2 cells were cotransfected with pac-gal4, pac-wg together with UAS-Wls or UAS-Wls9KR. 48 hours after transfection, cells were stained by mouse anti Wg (4D4) antibody with the extracellular staining protocol first and then fixed and underwent traditional staining by guinea pig anti Wg and rabbit anti Wls antibody. One representative image was selected for each sample. 107

109 Figure 3. Wls ubiquitination is important for Wg secretion and signaling in the Drosophila wing. (A) A confocal z section along the dorsal/ventral boundary of Wg expression domain was taken for wing discs with engal4-driven over-expression of indicated transgene. Apical sides are facing upward. The subapical plane marked by white line was shown in (B). All staining were done in parallel and same confocal setting was used when taking all images. (C) Adult wings from flies of control (srt hhgal4), UAS-Wls (UAS-Wls; srt hhgal4), UAS-Wls- 1(UAS-Wls-1; srt hhgal4), UAS-9KR (UAS-9KR; srt hhgal4) and UAS-9KR- 1(UAS-9KR-1; srt hhgal4). 108

110 Figure 4. Wls regulates Wg trafficking following endocytosis. In somatic clones marked by CD8GFP in the wing discs, wild-type Wls (A-A ) and Wls9KR (B-B ) are expressed under the control of act Gal4. Note the accumulation of Wg in clones expressing Wls9KR. 109

111 Figure 5. Identification of Su(dx) and USP8 in the control of Wls levels in an RNAi screen. (A-B ) Wls and Wg staining in the wing discs expressing USP8 RNAi (A-A ) and Su(dx) RNAi (B-B ) under the control of engal4. (C-D )Wls staining in the wing discs bearing clones mutant for USP8 (C-C ) or Su(dx) (D-D ) respectively. Mutant clones are marked by the absence of GFP. 110

112 Figure 6. Su(dx) and USP8 are the E3 ligase and deubiquitinating enzyme for Wls respectively. (A) S2 cells were transfected with Wls alone or Wls together with HAUSP8 or HAUSP8C>S. Cell lysates were immunoprecipitated and a western blot was performed with the indicated antibody. (B) On the left, S2 cells were transfected with Wls-1 together with control vector or pmt-hasu(dx) or pmt-hasu(dx). Cell lysates were immunoprecipitated and a western blot was performed with the indicated antibody. dsred was co-transfected as a control for transfection efficiency. Similar experiments were done with Wls9KR-1and the results were shown on the right. IP, immunoprecipitation; IB, immunoblot. 111

113 Figure 7. Su(dx) regulates Wg secretion in both S2 cells and the Drosophila wing. (A) Luciferase assay for WgRluc secretion. S2 cells were transfected with pac-wgrluc, pac-sfluc and pmt-gal4 control or pmt-su(dx) or pmt-su(dx)δhect. 24 hours after transfection, 0.5 mm of CuSO 4 was added to the medium and cells were grown for another 24 hours before the relative luciferase activity of WgRluc/sFluc in the conditioned medium was measured. (B) Confocal images of Wg staining taken from the subapical plane of wing discs with the indicated genotype. apgal4-driven transgene expression was in cells of the dorsal compartment. Compare Wg distribution on the dorsal side versus the ventral side of the Wg-expressing domain. Note more small particles in a longer range in dorsal cells expressing Su(dx) in the middle panel. Su(dx)ΔHECT-expressing dorsal cells transport Wg to a shorter distance and Wg was retained in big particles. (C) Adult wings from flies of control (engal4), UAS- Su(dx) (engal4uas- Su(dx)) and UAS-Su(dx)ΔHECT (engal4 UAS-Su(dx)ΔHECT). 112

114 Figure 8. Model of Wls trafficking and Wg secretion. Wg is lipid modified by Porcupine in the ER, then shuttled to the Golgi. With the help of Wls, Wg is transfered the plasma membrane where Su(dx) catalyzes Wls ubiquitination. After endocytosis, the Wg-bound Wls is sorted to the MVB where Wg is re-secreted on exosomes; the free Wls, after USP8 removes the ubiquitin attachment, is recycled to the Golgi by the retromer complex to engage the cargo receptor in a next round of Wg transport. 113

115 Supplementary Figure 1. WglacZ reporter levels are not altered upon Su(dx) overexpression or RNAi. engal4-driven expression of Su(dx)(A-A ) or Su(dx)RNAi (B-B ) significantly reduced or increased Wls levels respectivey. However, in either case, no major change in the WglacZ reporter could be detected. The white lines in A and B marked the anterior/posterior boundary. Both wing discs are oriented anterior to the left and ventral up. 114

116 Chapter IV Role(s) of hyd in the nuclear signaling of Wingless Xiaofang Tang a, Guolun Wang b, Lorraine Ray a, Xinhua Lin a,b a Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, and The Graduate Program in Molecular and Developmental Biology, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA b State Key Laboratory of Biomembrane and Membrane Biotechnology, and Key Laboratory of Stem Cell and Developmental Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, , China 115

