SUPPLEMENTARY INFORMATION

Transcription

1 DOI: /NCHEM.1856 A protein engineered to bind uranyl selectively and with femtomolar affinity Lu Zhou, Mike Bosscher, Salih Özçubukçu, Changsheng Zhang, Liang Zhang, Wen Zhang, Charles J. Li, Jianzhao Liu, Mark P. Jensen, Luhua Lai*, Chuan He* *To whom correspondence should be addressed. chuanhe@uchicago.edu; lhlai@pku.edu.cn. Contents Supplementary Methods...2 Figure S1: Strategy for the development of uranyl-binding proteins...16 Figure S2: Uranyl coordination design and URANTEIN algorithm Figure S3: Scoring for evaluating coordination structure.18 Figure S4: Uranyl-binding site at the interface of three monomers.20 Figure S5: Uranyl titration with protein and competitor..21 Figure S6: Crystal structure comparison of SUP apo-form and complex with uranyl.22 Figure S7: Details of the L67T interaction model and a structural comparison between SUP and the original template protein..23 Figure S8: Excess of MBP-SUP fusion immobilized on amylose resin can remove over 90% uranyl in seawater Figure S9: Western blot of SUP-OmpA protein...25 Figure S10: The thermal stability assay of SUP showing the T m to be ~71 C.26 Figure S11: Speciation diagrams for uranyl Figure S12: Gel filtration data for SUP with or without unrayl present...28 Table S1: 40 uranyl coordination cases from PDB...29 Table S2: Detailed information of 10 designed uranyl-binding proteins..30 Table S3: Uranyl-binding affinities of selected mutant proteins..32 Table S4: Selectivity of SUP to metal ions in seawater 33 NATURE CHEMISTRY 1

2 Table S5: Data collection and model statistics of SUP apo-form and SUP-uranyl complex...34 Table S6: The primers used for the cloning and mutation of the synthesized gene.35 Table S7: Solution compositions and equilibrium constants used to determine the K d of SUP by carbonate competition and for speciation calculations at 25 C..36 Table S8: Distribution of major uranyl-containing species in solution...37 Supplemental References 38 Supplementary Methods and Equilibrium Modeling Speciation calculations Uranyl hydrolysis constants, stability constants for uranyl carbonate complexes, 38,39 and protonation constants of the carbonate/bicarbonate anions 40 at the appropriate ionic strength (Supplementary Table S7) were used to calculate the concentration of free uranyl in the carbonate competition and sorption from freshwater experiments. Calculation of the speciation in -log [H + ] = 8.14 seawater (Supplementary Table S8) also included a correction to the free carbonate concentration to account for ion pairing. 41 Speciation curves are depicted in Supplementary Figure S11. The resulting free uranyl concentration determined for seawater was (2.4 ± 0.3) x molal (2.4 x M) at a total uranyl concentration of 1.39 x 10-8 molal (1.37 x 10-8 M). If effective competition between carbonate and SUP for uranyl in seawater is defined as the point where equal amounts of uranyl are carbonate-bound and SUP-bound (i.e., 6.85 x 10-9 M), then the two mass balance equations for uranyl and SUP can be combined with the dissociation constant expression for UO 2 (SUP) to determine the K d required to compete with carbonate at a given SUP concentration and the appropriate uranyl concentrations for seawater, NATURE CHEMISTRY 2

3 K d required = 2[SUP] total [UO 2+ 2 ] free ([UO 2+ 2 ] total [UO 2+ 2 ] free ) -1 [UO 2+ 2 ] free = 3.52 x 10-9 [SUP] total 2.41 x M The maximum practical total SUP concentration for uranium recovery from seawater is approximately 100 M. This corresponds to a K d required of 350 fm or lower. Lower total SUP concentrations would require still higher affinities, for example if [SUP] total = 10 M, the K d required would be 35 fm or lower. For the lowest possible SUP concentration that could bind half of the total uranyl, 6.85 x 10-9 M, the K d required is ~ M. The uranyl hydrolysis constants are well known for low ionic strength solutions or solutions of NaClO 4 electrolytes, but they are not well defined for NaCl or seawater solutions. 38 Given this limitation, a series of speciation calculations to determine the impact of uranyl hydrolysis on the calculated distribution of uranyl species was necessary. The infinite dilution hydrolysis constants (Supplementary Table S7), which represent a reasonable maximum possible formation of uranyl-hydroxide species in the NaCl or seawater systems, were used to test the impact of uranyl hydroxides on the uranyl speciation in a series of model calculations. In these model cases, which displayed the maximum possible fraction of uranyl-hydroxide species in seawater or carbonate competition experiments, the calculations demonstrated that the uranyl speciation was dominated by carbonate and protein complexes (Supplementary Table S8, Supplementary Fig. S11). Any uranyl hydroxide species accounted for less than 0.1% of all the uranyl species in the seawater systems, and no more than 2% of all uranyl species at the lowest carbonate concentrations in the carbonate K d determinations. Hydrolytic species had no significant effect on the concentration of free uranyl cation (and thus the calculated K d ) in these systems. However, the carbonate concentration in the ph 7 uranyl sorption from water experiment was much lower because this experiment did not use added carbonate. In that case, NATURE CHEMISTRY 3

