Wolbachia PCR: Discover the Microbes Within!

Size: px

Start display at page:

Download "Wolbachia PCR: Discover the Microbes Within!"

Felicia Reed
5 years ago
Views:

1 Wolbachia PCR: Discover the Microbes Within!

2 Overview of the Wolbachia Lab Insect identification DNA extraction PCR? Wolbachia lecture Bioinformatics ACAGATGTC TTGTAATCCG GCCGTTGGT GGCATAGGG AAAGGACAT TTAG DNA sequencing ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATGG CTTATGCTATCGATCAATCAGG AATTCAATTTAGAGTACTTAAT AGTAGCAAAGGAGCTGCTGTT AGAGCAACACGTGCTCAGGC AGATAAAATATTATATCGTCAA GCAATACGTAGTATTCTTGAAT ATCAAAAATTTTTGTTGGTTATT CA Gel electrophoresis Images MBL courtesy of MBL

3 Use Wolbachia to Teach Students About: Ecology & Biodiversity Entomology Systematics & Taxonomic Keys Cell Biology & Symbiosis Developmental Biology & Reproduction Molecular Biology: DNA & PCR Bioinformatics

4 What is Symbiosis? Humans consist of approximately 10% human! cells and 90% prokaryotic cells, yet the idea of! studying the varied relationships between eukaryotic hosts and prokaryotic symbionts is largely ignored! in biology classes.!! - Seth Bordenstein Close interactions between different biological species!mutualism - both species benefit!commensalism - one species benefits, the other is unaffected!parasitism - one species benefits, the other is harmed

5 Symbiosis Examples

Volume 14 No. 1, p. 4-5 http://www.caf.wvu.

6 What is Endosymbiosis? Any symbiotic relationship in which one symbiont lives within the tissues of the other, either in the intracellular space or extracellularly FOME Volume 14 No. 1, p

What is Wolbachia? Obligate intracellular bacteria found in arthropods and nematodes!! Found in ~66% of arthropod species; among the most abundant intracellular bacterial genus so far discovered!

7 What is Wolbachia? Obligate intracellular bacteria found in arthropods and nematodes!! Found in ~66% of arthropod species; among the most abundant intracellular bacterial genus so far discovered!! Responsible for the induction of a number of reproductive alterations; can alter host biology in diverse ways!! Transmitted vertically through host eggs; can also move horizontally across species boundaries!! Can have parasitic, mutualistic & commensal relationships with hosts Nature 412, (5 July 2001)

8 Wolbachia is a Reproductive Parasite Def: maternally inherited microbial infections of arthropods that manipulate the reproduction of their host species towards the production or survival of infected female hosts - Resides mostly within reproductive tissues - Present in mature eggs but not mature sperm - Passed from mother to offspring vertically - Employs 4 strategies to increase # of infected females: Nature Reviews Microbiology 6, (October 2008)

Feminization Wolbachia resides in androgen-producing glands and inhibits production of male hormones during development Causes genotypic males to have female phenotype

9 Feminization Wolbachia resides in androgen-producing glands and inhibits production of male hormones during development Causes genotypic males to have female phenotype First described in isopods Land crustaceans, order Isopoda, exhibit feminization with Wolbachia infection

10 Parthenogenesis A form of asexual or clonal reproduction found females Growth & development of embryos occurs without male fertilization Caused by disruption of the cell cycle during oogenesis Results in diploid female without fertilization Wasps, order Hymenoptera: one type of insect that exhibits Wolbachia-induced parthenogenesis

11 Male Killing Wolbachia causes abortion of male embryos during embryogenesis Ensures better access to food and resources for females Wolbachia causes MK in some butterfly species, order Lepidoptera

Cytoplasmic Incompatibility CI is the most frequently found Wolbachia-induced phenotype Active area of research; mechanism not clearly known Uninfected males cannot produce viable offspring with

12 Cytoplasmic Incompatibility CI is the most frequently found Wolbachia-induced phenotype Active area of research; mechanism not clearly known Uninfected males cannot produce viable offspring with infected females and vice-versa Sperm from Wolbachia-infected males is incompatible with eggs from females that do not harbor the same Wolbachia type Wolbachia causes CI in Nasonia wasps

13 Filarial Nematodes Not parasitic but mutualistic in nematodes Host depends on Wolbachia for development & survival Horizontally transmissitted (infection) Fliarial worm infected with Wolbachia Filaria Journal 2003, 2:10

Diseases caused by insect vectors of: West Nile virus, Dengue fever, Milaria!