117 Abstract The canonical Wingless (Wg)/Wnt pathway controls many developmental processes and adult homeostasis. Deregulated Wnt signalling has been associated with human diseases, including cancers. Although the major components in the signalling cascade have been uncovered, the mechanisms underlying β-catenin-induced transcription is not yet fully understood. Here we report the genetic identification of a novel Wg/Wnt pathway component in Drosophila, hyperplastic discs (hyd), which is essential for controlling the transcriptional output mediated by Armadillo (Arm)/β-catenin. Hyd is a HECT-type E3 ubiquitin ligase and is considered to be a putative tumour suppressor. Our work demonstrates that hyd regulates Wg signalling in a tissuespecific manner in Drosophila: loss of hyd function completely eliminates the canonical Wg/Wnt signaling in the wing imaginal disc, while embryos carrying a germline mutation of hyd only display minor Wg signalling defects. Moreover, using an epistasis approach, we find that hyd acts downstream of or in parallel to Arm to regulate nuclear Arm activity. Finally, to better understand the molecular function of hyd, we employed mass spectrometry to screen for the binding partners of hyd and a list of potential interacting molecules has been generated. Although more experiments are needed to validate the results, the presence of known components of Wg/Wnt pathway and some general transcriptional regulators within the list further implies an important role of hyd in the regulation of β-catenin-mediated transcriptional machinery. 116

118 Introduction The glycolipoproteins of the Wg/Wnt family are secreted signaling molecules that are essential in embryonic patterning and adult homeostasis in all animals (van Amerongen and Nusse, 2009). Aberrant Wnt signaling underlies a wide range of pathologies in humans (Clevers and Nusse, 2012; Yang, 2012). Wnt signals can be transmitted through three major pathways: the canonical, planar cell polarity (PCP), and Ca 2+ pathways. Signaling through the canonical β-catenin pathway underlies the regulation of tissue patterning, growth and cell fate specification (van Amerongen and Nusse, 2009). β-catenin is the central nuclear effector of the canonical Wg/Wnt pathway. In the absence of Wnt signal, β-catenin is maintained at low levels through the action of a destruction complex composed of factors including the scaffolding protein Axin, APC, CK1 and GSK3 (MacDonald et al., 2009). The phosphorylation of β-catenin by CK1 and GSK3 provides the degron motif which can be recognized by β-trcp, an F-box protein of SCF ubiquitin E3 ligase. As a consequence, β-catenin is ubiquitinated and degraded through the ubiquitin-proteosome pathway (Aberle et al., 1997). Wg/Wnt signaling is initiated by the binding of Wnt ligands to the Frizzled (Fz)/LRP coreceptor complex. Following receptor activation, the kinase activity of the destruction complex is inhibited, leading to the stabilization and translocation of β-catenin to the nucleus where it binds to the LEF/TCF transcription factors (Behrens et al., 1996; Molenaar et al., 1996). Within the β-catenin/tcf complex, there are two dedicated partners, BCL-9/legless (lgs) and pygopus (pygo), which were originally identified from genetic screens in Drosophila (Kramps et al., 2002; Parker et al., 2002; Thompson et al., 2002). The transactivation potential of β-catenin is largely dependent on the establishment of functional transcriptional machinery around the core β-catenin/tcf/lgs/pygo complex with general factors implicated in chromatin 117

119 remodeling and the recruitment/preparation of RNA polymerase II (RNA Pol II). Some of these more general factors have been identified. For example, β-catenin binds histone acetyltransferase (HAT) proteins CBP and p300, the ATP-dependent histone remodeling factor Brg1/Brahma (Brm). More recently, Arm/β-catenin was found to directly bind to Hyrax/Parafibromin (Mosimann et al., 2006), a component of the Polymerase-Associated Factor 1 (PAF1) complex. With the identification of a number of β-catenin-interacting proteins, the complete view of the transcriptional machinery and the interaction network is still missing. In particular, how β- catenin controls tissue-specific signaling output remains a mystery. In this work, we described the genetic identification and molecular characterization of hyd as a novel component in the nuclear Wg/Wnt signaling pathway in Drosophila. Hyd (the Drosophila UBR5 gene) was first identified as a tumour suppressor gene in Drosophila imaginal discs (Mansfield et al., 1994; Martin et al., 1977). Subsequent studies suggest that hyd is evolutionarily conserved from C. elegans to mouse and human. In Drosophila, hyd has been shown to regulate the expression and function of hedgehog (hh) in the wing and eye imaginal discs (Lee et al., 2002). In mouse, UBR5 has been implicated in the control of extraembryonic development and UBR5 knockout mice exhibit early embryonic lethality (Saunders et al., 2004). Later cell-based assays have implicated mammalian UBR5 (also known as Edd, E3 identified by differential display) in the regulation of a series of cellular processes, including cell cycle progression (Benavides et al., 2012; Ling and Lin, 2011; Munoz et al., 2007; Smits, 2012; Tomaic et al., 2011), control of gene transcription (Cojocaru et al., 2011; Hu et al., 2010), DNA damage response (Gudjonsson et al., 2012; Henderson et al., 2006; Honda et al., 2002), mirnamediated gene silencing (Su et al., 2011) and phosphoenolpyruvate carboxykinase (PEPCK1)- mediated gluconeogenesis (Jiang et al., 2011). As a HECT-type ubiquitin E3 ligase, UBR5 has 118