4 uranyl hydroxides were important species regardless of the uranyl concentration (Supplementary Table S8). Fortunately, the hydrolysis constants are well known under those conditions (ionic strength < 0.01 M). 38 Similar model calculations were also used to test the importance of UO 2 Cl +, (UO 2 ) 2 CO 3 (OH) - 3, (UO 2 ) 3 (CO 3 ) 6-6, (UO 2 ) 4 (OH) + 7, (UO 2 ) 3 (OH) - 7, (UO 2 ) 2 (OH) 3+, UO 2 (HPO 4 ), UO 2 (OH) 2 H 2 O (s), and UO 2 CO 3 (s) using literature binding constants. 38 None of these species, alone or together, had a discernible impact on the distribution of dissolved uranylcarbonate or protein species or on the free uranyl concentration. Generation of a library of potential binding residues Generally, each residue was computationally mutated to aspartate, glutamate, asparagine, or glutamine using the basic Mayer rotamer library 42. If the mutated side-chain did not conflict with surrounding residues, then the information regarding the oxygen position, linked carbon, and corresponding rotamer was deposited to an oxygen library and, in the case of aspartate and glutamate, a carboxyl library. The native aspartate and glutamate oxygens and main-chain oxygens were also deposited in the appropriate library. To efficiently search for hydrogen bonds between uranyl and the scaffold protein, the hydrogens of the native scaffold were collected to a hydrogen library. Screening using the URANTEIN algorithm The URANTEIN algorithm searches for uranyl-binding sites in a scaffold protein that satisfies one of the three coordination features introduced in Fig. S2c - S2e using a series of five steps in Fig. S2f. First, a carboxyl is selected from the carboxyl library. The theoretical position of the coordinated uranyl is calculated using standard coordination parameters: the O-U-O line is NATURE CHEMISTRY 4

5 perpendicular to the carboxyl plane, and the distances between the two carboxyl oxygens and the uranium are equal at 2.46Å. If this uranyl is not in serious conflict with the surrounding residues, the oxygens which can coordinate with this uranyl will be searched from the oxygen library in step 2. Second, every element in the oxygen library was checked for the extent to which it satisfied the coordination requirement. A coordination score is provided, which includes U-O distance, C-O-U angle, planarity with the first carboxyl, repulsion with the first carboxyl, and repulsion between the corresponding mutated residue and the uranyl (Fig. S3a). Next, the results were filtered so that all remaining results had at least one carboxyl plus one oxygen from a different residue without serious repulsion. Subsequently, if at least one coordination structure was found, then hydrogen bonding was searched via the hydrogen library of the scaffold. Finally, the uranyl binding sites were evaluated by a scoring function containing oxygen coordination, oxygen compatibility, and hydrogen bonding (Fig. S3a). Further Selection From the top 5,000 hits we first narrowed down to hits of each three coordination types by calculating the buried area of uranyl ion. Uranyl should be in a pocket with over 2/3 uranyl surface buried. The hit protein should also have entrance for uranyl binding. If uranyl is completely buried in a protein core, the model was eliminated. We also deleted redundant results with high sequence similarity in this step. Only the hit with the highest score among the homologic results was retained. Secondly, we narrowed down to about 20 hits of each three coordination types manually by considering the local environment of binding site, including potential steric clashes and stability of coordination residues. Models with potential steric clashes were eliminated. The coordination residues including mutated ones should locate on the NATURE CHEMISTRY 5

6 segments with secondary structure to make the binding motif rigid enough during the mutation process. Accordingly, the results with better scores have higher probability to be selected. Finally, we selected the 10 hits by evaluating the remaining results based on perceived thermal stability (proteins from thermophilic organisms are preferred) and origin of organism. For example, most human proteins are eliminated because they are less likely to express well in E. coli, whereas U09, which consists of bundled α-helices, is chosen over comparable hits with more random coil. Plasmid construction and mutation U01-U10 and SUP-OmpA fusion gene were synthesized by GeneScript. The gene sequences of U09 and SUP-OmpA fusion protein are shown below. Mutations were performed using Pfu Ultra II polymerase from Agilent. U01-U10 and all U09 mutations were cloned and expressed in pmcsg19 vector for expression in BL21 or PRK1037 E. coli as previously described 43. All plasmid DNA was purified using a spin mini-prep kit, eluted into Type A water. The primers used for the cloning and mutation of the synthesized gene are listed in Table S6. U09 gene: CTG GAT TGC CGT GAA CGC ATT GAA AAA GAC CTG GAA AAC CTG GAA AAA GAA CTG ATG GAA ATG AAA AGC ATC AAA CTG TCT GAT GAC GAA GAA GCG GTG GTT GAA CGT GCC CTG AAT TAT CGC GAT GAC AGT GTC TAT TAC CTG GAA AAA GGC GAT CAT ATT ACC TCC TTT GGT TGT ATC ACG TAC GCG CAG GGC CTG CTG GAT AGC CTG CGT ATG CTG CAC CGC ATT ATC GAA GGT SUP-OmpA fusion gene: NATURE CHEMISTRY 6