14 Infections Disease Control using Wolbachia Diseases caused by filarial worms: Filariasis, River blindness, Heartworms (dogs) Kill Wolbachia: Patients treated with antibiotics! Diseases caused by insect vectors of: West Nile virus, Dengue fever, Milaria! Introduce Wolbachia: will control mosquito populations!

Evolutionary Consequences Wolbachia is an important selective force behind evolution It can accelerate & alter the evolution of it s host in many

15 Evolutionary Consequences Wolbachia is an important selective force behind evolution It can accelerate & alter the evolution of it s host in many ways An current area of intensive research ABOVE: How have Wolbachia induced evolutionary change?

16 Lateral Gene Transfer Widespread Lateral Gene Transfer from Intracellular Bacteria to Multicellular Eukaryotes Hotopp et al., 317 (5845): , September 2007 Approximately one-third of sequenced invertebrate genomes contain Wolbachia gene insertions Insertional events may contribute to host chromosomal rearrangements: - Acquisition of new genes (gain-of-function) - Disruption of existing genes (loss-of-function) May play a part in reproductive isolation and speciation Allow species to acquire new genes and functions extremely quickly

17 Evidence of Wolbachia Induced Evolution Mating behavior alteration Males are rarer Competition between females increases Loss of sex Parthenogenesis causes reproductive isolation Loss of functioning sex mechanisms Reduced genetic diversity Speciation and Extinction Accumulation of mutations between isolated groups Decreasing population productivity

The Endosymbiotic Theory Certain organelles originated as free-living bacteria that were taken inside another cell as endosymbionts Mitochondria developed from α-proteobacteria

18 The Endosymbiotic Theory Certain organelles originated as free-living bacteria that were taken inside another cell as endosymbionts Mitochondria developed from α-proteobacteria Chloroplasts from cyanobacteria What does this symbiosis tell us! about the nature of our own cells?!! Could Wolbachia be the next mitochondria? It is maternally inherited also a proteobacteria

Wolbachia PCR PCR reaction with Master and Primer mixes Duplex reaction with insect and Wolbachia-specific primers: Cytochrome oxidase I: component of electron transport chain, 709 bp Wspec: 16s

19 Wolbachia PCR PCR reaction with Master and Primer mixes Duplex reaction with insect and Wolbachia-specific primers: Cytochrome oxidase I: component of electron transport chain, 709 bp Wspec: 16s ribosomal subunit specific to Wolbachia, 438 bp bp Ladder 2. Fly from SJSU lab, Ladybug from Mt. View, Aphids from my tomato plant, Ant from Sunnyvale, Large mosquito from San Mateo, Wol+ control, Nasonia, bp 438 bp Students can expect a positive Wolbachia diagnosis in one out of five insects.!

Sequencing and Bioinformatics 1. Students submit positive Wolbachia PCR samples for! DNA sequencing!! 2. BLAST the results to see if they matches a known sequence!! 3.

20 Sequencing and Bioinformatics 1. Students submit positive Wolbachia PCR samples for! DNA sequencing!! 2. BLAST the results to see if they matches a known sequence!! 3. Upload the Wolbachia sequence with those in a national database ( National Center for Biotechnology Information Basic Local Alignment Search Tool Bioinformatics is like using Google for DNA sequences

The Wolbachia Project http://discover.mbl.

bacterial endosymbionts (Wolbachia) Enhance student interest in science through an

21 The Wolbachia Project Encourage nationwide participation in the collection of new scientific data on bacterial endosymbionts (Wolbachia) Enhance student interest in science through an integrative lab series spanning biodiversity to molecular biology Professional development workshops for teachers: April

22 How Students Contribute Student generates and uploads data on the infection! rate & geographic distribution of Wolbachia! The Wolbachia scientific community isn t big enough to adequately! sample the world s arthropod populations for infection rates!! Students are potentially the biggest assets in helping scientists!! This is an effective motivator because it is publishable online! at the project s web site and is accessible by other students,! teachers, families, and scientists.! Students who collect their own insect will have a much greater interest in and ownership over the project!

23 Key Steps for Obtaining Sharable Data Insect handling Store insect in alcohol and freeze upon collection Record keeping Collection site, date, insect photos, identification DNA handling Use a very small portion of insect abdomen for DNA extraction Store DNA and PCR products in the freezer Send complete information Gel image BLAST new Wolbachia sequence Information about subgroup

24 Acknowledgements MBL and The Wolbachia Project Seth Bordenstein, Vanderbilt University John Werren, University of Rochester The International Wolbachia Conference Group

Extranuclear Inheritance

Extranuclear Inheritance Extranuclear Inheritance The past couple of lectures, we ve been exploring exceptions to Mendel s principles of transmission inheritance. Scientists have observed inheritance patterns