120 been reported to function in both E3-denpendent and -independent manners. In our studies, we provide the first in vivo evidence that the Drosophila UBR5, hyd, is indispensable for canonical Wg signalling during wing disc development while it is not essential for Wg signalling during embryogenesis. Reduction of hyd function by either RNA interference (RNAi) or an inactivating mutation eliminates Wg-specific target gene transcription. While over-expression of wild-type hyd can rescue the signalling defects associated with hyd mutation, over-expressing E3-deficient hyd cannot, indicating that the ubiquitin E3 ligase activity is required for hyd s function in nuclear Wg signalling. Furthermore, we place hyd downstream of or in parallel with Arm in the Wg signal transduction cascade through epistatic analysis. Taken together, the genetic characterization of hyd as well as the ongoing mass spectroscopic analysis proposes a mechanistic model for Wg/Wnt target gene regulation in which hyd acts as an E3 ligase to control the activities of the β-cetanin/tcf transcriptional machinery in the wing disc cells. 119

121 Materials and Methods hyd transgenes and constructs The hyd gene (CG9484) was cloned via assembly of cdna from ESTs and exons (the strategy is shown in Supplementary Fig. 1). The E3-deficient form of hyd (hydcs) was generated by introducing the cystein-to-alanine mutation at amino acid residue 2854 into the full-length hyd. A V5 tag was added N-terminally. Both V5hyd and V5hydCS were cloned into the puast-attb vector and injected into 51C site on the second chromosome for expression in transgenic flies. Fly genetics Ectopic expression of hyd transgenes and hyd RNAi was achieved by the Gal4/UAS system (Brand and Perrimon, 1993). engal4, engal4 UAS-dcr2 and apgal4 strains were described in Flybase and crosses were kept at 25 C. The hyd null allele hyd 15 was obtained from the Bloomington Drosophila Stock Center. wg IG22 (van den Heuvel et al., 1993) is used as Wingless null allele. The constitutively active form of Arm, arm.s10, was described in Flybase. The enhancer trap line dad-lacz was described in Flybase. The axin null allele was previously described (Belenkaya et al., 2002a). Females with germline clones were generated by the autosomal FLP-DFS technique as described (Hacker et al., 1997). Imaginal disc clones of mutant cells marked by the absence of CD8-GFP marker were generated by the FLP-FRT method as described (Belenkaya et al., 2002a). Over-expression of transgenes in the hyd 15 clones positively marked by CD8-GFP expression was achieved by the MARCM technique (Lee and Luo, 2001). Imaginal disc immunostaining Fixation and antibody staining of imaginal discs were performed as described (Hacker et al., 120

122 1997). Polyclonal mouse and rabbit anti-hyd antibodies were generated against a polypeptide corresponding to amino acid residues Polyclonal rat and guinea pig anti-distalless (Dll) antibodies were generous gifts from Dr. Brian Gebelein. Other primary antibodies used include mouse anti-wg 4D4 (Iowa Developmental Studies Hybridoma Bank; IDSHB), guinea pig anti- Senseless (Nolo et al., 2000), and rabbit anti-v5 (Sigma). Luciferase assay Clone 8 cells were cultured as described ( Transient transfections and reporter assays were done essentially as previously described (Tang et al., 2012). Transfections were performed in 24-well plates using Effectene transfection reagent (QIAGEN). The firefly luciferase reporter notum-luciferase and the normalization vector Po1IIIRL (40:1 ratio) were transfected along with plasmids expressing Fz2 and equal amounts of UAS-V5hyd and UAS-V5hydCS. To examine the effect of hyd RNAi in Wg signaling, each well of clone 8 cells in a 24-well plate was pretreated with 2 μg of hyd dsrna or lacz control dsrna for 3 day before transfection and 5 μg of hyd dsrna or lacz control dsrna were added to cells right after transfection. Luciferase activities were assayed 48 hrs after transfection. dsrnas were synthesized using the MEGAscript In Vitro Transcription Kit from Ambion according to the protocol as described ( Control dsrna for lacz was generated using primers described before (Belenkaya et al., 2008). dsrna for hyd was generated using the following primers: R primer:taatacgactcactataggggtctggaccttcaccgatgt S primer:taatacgactcactatagggtttattgccggaaaacgaac 121

123 Results 1. Identification of hyd as a novel component required for Wg signaling Ubiquitination regulates all critical cellular processes in eukaryotes, including cell cycle progression, transcription, and signal transduction by controlling the stability, function and intracellular localization of a wide variety of proteins (Miranda and Sorkin, 2007; Wilkinson, 2000; Zhang, 2003). The process of protein ubiquitination is catalyzed by the sequential action of three distinct enzymes: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligases (E3) (Neutzner and Neutzner, 2012). E3 ligases specify the timing and substrate selection of ubiquitination reactions. To investigate the role(s) of ubiquitination in the regulation of Wg/Wnt signaling, we screened about 200 E3 ligase genes in the genome-wide Drosophila RNAi libraries from Vienna Drosophila RNAi Center (VDRC) and National Institute of Genetics (NIG). We induced posterior-compartment-specific knockdown of each E3 genes in the wing imaginal disc by crossing corresponding UAS-RNAi lines with engal4 driver. The effects of RNAi on Wg signaling were determined first by examining the margin bristles in the adult wing and the expression of the short-range target Sensless (Sens) and the long-range target Distalless (Dll) in the larval wing disc (Fig. 1B-B ). Among the 15 candidate genes selected from the screen, the RNAi-mediated knockdown of hyd caused diminished wing size and loss of margin bristles (Fig. 1A-A ), suggesting a possible disruption of Wg signaling activities. Consistent with this, the expression of Wg target genes Sens and Dll were strikingly reduced in cells upon RNAi-mediated knockdown (Fig.1C-C ). We next used a null allele of hyd, (hyd15), and generated clones of somatic cells mutant for hyd in the wing disc by FLP-mediated mitotic recombination. Consistently, Dll expression is eliminated in hyd15 mutant clones (Fig.1D-D ). These data strongly argue that Hyd is a positive regulator of Wg signaling in the wing disc. It is 122