7 ATG AAA GCT ACT AAA CTG GTA CTG GGC GCG GTA ATC CTG GGT TCT ACT CTG CTG GCA GGT TGC TCC AGC AAC GCT AAA ATC GAT CAG GGA ATT AAC CCG TAT GTT GGC TTT GAA ATG GGT TAC GAC TGG TTA GGT CGT ATG CCG TAC AAA GGC CAG CGT GAA AAC GGT GCA TAC AAA GCT CAG GGC GTT CAA CTG ACC GCT AAA CTG GGT TAC CCA ATC ACT GAC GAC CTG GAC ATC TAC ACT CGT CTG GGT GGC ATG GTA TGG CGT GCA GAC ACT AAA TCC AAC GTT TAT GGT AAA AAC CAC GAC ACC GGC GTT TCT CCG GTC TTC GCT GGC GGT GTT GAG TAC GCG ATC ACT CCT GAA ATC GCT ACC CGT CTG GAA TAC CAG TGG ACC AAC AAC ATC GGT GAC GCA CAC ACC ATC GGC ACT CGT CCG GAC AAC GGC GGA GGT TCT GGA GGA GGG AGC AAT GCC CTG GAT TGC CGT GAA CGC ATT GAA AAA GAC CTG GAA AAC CTG GAA AAA GAA CTG ATG GAA ATG AAA AGC ATC AAA CTG TCT GAT GAC GAA GAA GCG GTG GTT GAA CGT GCC CTG AAT TAT CGC GAT GAC AGT GTC TAT TAC CTG GAA AAA GGC GAT CAT ATT ACC TCC TTT GGT TGT ATC ACG TAC GCG GAG GGC CTG ACG GAT AGC CTG CGT ATG CTG CAC CGC ATT ATC GAA GGT Expression and purification of protein The strains carrying the plasmids were grown in LB to OD 600 = 0.6, induced with 1 mm IPTG and cells were grown overnight at room temperature before harvesting. Cells were lysed by sonication in the presence of 1 mm PMSF as serine protease inhibitor. Supernatant was separated by centrifugation and filtration through 0.45 μm PVDF. Ni-NTA columns were run using 10 mm Tris ph 7.4, 500 mm NaCl with 1 mm DTT and imidizole ramping from 0 to 500 mm. Ni-NTA column chromatography gave pure protein in good yields. Protein samples were NATURE CHEMISTRY 7

8 concentrated using 10 kda cutoff centrifuge filters and desalted into appropriate buffers. The His-tag was removed by TEV protease. All crystallization samples were further purified by gel filtration. Gel filtrations were run in 10 mm Tris ph 7.4 with 100 mm NaCl containing 1 mm dithiothreitol (DTT). Protein crystallization Crystals of SUP apo-form and SUP-uranyl complex were originally identified using the PEG ION crystallization screen kit (Hampton Research). Optimized crystals were produced using hanging drop vapor diffusion at 16 C by mixing 1 μl of protein solution at mg/ml with 1 μl reservoir solution containing 2% v/v Tacsimate ph 4.0, 0.1 M sodium acetate trihydrate ph 4.6, 16% PEG For SUP-uranyl complex, uranyl was mixed with SUP at 1.2:1 molar ratio before the drop set. Crystals appeared after 1 day and continued to grow for one week. Crystal handling and data collection Crystals were transferred to cryoprotectant consisting of a modified reservoir solution supplemented with 15% glycerol (v/v) and quickly frozen in liquid nitrogen. All diffraction data sets were collected at 100K at the macromolecular crystallography for life science beamline LS/CA-CAT (21-ID-F) and NE-CAT (24-ID-C), respectively, at the Advanced Photon Source, Argonne National Laboratory. Native data sets extending to 1.30 Å resolution were collected at Å wavelength (12.66 kev). Protein-uranyl complex data sets extending to 1.29 Å were collected at the uranium L 3 -edge (17.18 kev, Å). The data were processed with HKL and the scaled data were used for molecular replacement. Crystallographic statistics are summarized in Table S5. NATURE CHEMISTRY 8

9 Data refinement For phasing, model building and refinement, the structures of both UBP apo-form and UBPuranyl complex were determined by molecular replacement using Phaser in the CCP4 suite 45, with the template protein as the search model (pdb code: 2PMR). The structures were then refined by using Phenix 46. Manual rebuilding of the model was carried out using the molecular graphics program COOT 47 based on electron density interpretation. Water molecules were incorporated into the model if they gave rise to peaks exceeding 3σ in Fo-Fc density maps. The final refined model had good stereochemistry with 99.4% of the residues in the most favored regions of the Ramachandran plot with none in the disallowed regions (Table S5). Arsenazo III determination of uranyl A modification of the Arsenazo III method 48 was employed to determine uranyl concentrations unless otherwise indicated. 50 μl of 80 μm Arsenazo III containing 0.1 M HCl was titrated with an equal volume of uranyl solutions ranging from 0 to 30 μm, and the absorbances at 652 nm and 800 nm were monitored. The value of A 652 -A 800 increases linearly in this range, and can be converted to uranyl concentrations. For high DGA (diglycolic acid) or carbonate concentrations HCl was added to the final Arsenazo solution to compensate for the buffering activity of the carboxylates. Diglycolic acid competition assays Diglycolic acid (DGA) competition assays were performed at ph 6.0 or 6.5 in 10 mm Bis-Tris buffer with 300 mm NaCl. 9 Standard solutions of 100 μm protein (expressed by PRK1037 E. NATURE CHEMISTRY 9

10 coli with his-tag present, with an extinction coefficient of 7575 M -1 cm ) and 100 μm UO 2 were prepared and diluted 10 fold with the appropriately scaled DGA buffer. The final solutions contained 10 mm Bis-tris (ph 6.5), 10 μm protein, 10 μm UO 2+ 2 and different concentrations of DGA. The solutions were mixed and filtered through 3 kda cutoff centrifuge filters. Flowthrough was tested for uranyl concentration following Arsenazo III assay. The experiments were repeated in triplicate. Carbonate competition assays Carbonate competition assays were performed similarly to the DGA assays, but with freshly prepared ph carbonate solutions in Tris-HCl buffer. All water used to prepare solutions was freshly degassed and deionized and protected against further sorption of atmospheric CO 2. The final solution contained 10 mm Tris-HCl (ph ), 10 μm protein, 10 μm UO 2+ 2 and different concentrations of carbonate. Each binding curve was measured in three replicate experiments. The reproducibility of each individual binding measurement at a given total carbonate concentration was ±5%. The K d of the uranyl-protein complex was determined by fitting the resulting binding curve using the uranyl-carbonate binding constants in Supplementary Table S7. (Inclusion of the uranyl hydrolysis constants did not alter the calculated K d in these experiment). The three independent sets of carbonate competition data for each protein were combined and fit together using two different approaches. First, the binding curve was fit by non-linear least squares regression to the Hill equation implemented in the program Origin 8.5 (OriginLab), allowing the minimum and maximum of the curve, the midpoint, and the Hill coefficient to vary simultaneously. In the second approach, the K d was calculated directly from the uranyl mass balance equation at each experimental point, and the 15 individual K d values between 10% and NATURE CHEMISTRY 10

11 95% protein binding were averaged. Each approach gave K d values that were not statistically distinguishable at the 95% confidence level. Nevertheless, the K d values reported in Table S3 were based on the fit to the Hill equation, and the stated uncertainty incorporates both the uncertainty in the total concentration of carbonate required for 50% binding derived from the fit and the systematic uncertainty introduced by the uncertainties in the carbonate binding constants. Resin immobilized U09 mutants SUP protein (expressed by PRK1037 E. coli with his-tag present, an extinction coefficient of 7575 M -1 cm -1 ) was immobilized on Sulfhydryl Coupling Resin from G-Biosciences ( ) by suspending the commercial slurry and washing both resin and protein with 50 mm Tris ph 8.5 coupling buffer containing 5 mm EDTA and 1 mm TCEP (tris(2-carboxyethyl)phosphine) to generate free sulfhydryl. The resin and protein were combined with excess protein and held at room temperature with mixing for 30 minutes. The reaction flow-through was collected to determine efficiency and the resin was washed with the Tris coupling buffer. The resin was quenched with 50 mm L-Cysteine HCl in coupling buffer mixed at room temperature for 30 minutes. Prior to use the resin was washed again with coupling buffer. Metal competition assay Metal competition assays of SUP were originally performed using protein immobilized on resin. 1 ml solutions of 500 nm uranyl with metals at different concentrations were prepared. The solutions were mixed and incubated with resin in two aliquots for one minute each. The solution was removed by vacuum filtration and the resin was washed thrice with 750 μl of 10 mm Bis- Tris buffer at ph 6.5. We eluted with 50 μl of 20 mm carbonate solution at ph 9.0 in 10 mm NATURE CHEMISTRY 11

12 Tris. We used the Arsenazo III method 48 to detect uranyl, and tested at a maximum ratio of 2.0 x 10 6 metal ions to 1 uranyl ion. If no uranyl was detected, we tested the competition again with metal diluted ten-fold and repeated until uranyl was detected. After each test, the resin was regenerated by rinsing with 750 μl saturated EDTA solution followed by 750 μl of 20 mm carbonate solution at ph 9.0 in 10 mm Tris and washing with three aliquots of 750 μl of 10 mm Bis-Tris buffer at ph 6.5. To ensure that the presence of competing cations was not affecting the Arsenzo III assay, the metal competition assay was repeated using amylose resin and ICP-MS for detection. SUP-MBP fusion protein was immobilized on amylose resin at a concentration of 7 mg/ml. The assay solutions contain 500 nm uranyl, different metals (based on the solubility, ranging from 1 mm to 2 M ) and 1 mm DGA (diglycolic acid) to prevent the precipitation and non-specific binding of uranyl ion. The ph value of each mixed metal solution was measured. For each sample, 1 ml mixed metal solution was incubated with 0.3 ml amylose resin for 1 minute. The supernatant was diluted by 1% HCl and determined by ICP-MS. Seawater sequestration assays by amylose resin For preparation of SUP-bound amylose resin, SUP was cloned into pmcsg19 vector and expressed in BL21 E. coli to produce an MBP fusion protein. Cells were harvested, sonicated, and purified by nickel-nta chromatography. The resulting protein was concentrated and exchanged into a 10 mm Tris buffer at ph 7.4 containing 1 mm EDTA and 100 mm NaCl. The solution was mixed by shaking and then exchanged to a 10 mm Tris buffer at ph 8.0 containing 100 mm NaCl. The concentration was measured by absorbance at 280 nm with an extinction coefficient of M -1 cm -1. The protein was then incubated with amylose resin (New England NATURE CHEMISTRY 12