124 worth to note that the failure of Dll expression is not attributed to a general cellular defect. Transcription of the dpp target gene, Daughters against dpp (Dad) (Tsuneizumi et al., 1997), is only slightly altered by hyd RNAi as revealed by the reporter dad-lacz expression (Fig. 2, compared A-A to B-B ). These data argue that the output of the Wg pathway is particularly susceptible to a reduction of hyd activity. 2. Hyd functions differentially in Wg signaling in various developmental contexts Wg signaling is required for various developmental processes during embryonic and larval development. To confirm that hyd is generally required for Wg signaling, we examined the patterning of embryonic ventral cuticles associated with hyd mutation. The ventral cuticles of wild-type embryos are characteristic of a repeated pattern of denticle belts interspersed by naked cuticles (Fig. 3A). Wg signaling is required for the formation of naked cuticles and mutations in essential Wg signaling components results in embryos covered with a lawn of denticles (Fig. 3B) (Nusslein-Volhard and Wieschaus, 1980). In contrast to the indispensable role of hyd in wing disc development, homozygous mutant embryos derived from females lacking maternal hyd activity displayed mild Wg-like segment-polarity phenotype: the ventral denticles are still well patterned only with occasional and partial fusions (Fig. 3C, D). This suggests that hyd is not absolutely required for Wg signaling during embryogenesis, indicating a tissue- and/or timespecific function of hyd in the regulation of Wg signaling. 3. Hyd acts downstream of or in parallel with Arm to regulate nuclear Arm activity The cell-autonomous decrease in Dll expression suggests that hyd acts in the reception of Wg signals instead of Wg production or secretion. To further define the role(s) of Hyd in Wg signaling, we generated an antibody against Drosophila Hyd. Consistent with a predicted role in 123

125 the nucleus (Mansfield et al., 1994), immunostaining revealed a strong nuclear signal especially in the wing pouch (Fig. 2 and Fig. 4 ), suggesting that hyd normally regulates nuclear events. Furthermore, we conducted epistasis analysis to investigate how hyd regulates Wg signaling. First, we used the Drosophila axin mutant for an epistasis analysis. Axin is a key component of the destruction complex which phosphorylates Arm and leads to subsequent proteasomal degradation (Hamada et al., 1999; Willert et al., 1999a; Willert et al., 1999b). Removal of Axin leads to stabilization of Arm and activation of downstream signaling as shown by Dll expression (Fig.5 A-A ). We used an axin null mutant to make a double axin-hyd 15 mutant. As shown in Fig.5 B-B, cells double mutant for axin-hyd 15 behaved the same as cells mutant for hyd alone in that the expression of Dll was abolished (Fig. 5B-B ). Notably, Arm protein levels were upregulated in the nucleus when axin was deleted and this upregulation was maintained in clones mutant for axin-hyd 15. Second, we over-expressed the constitutively active form of Arm, Arm.S10 (Pai et al., 1997), in clones mutant for hyd and examined whether the expression of Dll could be restored. In wild-type wing disc cells, over-expression of Arm.S10 was sufficient to induce ectopic Dll expression (Fig. 5C-C ). Surprisingly, the hyd mutation blocked both the endogenous Wg signaling and that induced ectopically by Arm.S10 (Fig. 5D-D ). Collectively, these data suggest that Hyd acts downstream or in parallel with Arm to regulate Wg signaling. 4. Effects of hyd in Wg signaling in wing disc cells depend on its E3 ligase activity Hyd is a large protein comprising of 2885 amino acids (Supplementary Fig. 1). As a HECT-type E3 ligase, the mammalian homolog of hyd, Edd, has been reported to function in both E3- dependent and -independent manners in different processes. By mutating the critical cystein at amino acid residue 2854 with the catalytic HECT domain, we made a catalytic inactive form of hyd, hydc2854s (hydcs). 124

126 We first examined the activities of hyd and hydcs by luciferase assays in cultured Drosophila clone 8 cells which are derived from wing discs. To better reflect Wg signaling in the wing discs, we employed a notum-luciferase reporter instead of the TOPFlash-like luciferase reporter dtf12 (DasGupta et al., 2005). Instead of using the multimerized TCF-binding sites to drive firefly luciferase expression, notum-luciferase consists of a 4-kb upstream element from the genetic locus of notum (also known as wingful) (Song et al., 2010), which is a known Wg target in the wing disc. Expression of Wg caused an over 50 fold induction of notum-luciferase activity, indicating a Wg-dependent response. Application of hyd double-stranded RNA (dsrna) significantly suppressed Wg-enhanced reporter activity by 50% (Fig. 6A). As predicted based on its positive role in Wg signaling, co-expression of wild-type hyd further activated the reporter (about 2 fold increase) (Fig. 6A). Introduction of hydcs can also significantly promote Wginduced luciferase activity although the effect is slightly weaker (1.7 fold increase) compared with its wild type counterpart (Fig. 6A). This result indicates that hydcs retained a reduced yet significant degree of capacity to regulate Wg signaling in cultured clone 8 cells. To further evaluate the in vitro observations, we generated transgenic flies expressing Gal4- inducible N-terminally V5-tagged hyd and hydcs. Both constructs are incorporated into the same locus on the fly genome to ensure the same expression levels which is confirmed by immuno-staining in Fig.6. First, we compared the ability of wild-type and E3-deficient hyd to regulate Wg target gene expression in the wing imaginal discs. Contradictory to results obtained from luciferase assay, neither the expression of hyd (Fig. 6C-C ) nor that of hydcs (Fig. 6D-D ) showed any obvious enhancing effect on Dll expression when driven by engal4, implying that the presence of hyd is necessary but insufficient for Wg signal transduction in the wing disc. Furthermore, we also examined the rescuing ability of hyd and hydcs to restore Dll expression 125