13 Biolabs, E8021S) in aliquots for 30 min. The supernatant was removed and the protein concentration was tested. New protein aliquots were added until the resin was saturated. The solution was washed with ph 8.0 Tris buffer containing no protein and the eluent was tested for the presence of any protein. This procedure was repeated until no protein was eluted. The final concentration was calculated at around 60 nmol per ml of concentrated resin bed volume. The resin was then aliquoted as a wet slurry to 50 ml centrifuge tubes in amounts corresponding to equimolar protein on resin and uranyl in seawater and 10:1 protein to uranyl. Larger resin amounts were not tested due to the limits of eluting and testing from large resin samples. The resin was incubated at room temperature in 50 ml of synthesized seawater under constant gentle inversion for 30 minutes. The solution was then spun at 5,000 rpm for 10 minutes to concentrate the resin at the bottom of the tube. The solution was then vacuum filtered through a QIAquick Spin Column (Mat. No ). In the last 5 ml of solution, the resin was resuspended by pipetting gently and filtered with the solution. The flow-through was collected and analyzed by ICP-MS. The resin was dried by spinning for 1 min at 8,000 rpm. The resin was then treated with 20 mm carbonate solution at ph 9.2 for 30 min at room temperature in 100 μl aliquots. The resin was centrifuged at 8,000 rpm for 1 min and the flow-through collected and analyzed by Arsenazo III. If any uranyl was detected the resin was washed again with carbonate until no more uranyl was detected. For the ion exchange approach, MBP-SUP fusion protein (60 mg) was immobilized on 10 ml amylose resin in a ϕ10 mm column and pre-washed by non-uranyl synthesized seawater. Total 10 ml seawater sample flowed through the column at a rate of 2 ml/min, and the flow-through was collected and analyzed by ICP-MS. Seawater sequestration assays by surface-displayed cells NATURE CHEMISTRY 13

14 For preparation of surface-displayed cells, SUP-OmpA fusion protein was cloned into pbad vector and expressed in BL21 E. coli, with a linker GGGSGGGS between SUP and OmpA. Cells were induced by 2% L-arabinose overnight and harvested by centrifugation at 6000 rpm. Cells were washed with degassed, deionized H 2 O prior to use. For the seawater extraction assay, SUPbound amylose resin (5 ml) or surface display cells (0.5 ml pellet) were incubated with 50 ml synthesized seawater for 30 minutes at room temperature. Supernatants were sent for uranium analysis by ICP-MS. Blank resin or non-induced cells were used as negative controls and no uranium enrichment was observed. Western blot The surface display cells were grown to 0.6 (OD 600 ) and induced with and without 2% L- arabinose overnight in LB. The bacteria were collected and suspended in buffer A (500 mm NaCl, 10 mm Tris HCl, ph 7.4, 1 mm DTT, 5% glycerol), followed by sonication to lyse the bacteria. The 20-μL supernatants were loaded into a 12% SDS page gel for separation. After standard Western blot procedures, the proteins were detected by anti-flag antibody (Sigma- Aldrich, A8592). Thermal stability assay Fresh SUP protein purified by Ni-NTA column and gel filtration column was applied in the thermal shift assay study. The experiment was performed on Applied Biosystems 7500 Fast Real-time PCR system using sypro-orange as the fluorescence dye and followed the standard procedure of protein thermal shift studies provided by Applied Biosystems. Briefly, SUP protein (0.25 µg/µl, final concentration) was mixed with dye (5-10X, final concentration) in total 20 µl NATURE CHEMISTRY 14

15 solution (50 mm Bis-tris, ph 6.0, mm NaCl) and heated from 10 to 95 at 1% heating rate. The fluorescence signals were monitored using the ROX (Ex:584 nm, Em: 612 nm) as reporter. The data were analyzed by Protein Thermal ShiftTM software (Invitrogen, version 1.1). NATURE CHEMISTRY 15

16 Supplementary Figure S1. Strategy for the development of uranyl-binding proteins. In our strategy for the development of uranyl-binding proteins binding motifs were identified and the protein database was screened for appropriate binding models. Virtual hits were expressed, tested, and crystallized. Crystal and experimental data were used to develop new mutants which were again tested, crystallized in mutant form. This loop continued until satisfactory binding efficiencies were reached or the scaffold no longer yielded improved mutants. NATURE CHEMISTRY 16

17 Supplementary Figure S2. Uranyl coordination design and URANTEIN algorithm. The crystal structure of uranyl nitrate hexahydrate (5) is the reference for protein-binding-uranyl coordination design(a and b). Uranyl is represented by blue and red ball and stick model. In this structure, six oxygens from four nitrate oxygens and two water oxygens coordinate the uranium atom in the equatorial plane. The distance of U-nitrate O is 2.50 Å, and U-water O is 2.4 Å. In our design, nitrate was replaced with the carboxyl of an aspartate or glutamate side-chain, and one or two waters were replaced with the carbonyl oxygen of an asparagine or glutamine sidechain, main-chain carbonyl oxygen, or monodetate coordinate aspartate or glutamate (c). Conformations with two adjacent carboxyl ligands (d), or three carboxyl ligands (e) were also considered.(f) The URANTEIN algorithm uses a five-step screening strategy based on preferred uranyl coordination geometries. NATURE CHEMISTRY 17

18 Supplementary Figure S3. a, Scoring for evaluating coordination structure. 1) Oxygen coordination requirement and evaluation. i Oscore coefficentof parameter i (Oscore should be greater than 0.4) Parameter coefficent U-O(Å) : : : : 0.4 COU(º) 60-85: : 1.0 min( OUO A, OUO B ) (º) 60-75: : 1.0 min(o-o 1, O : : 0.8 >2.6: 1.0 NATURE CHEMISTRY 18