127 in wing disc cells mutant for hyd 15. hyd transgene insertion fully rescued the hyd 15 mutant allele and both Dll expression and clone morphology were restored to normal (Fig. 6E-E ). In contrast, we did not observe any detectable rescuing effects of hydcs (Fig. 6F-F ), which led us to conclude that the E3 ligase activity of hyd is essential for Wg signal transduction in the wing disc cells. 5. Identification of the interacting partner of hyd involved in Wg signaling We have presented evidence that hyd is an E3 ligase acting downstream of or in parallel to Arm to regulate the nuclear function of Arm. No obvious effect of Arm stability or ubiquitination patterns have been detected in both wing disc cells and cultured clone 8 cells (Fig.5 and data not shown) when hyd levels are modulated. We neither detected any change in other major components in the core nuclear complex mediating Wg signaling, including pangolin (the Drosophila TCF factor), pygo and groucho (data not shown). To gain more insight into the molecular mechanism underlying hyd function, we tried to identify the substrate of the E3 ligase activity of hyd by mass spectrometry. The wing disc-derived clone 8 cells were used as the source for large numbers of hyd-expressing cells. Hyd-interacting factors were purified from the nuclear extract of clone 8 cells through the use of hyd antibody covalently coupled to protein A-agarose resin and then identified by mass spectrometry. Results from IgGaffinity chromatography was used as a background control. Three independent rounds of experiments were performed and the reproducible results are summarized in Table. 1. Among the listed genes, there are dedicated components in Wg pathways including lgs and pygo; there are also a lot of general nuclear factors such as chromatin remodeling factors and RNA Pol II transcription cofactors. Although further work needs to be done to define the molecular function of hyd, the preliminary results from the proteomics assay proposed a model that hyd controls the 126

128 activity of more general transcriptional machinery and is recruited to the core Wg nuclear signaling complex through physical interaction with lgs/pygo. 127

129 Discussion The canonical Wg/Wnt pathway is generally associated with pattern formation in embryonic development and homeostatic self-renewal in adulthood. The transcription of target genes in this pathway is controlled by β-catenin-mediated recruitment of auxiliary factors to the DNA-bound LEF/TCF proteins. Although a number of dedicated and more general factors affecting the transcriptional output of β-catenin have been identified in the past three decades, a detailed and comprehensive view of the network involving all the factors is still missing. In this paper, we extend the current understanding by identification and characterization of a novel transcriptional mediator of the Drosophila β-catenin. This gene hyd encodes an ubiquitin E3 ligase which is essential for Arm-mediated transcription in the wing disc but not in the embryos. Hyd as a novel Wg pathway component Here we provide three lines of evidence to support the notion that hyd is a novel wing-disc component in nuclear Wg signal transduction. First, genetic reduction of hyd function by either RNAi or inactivating mutation blocked the Wg pathway activity, serving as a strong in vivo argument for the requirement of hyd in Wg signalling. Consistent results emerged from the reduced luciferase reporter activity in wing disc-derived clone 8 cells following treatment with hyd dsrna. Second, over-expression of hyd in clone 8 cells further activated Wg-induced luciferase activity to an extent comparable to when the Wg ligand levels were doubled. It seems confusing that no obvious change in Dll expression was observed in hyd-over-expressing wing disc cells. This may be partially explained by the limited number of other active factors within the receiving cells in response to Wg pathway activation. Such factors include nuclear Arm, TCF, pygo/lgs et.al. It might be interesting to examine the effects of hyd over-expression in a sensitized background, for example, in cells overexpressing a dominant negative form of lgs, 128

130 lgs 17E (Mosimann et al., 2006). The mode of hyd action will be discussed in more details later. Third, mass spectroscopic analysis identified pygo/lgs as hyd associated factors in the nucleus of clone 8 cells, further supporting our proposed model in which hyd plays a key role in regulating the transcriptional output of Wg signalling. The specificity of hyd in the Wg signaling pathway Although complete loss of hyd activity results in pleiotropic phenotypes including upregulated hh signalling and downregulated Wg signalling, no obvious change in dpp signalling was detected in the wing disc, arguing against a role of hyd as a universal transcriptional activator/repressor. Moreover, the tissue specific effect of hyd adds another level of complexity to its regulation of Wg signalling. Notably, hyd is expressed at comparable levels in developing embryos shown by in situ hybridization (Mansfield et al., 1994) and immuno-staining (data not shown). One possibility for the tissue-specific regulation is that hyd exerts its effects via certain tissue-specific factors or in another scenario hyd is recruited to the core Arm/Pangolin complex though certain tissue-specific factors. It will be helpful for the identification of such factors if we could compare the list of hyd-associated factors in wing disc-derived clone 8 cells and embryoderived S2 cells. It will also be helpful to better understand hyd function if we expand our investigation to more Wg-regulated developmental processes, such as up-regulation of the expression of the homeotic gene labial (lab) during midgut development, maintenance of the expression of the homeobox gene tinman (tin) in the cardiac mesoderm, and specification of RP2 motoneurons in each segment and control of H15 expression in the leg disc (Bhat, 1996; Brook and Cohen, 1996; DiNardo et al., 1988; Hoppler and Bienz, 1995; Nusslein-Volhard and Wieschaus, 1980; Park et al., 1996). 129