19 O 2 ) (Å) R repulsion If R is not carboxyl or min( O UO A, O UO B ) < 60º, then all atoms of R cannot repulse with UO 2 and the first carboxyl 2) Hydrogen bonding requirement and evaluation. i Hscore coefficentof parameter i (Hscore should be greater than 0.4) Parameter coefficient O A -H(Å) : : : : 0.4 O A Hroot (º) 60-90: : : 1.0 UO A H (º) 60-90: : : 1.0 3) Oxygen-oxygen compatible requirement and evaluation. i O compat O jis not at the residuepostionof i i - O j compatible coefficient (should be greater than 0.4) 4) Compatible coefficient O 1 -O 2 (Å) : : 0.8 >2.6: 1.0 Uranyl coordination structure score. i i type_coefficient 1 O compat) O score Uscore ( i j H j score Main-chain Wild carboxyl Else wild Mutate carboxyl else Type_coefficient b, Crystal structure of 2PMR, a scalfold of U09 selected for further optimization. SUP were designed based on the mutation of 2PMR, which was a protein of unknown function from Methanobacterium thermoautotrophicum. c, Designed coordination environment. The predicted environment of U09 with the mutations identified in the URANTEIN screening algorithm shows two bidentate and two monodentate equatorial ligands as well as a hydrogen bond for one of the axial oxo-ligands. NATURE CHEMISTRY 19

20 Supplementary Figure S4. Uranyl-binding site at the interface of three monomers. a, The trimer interface binding site is overviewed b, and detailed and shows an idealized uranyl-binding motif featuring 5 equatorial coordinates by three glutamate and one water molecule. A hydrogen bond is also observed between the uranyl axial oxo-ligand and side chain asparagine39. NATURE CHEMISTRY 20

21 Supplementary Figure S5. a) Uranyl binding affinity of SUP with DGA. Competition assay of SUP vs. DGA for uranyl yields a K d of 0.2±0.1 nm at ph 6.0 in 300 mm NaCl. b) Uranyl titration with protein and competitor. A stock solution of 10 μm protein and 10 mm DGA was prepared in Bis-tris buffer (ph 6.0) with 300 mm NaCl. Uranyl was added to aliquots of the stock to create solutions ranging from 0 to 30 um. At low uranyl concentrations, most of the uranyl (see panel a) is bound to the protein in the designated binding site (K d = 0.2 nm at ph 6.0 and 7.4 fm at ph 8.87) The sharp increase in eluted uranyl above 12 μm total uranyl indicates saturation of the primary binding site and that there are no other specific interactions between uranyl and the protein with a K d lower than 4 nm. NATURE CHEMISTRY 21

22 Supplementary Figure S6. Crystal structure comparison of SUP apo-form and complex with uranyl. Arg71 forms a hydrogen bond with an axial oxo of the uranyl ion in the complex structure (green) but has different conformation in apo-form (magenta). Glu17 also has a conformational change in apo-form compared to the SUP-uranyl complex structure, showing that uranyl binding is site specific. NATURE CHEMISTRY 22

23 Supplementary Figure S7. Details of the L67T interaction model and a structural comparison between SUP and the original template protein. a, Thr67 forms a hydrogen bond with Ala64 main chain (shown in stick) near the uranyl-binding pocket by Glu17, Asp68 and Arg71 (shown in line). The newly formed hydrogen bond stablizes the helix structure, thus increasing the binding affinity. b, Structural comparison between SUP (green) and template protein 2PMR (blue). Residue 67 (Thr in SUP and Leu in 2PMR) are shown in stick. The last helix bent in SUP compared to template protein, showing that hydrophobic core residue (Leu67) mutation significantly alters the conformation. NATURE CHEMISTRY 23

24 U concentration (ppb) Seawater Flow through 0 Seawater Flow through Supplementary Figure S8. Excess of MBP-SUP fusion immobilized on amylose resin can remove over 90% uranyl in seawater. MBP-SUP fusion protein (60 mg) was immobilized on 10 ml amylose resin in a 10 mm column and pre-washed by non-uranyl synthesized seawater. A total of 10 ml seawater sample flowed through the column at a rate of 2 ml/min, and uranyl concentration of the flow-through was analyzed by ICP-MS. NATURE CHEMISTRY 24

25 Supplementary Figure S9. Western blot of SUP-OmpA protein. Western blot showing that SUP-OmpA fusion protein can be effectively expressed after L-arabinose induction. The original E.coli OmpA (~19 kd) was replaced by overexpressed fusion protein (~ 26 kd). NATURE CHEMISTRY 25

26 Supplementary Figure S10. The thermal stability assay of SUP protein. a) the protein showed the T m to be ~71 C in the buffer containing 50 mm Bis-tris, ph 6.0, 50 mm NaCl. b) the protein s Tm did not alter under different salt concentration. NATURE CHEMISTRY 26

27 Supplementary Figure S11. Speciation diagrams for uranyl. The speciation for (a) 13 nm uranyl in seawater with K d UO 2 (SUP) = 7.4 fm and (b) 667 nm uranyl in ph 7.0 water that is in equilibrium with atmospheric CO 2 with K d UO 2 (SUP) = 0.2 nm. Calculations were performed using the program Medusa 52 and the equilibrium constants and solution compositions given in Supplementary Table S7. Solid squares ( ) represent the amount of uranium sorbed to the SUP resin at (a) 1:1 10:1 and 6100:1 SUP:U ratios in seawater or (b) a 30:1 SUP:U ratio in water. NATURE CHEMISTRY 27

28 Supplementary Figure S12. Gel filtration data for SUP with or without unrayl present. The peaks of SUP were shown at the same position with 50 µm uranyl present (a) or without uranyl (b) in a Superdex 200 column (GE healthcare). The buffer contains 20 mm Tris-HCl and 100 mm NaCl. NATURE CHEMISTRY 28

29 Supplementary Table S1. 40 uranyl coordination cases from PDB. PDB Uranyl Coordination oxygen U-O (Å) COU 1BZO IUM A 502 OD1 ASP A BZO IUM A 502 OD2 ASP A BZO IUM A 559 OE1 GLU A BZO IUM A 559 OE2 GLU A CT9 IUM A1101 OD1 ASP A CT9 IUM A1101 OD1 ASP A CT9 IUM A1102 OE1 GLU A CT9 IUM A1102 OD1 ASP A CT9 IUM A1103 OE1 GLU A CT9 IUM A1103 OD2 ASP A EFQ IUM A 199 OD1 ASP A EFQ IUM A 199 OD2 ASP A EFQ IUM A 199 O GLN A FE4 IUM A1003 OD2 ASP A JET IUM C 1 OD2 ASP A JET IUM C 4 OE2 GLU A JET IUM C 4 OD2 ASP A JET IUM C 5 OD2 ASP A JET IUM C 5 OD2 ASP A JET IUM C 8 OD2 ASP A JET IUM C 9 OE1 GLN A NCI IUM A 300 OE2 GLU A NCI IUM A 300 OD1 ASP A T9H IUM A 402 OE1 GLU A T9H IUM A 402 OE2 GLU A T9H IUM A 407 OD1 ASP A T9H IUM A 407 OD2 ASP A VEO IUM A1441 OD2 ASP A VEO IUM A1441 OE1 GLU A VEO IUM A1441 OE2 GLU A VEO IUM A1442 OD2 ASP A VEO IUM A1442 OE2 GLU A L0O IUM A 428 OD1 ASP A L0O IUM A 428 OD2 ASP A L0O IUM A 428 OD1 ASP A L0O IUM A 428 OD2 ASP A L0O IUM A 430 OE1 GLU A L0O IUM A 430 OE2 GLU A L0O IUM B 429 OE1 GLU B L0O IUM B 429 OD2 ASP B L0O IUM B 431 OD2 ASP B NATURE CHEMISTRY 29

30 Supplementary Table S2. Detailed information of 10 designed uranyl-binding proteins. Data for the top ten uranyl-binding protein candidates identified by the in silico screen. The mutation column indicates mutations necessary for the native protein to fulfill the screen conditions. The residues column indicates the residues expected to bind uranyl in the equatorial positions. E X P N O. U 01 U 02 U 03 U 04 PDB Code 2G9M 2O6F 1QR4 1JRL Protein name pigment protein phycoerythrin from Cyanobacterium rtp34 from Treponema pallidum Fibronectin type-iii domain from chicken tenascin E. coli Lysophospholiase L1 Mutatio n Asn121 Glu Pro123 Asp Asp074 Gln Ala119 Gln Val145 Glu Val133 Glu Leu011 Asp Gly072 Glu Ile156A sp Sequence (after mutation) QRAAARLEAAEKLGSNHEAV VKEAGDACFSKYGYNKNPGE AGENQEKINKCYRDIDHYMR LINYTLVVGGTGPLDEWGIA GAREVYRTLELDSAAYIAAF VFTRDRLCAPRDMSAQAGVE FCTALDYLINSLS DEFPIGEDRDVGPLHVGGVY FQPVEMHPAPGAQPSKEEAD CHIEAQIHANEAGKDLGYGV GDFVPYLRVVAFLQKHGSEK VQKVMFAPMNQGDGPHYGAN VKFEEGLGTYKVRFEIAAPS HDEYSLHIDEQTGVSGRFWS EPLVAEWDDFEWKGPQW GSTVVGSPKGISFSDITENS ATVSWTPPRSRVDSYRVSYV PITGGTPNVETVDGSKTRTK LEKLVPGVDYNVNIISVKGF EESEPISGILKTALDS ADTLLILGDSDSAGYRMSAS AAWPALLNDKWQSKTSVVNA SISGDTSQQGLARLPALLKQ HQPRWVLVELGENDGLRGFQ PQQTEQTLRQILQDVKAANA EPLLMQIRPPANYGRRYNEA FSAIYPKLAKEFDVPLLPFF MEEVYLKPQWMQDDGDHPNR DAQPFIADWMAKQLQPLVNH DSLE Coordinati on residues Glu071 Glu121 Asp123 Glu072 Gln074 Gln119 Asp121 Glu133 Lys143 Glu145 Asp011 Glu072 Asp156 U 1T0A 2C-Methyl-D- Ile111Gl MKIRIGHGFDVHKFGEPRPL Asp058 NATURE CHEMISTRY 30