131 The context-dependent effects of the mammalian homolog of hyd, Edd, have been reported in the regulation of other processes. For example, studies on Edd function on cell cycle progression show different results in different cells: in primary fibroblasts, Edd depletion caused G1/S arrest through its effect on p53 phosphorylation and/or p53 protein levels (Ling and Lin, 2011; Smits, 2012); in HeLa cells which are functionally deficient in p53 activity, Edd knockdown led to an increased S phase (Munoz et al., 2007); in Edd-null mice, the mutant phenotype is not altered on a p53-null background (Saunders et al., 2004). As hyd can potentially play multiple roles and the ultimate outcome is always the combination of all disturbed processes, it is possible that one phenotype can mask another and some functions dominate when the other pathway is inactivated or unavailable. To this point, it is not surprising that Edd can be both a tumor suppressor in one case and an oncogenic factor in another. Mechanism of hyd action In this study, we provide evidence that hyd is downstream of axin, a constitutively active form of Arm and Arm nuclear import (Fig.5). Consistently, hyd is detected in the nucleus by immunestaining. Therefore, we conclude that hyd functions in the nucleus at the transcriptional level. How could hyd influence the transcription of Wg target genes in the nucleus? As no major decrease in protein levels was detected for Arm, Pangolin, lgs and pygo in hyd depletion, an easy explanation is that hyd controls the interaction between Arm/Pangolin and/or Pangolin binding with DNA. However, this possibility is very unlikely to be true. It has been shown previously that Arm/Pangolin interaction is required for the nuclear retention of stabilized Arm (Tolwinski and Wieschaus, 2001). The fact that Arm still accumulates inside the nucleus in axin-hyd 15 double mutant cells suggests the formation of functional Arm/Pangolin/DNA complex in the absence of hyd activity. Another piece of evidence arguing against that hyd is required for the 130

132 formation of the core Arm/Pangolin transcription complex comes from hyd over-expression. Generally, over-expression of one subunit could lead to dysfunction of the multi-subunit complex, for example, both Pangolin and pygo over-expression led to Wg signalling defects (Cavallo et al., 1998; Parker et al., 2002). Over-expression and depletion of factors involved in the complex formation could also disturb its biological function, as in the case of Coop (Song et al., 2010). If hyd does not function in the way mentioned above, what is it doing in Wg signalling? Two models have been proposed for the action of Edd in vertebrate Wnt signalling. In one case, Edd was found to physically interact with APC in the cytoplasm, resulting in stabilization of APC and inhibition of Wnt signalling (Ohshima et al., 2007); in another case, Edd over-expression was shown to upregulate GSK-3β and β-catenin nuclear localization and more importantly, through ubiquitinating β-catenin, Edd was proposed to stabilize this substrate and therefore promote Wnt signalling (Hay-Koren et al., 2011). Despite the virtually opposite role they proposed in Wg signalling, neither of these two models could explain the phenotypes associated with our hyd null allele in the wing disc. Although the apparent discrepancy may be due to different cell lines and experimental protocols, more experiments need to be done in animal models other than in isolated cell lines to better reflect events in cancer progression and to help develop potential therapeutics. Finally, the genetic rescuing experiments with hyd and hydcs argue that hyd acts as an E3 ligase. It is worth to notice that the requirement for the E3 function is somewhat relaxed in clone 8 cells as demonstrated by the strong ability of hydcs to stimulate notum-luciferase reporter. It is possible that hyd exerts both E3-dependent and independent functions within wing disc cells. One intriguing hypothesis could be that the E3-dependent function involves chromatin regulation, 131

133 which is not applicable to transiently transfected luciferase reporter DNA. Consistently, mass spectrometry analysis identified a number of hyd-interacting factors which are implicated in chromatin remodelling processes. Acknowledgements We thank the following: Brian Gebelein and the Iowa Developmental Studies Hybridoma Bank (IDSHB) for antibodies; Haiyun Song for plasmids; VDRC, NIG and the Bloomington Stock Center for Drosophila stocks. This work was supported by NIH grant (2R01GM A1). 132

134 References Aberle, H., A. Bauer, et al. (1997). "beta-catenin is a target for the ubiquitin-proteasome pathway." EMBO J 16(13): Behrens, J., J. P. von Kries, et al. (1996). "Functional interaction of beta-catenin with the transcription factor LEF-1." Nature 382(6592): Belenkaya, T. Y., C. Han, et al. (2002). "pygopus Encodes a nuclear protein essential for wingless/wnt signaling." Development 129(17): Belenkaya, T. Y., Y. Wu, et al. (2008). "The retromer complex influences Wnt secretion by recycling wntless from endosomes to the trans-golgi network." Dev Cell 14(1): Benavides, M., L. F. Chow-Tsang, et al. (2012). "The Novel Interaction Between Microspherule Protein Msp58 and Ubiquitin E3 Ligase EDD Regulates Cell Cycle Progression." Biochim Biophys Acta. Bhat, K. M. (1996). "The patched signaling pathway mediates repression of gooseberry allowing neuroblast specification by wingless during Drosophila neurogenesis." Development 122(9): Brand, A. H. and N. Perrimon (1993). "Targeted gene expression as a means of altering cell fates and generating dominant phenotypes." Development 118(2): Brook, W. J. and S. M. Cohen (1996). "Antagonistic interactions between wingless and decapentaplegic responsible for dorsal-ventral pattern in the Drosophila Leg." Science 273(5280): Cavallo, R. A., R. T. Cox, et al. (1998). "Drosophila Tcf and Groucho interact to repress Wingless signalling activity." Nature 395(6702): Clevers, H. and R. Nusse (2012). "Wnt/beta-catenin signaling and disease." Cell 149(6): Cojocaru, M., A. Bouchard, et al. (2011). "Transcription factor IIS cooperates with the E3 ligase UBR5 to ubiquitinate the CDK9 subunit of the positive transcription elongation factor B." J Biol Chem 286(7): DasGupta, R., A. Kaykas, et al. (2005). "Functional genomic analysis of the Wnt-wingless signaling pathway." Science 308(5723): DiNardo, S., E. Sher, et al. (1988). "Two-tiered regulation of spatially patterned engrailed gene expression during Drosophila embryogenesis." Nature 332(6165): Gudjonsson, T., M. Altmeyer, et al. (2012). "TRIP12 and UBR5 suppress spreading of chromatin ubiquitylation at damaged chromosomes." Cell 150(4): Hacker, U., X. Lin, et al. (1997). "The Drosophila sugarless gene modulates Wingless signaling and encodes an enzyme involved in polysaccharide biosynthesis." Development 124(18): Hamada, F., Y. Tomoyasu, et al. (1999). "Negative regulation of Wingless signaling by D-axin, a Drosophila homolog of axin." Science 283(5408): Hay-Koren, A., M. Caspi, et al. (2011). "The EDD E3 ubiquitin ligase ubiquitinates and upregulates beta-catenin." Mol Biol Cell 22(3): Henderson, M. J., M. A. Munoz, et al. (2006). "EDD mediates DNA damage-induced activation of CHK2." J Biol Chem 281(52): Honda, Y., M. Tojo, et al. (2002). "Cooperation of HECT-domain ubiquitin ligase hhyd and DNA topoisomerase II-binding protein for DNA damage response." J Biol Chem 277(5):

135 Hoppler, S. and M. Bienz (1995). "Two different thresholds of wingless signalling with distinct developmental consequences in the Drosophila midgut." Embo J 14(20): Hu, G., X. Wang, et al. (2010). "Modulation of myocardin function by the ubiquitin E3 ligase UBR5." J Biol Chem 285(16): Jiang, W., S. Wang, et al. (2011). "Acetylation regulates gluconeogenesis by promoting PEPCK1 degradation via recruiting the UBR5 ubiquitin ligase." Mol Cell 43(1): Kramps, T., O. Peter, et al. (2002). "Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-tcf complex." Cell 109(1): Lee, J. D., K. Amanai, et al. (2002). "The ubiquitin ligase Hyperplastic discs negatively regulates hedgehog and decapentaplegic expression by independent mechanisms." Development 129(24): Lee, T. and L. Luo (2001). "Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development." Trends Neurosci 24(5): Ling, S. and W. C. Lin (2011). "EDD inhibits ATM-mediated phosphorylation of p53." J Biol Chem 286(17): MacDonald, B. T., K. Tamai, et al. (2009). "Wnt/beta-catenin signaling: components, mechanisms, and diseases." Dev Cell 17(1): Mansfield, E., E. Hersperger, et al. (1994). "Genetic and molecular analysis of hyperplastic discs, a gene whose product is required for regulation of cell proliferation in Drosophila melanogaster imaginal discs and germ cells." Dev Biol 165(2): Martin, P., A. Martin, et al. (1977). "Studies of l(3)c43hs1 a polyphasic, temperature-sensitive mutant of Drosophila melanogaster with a variety of imaginal disc defects." Dev Biol 55(2): Miranda, M. and A. Sorkin (2007). "Regulation of receptors and transporters by ubiquitination: new insights into surprisingly similar mechanisms." Mol Interv 7(3): Molenaar, M., M. van de Wetering, et al. (1996). "XTcf-3 transcription factor mediates betacatenin-induced axis formation in Xenopus embryos." Cell 86(3): Mosimann, C., G. Hausmann, et al. (2006). "Parafibromin/Hyrax activates Wnt/Wg target gene transcription by direct association with beta-catenin/armadillo." Cell 125(2): Munoz, M. A., D. N. Saunders, et al. (2007). "The E3 ubiquitin ligase EDD regulates S-phase and G(2)/M DNA damage checkpoints." Cell Cycle 6(24): Neutzner, M. and A. Neutzner (2012). "Enzymes of ubiquitination and deubiquitination." Essays Biochem 52: Nolo, R., L. A. Abbott, et al. (2000). "Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila." Cell 102(3): Nusslein-Volhard, C. and E. Wieschaus (1980). "Mutations affecting segment number and polarity in Drosophila." Nature 287(5785): Ohshima, R., T. Ohta, et al. (2007). "Putative tumor suppressor EDD interacts with and upregulates APC." Genes Cells 12(12): Pai, L. M., S. Orsulic, et al. (1997). "Negative regulation of Armadillo, a Wingless effector in Drosophila." Development 124(11): Park, M., X. Wu, et al. (1996). "The wingless signaling pathway is directly involved in Drosophila heart development." Dev Biol 177(1): Parker, D. S., J. Jemison, et al. (2002). "Pygopus, a nuclear PHD-finger protein required for Wingless signaling in Drosophila." Development 129(11):

136 Saunders, D. N., S. L. Hird, et al. (2004). "Edd, the murine hyperplastic disc gene, is essential for yolk sac vascularization and chorioallantoic fusion." Mol Cell Biol 24(16): Smits, V. A. (2012). "EDD induces cell cycle arrest by increasing p53 levels." Cell Cycle 11(4): Song, H., S. Goetze, et al. (2010). "Coop functions as a corepressor of Pangolin and antagonizes Wingless signaling." Genes Dev 24(9): Su, H., S. Meng, et al. (2011). "Mammalian hyperplastic discs homolog EDD regulates mirnamediated gene silencing." Mol Cell 43(1): Tang, X., Y. Wu, et al. (2012). "Roles of N-glycosylation and lipidation in Wg secretion and signaling." Dev Biol 364(1): Thompson, B., F. Townsley, et al. (2002). "A new nuclear component of the Wnt signalling pathway." Nat Cell Biol 4(5): Tolwinski, N. S. and E. Wieschaus (2001). "Armadillo nuclear import is regulated by cytoplasmic anchor Axin and nuclear anchor dtcf/pan." Development 128(11): Tomaic, V., D. Pim, et al. (2011). "Regulation of the human papillomavirus type 18 E6/E6AP ubiquitin ligase complex by the HECT domain-containing protein EDD." J Virol 85(7): Tsuneizumi, K., T. Nakayama, et al. (1997). "Daughters against dpp modulates dpp organizing activity in Drosophila wing development." Nature 389(6651): van Amerongen, R. and R. Nusse (2009). "Towards an integrated view of Wnt signaling in development." Development 136(19): van den Heuvel, M., C. Harryman-Samos, et al. (1993). "Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein." EMBO J 12(13): Wilkinson, K. D. (2000). "Ubiquitination and deubiquitination: targeting of proteins for degradation by the proteasome." Semin Cell Dev Biol 11(3): Willert, K., C. Y. Logan, et al. (1999). "A Drosophila Axin homolog, Daxin, inhibits Wnt signaling." Development 126(18): Willert, K., S. Shibamoto, et al. (1999). "Wnt-induced dephosphorylation of axin releases betacatenin from the axin complex." Genes Dev 13(14): Yang, Y. (2012). "Wnt signaling in development and disease." Cell Biosci 2(1): 14. Zhang, Y. (2003). "Transcriptional regulation by histone ubiquitination and deubiquitination." Genes Dev 17(22):

137 Figures Figure 1. hyd is required for Wg signaling in the Drosophila wing disc. In wing disc images in this and all following figures, discs are oriented anterior left and dorsal up. (A-A ) Adult wings from control (A) (engal4 UAS-dcr2), (A ) (engal4 UAS-dcr2;UAS-RNAi1) and (A ) (engal4 UAS-dcr2;UAS-RNAi2) flies. The red line shown in A indicates the anterior/posterior boundary. Positions of wing veins including the longitude veins (L1-L5), anterior vein (acv) and posterior vein (pcv) are also indicated. (B-B ) In the wild-type larval wing disc, Wg-dependent 136

138 Sens expression is in two narrow stripes abutting the dorsal-ventral boundary and Dll is expressed in a graded manner with the highest level in the dorsal-ventral boundary. (C-C ) The expression of UAS-hydRNAi is driven by engal4 in the P compartment. Both Dll and Sens show reduced protein levels in the P compartment. The expression domain of engal4 driver is marked by GFP. (D-D ) Dll staining in wing discs bearing hyd 15 mutant clones. Mutant clones are marked by the absence of CD8-GFP. 137

139 Figure 2. hyd is not a universal transcription factor in the wing disc. (A-A ) In the wild-type larval wing disc, dad-lacz is activated by dpp signaling in a broad region along the anterior/posterior boundary. (B-B ) The expression of UAS-hydRNAi is driven by apgal4 in the dorsal compartment. Only subtle change in Dad-lacZ levels is observed. Hyd staining revealed the cells expressing hydrnai. Note that hyd signals colocalize with Dad-lacZ, suggesting that hyd is a nuclear protein. 138

140 Figure 3. hyd is not absolutely required for Wg signaling in patterning the embryonic cuticles. Ventral cuticles of embryos of (A) wild-type control, (B) wg IG22 germline clone (GLC) and (C and D) hyd 15 GLC. All embryos are oriented anterior to the left. 139

141 Figure 4. Staining of hyd antibody in the wing disc. In wing discs, staining using the hyd antibody reveals a specific nuclear signal which is eliminated in hydrnai expressed in posterior cells (marked by GFP in A-A ) or hyd 15 mosaic clone cells (marked by the absence of CD8-GFP in B-B ). 140

142 Figure 5. hyd acts downstream of or in parallel with Arm to regulate Arm activity. Somatic clones mutant for axin (A-A ) and axin-hyd 15 (B-B ) are marked by the absence of CD8-GFP. (C-C ) Arm.S10. expressing clones are marked by GFP. (D-D ) hyd 15 clones expressing UAS-Arm.S10. under the control of tubgal4 are positively marked by GFP expression. 141

143 142