31 05 Erythritol-2,4- cyclodiphosphate Synthase from Shewanella Oneidensis U 06 U 07 U 08 U 09 U 10 2J80 3HDP 1IIU 2PMR 2FA5 Periplasmic domain of sensor histidine kinase CITA Ni(II)-bound Glyoxalase-I from Clostridium acetobutylicum Chicken plasma retinol-binding protein (RBP) unknown function from Methanobacterium thermoautotrophicum multiple antibioticresistance repressor (MarR) from Xanthomonas campestris u Lys061 Asn His009 Glu Leu106 Asp Ile129Gl u Leu132 Ala Cys077 Glu Ala104 Glu His5Thr Glu124 Ala Lys017 Glu Asn017 Glu Leu013 Asn His064 Gln Ser027G lu Ile049A sp Arg053 Asp ILCGVEVPYETGLVAHSDGD VVLHAISDAILGAMALGDIG NHFPDTDAAYKGADSRVLLR HCYALAKAKGFELGNLDVTI IAQAPKMAPHEEDMRQVLAA DLNADVADINVKATTTEKLG FTGRKEGIAVEAVVLLSRQ MDITEERLEYQVGQRALIQA MQISAMPELVEAVQKRDLAR IKALIDPMRSFSDATYITVG DASGQRLYHVNPDEIGKSME GGDSDEALINAKSYVSVRKG SLGSSDRGKSPIQDATGKVI GIVSVGYTEEQAE GSHMSLKVHTIGYAVKNIDS ALKKFKRLGYVEESEVVRDE VRKVYIQFVINGGYRVELVA PDGEDSPINKTIKKGSTPYH IEYEVEDIQKSIEEMSQIGY TLFKKAEIEPAIDNRKVAFL FSTDIGLIALLEK MDCRVSSFKVKENFDENRYS GTWYAMAKKDPEGLFLQDNV VAQFTVDENGQMSATAKGRV RLFNNWDVCADMIGSFTDTE DPAKFKMKYWGVASFLQKGN DDHWVVDTDYDTYALHYSCR ELNEDGTCADSYSFVFSRDP KGLPPEAQKIVRQRQIDLCL DRKYRVIVHNGFCS LDCRERIEKDLENLEKELME MKSIKLSDDEEAVVERALNY RDDSVYYLEKGDHITSFGCI TYAQGLLDSLRMLHRIIEG MSDLDTPTPSPHPVLLNLEQ FLPYRLEVLSNRISGNIAKV YGDRYGMADPEWDVITILAL YPGSSASEVSDRTAMDKVAV SRAVARLLERGFIRRETHGD DRRRSMLALSPAGRQVYETV APLVNEMEQRLMSVFSAEEQ QTLERLIDRLAKDGLPRMASKD Asn061 Glu111 Glu009 Asp106 Glu129 Glu052 Glu077 Glu104 Glu017 Gly051 Asp079 Asn013 Glu017 Gln064 Asp068 Asp049 Asp053 Glu027 NATURE CHEMISTRY 31

32 Supplementary Table S3. Uranyl-binding affinities of selected mutant proteins. Uranyl-binding efficiencies for 4 top virtual hits and for optimized mutants of U09. The binding affinity of first generation hits are around the 10-7 to 10-8 M level. Each successive mutation to U09 yielded significant increases in binding affinity.the data were repeated at least three times. Mutant Dissociation constant (K d ) U02 98±25 nm a U04 98±7 nm a U09 37±9 nm a 56±1 pm b U10 92±38 nm a U09 Leu67Thr 1.8±0.3 nm a 5.0±5pM b U09Gln64Glu, Leu67Thr 1.0±0.3 pm b, 20±8 pm a, SUP (U09Asn13Asp, Gln64Glu, Leu67Thr) 7.4±2.0 fm c, 0.2±0.1 nm d, a ph 6.5, DGA assay b ph 8.15, carbonate assay c ph 8.87, carbonate assay d ph 6.0, DGA assay NATURE CHEMISTRY 32

33 Supplementary Table S4. Selectivity of SUP to metal ions. Seawater levels of seventeen metals are expressed as concentrations and molar excess compared with uranyl in column 1-3. These values are given as a comparison to the measured selectivity of SUP for uranyl against each metal. The conditions and results of competition experiment evaluated by ICP-MS were listed in column 4-6, including ph value of metal-uranyl mixture, metal concentration and uranyl concentration in the supernatant. The selectivity was calculated based on the uranyl concentration in the supernatant and molar excess of metal ions. Metal [Seawater] Excess ph Metal concentrat ion (M) Uranyl concentrat ion (incubated with amylose resin, nm) Selectivity Blank ±6 resin Na mm 3.5* ±13 9.8±1.6* 10 6 Mg mm 3.9* ±20 3.4±0.4 * 10 6 K + 10 mm 7.6* ±13 6.5±0.8 * 10 6 Ca mm 7.7* ±12 1.9±0.2 * 10 6 Sr um ±2 1.7±0.02 * 10 6 Rb um ±1 2.0±0.01 * 10 6 Ba nm ±2 1.1 ±0.05*10 7 VO nm ±9 9.4±0.4*10 3 Pb nm ±3 1.4±0.1*10 5 Ni nm ±1 7.3±0.1 * 10 6 Zn nm 0.42 <2 1 ND 2 *10 6 Cu nm ±2 3.4±0.06*10 3 Hg pm ±1 6.0±0.08*10 5 Cd pm ±3 8.3±0.4 *10 6 Fe pm <2 1 ND 2 * 10 6 Mn pm ±5 5.7±0.1 *10 5 Co pm ±2 1.3±0.07 *10 7 ND: not determined because of protein precipitation in the metal solution. NATURE CHEMISTRY 33

34 Supplementary Table S5. Data collection and model statistics of SUP apo-form and SUPuranyl complex. SUP-apo SUP-uranyl Data Collection Space group P P Cell dimensions a, b, c (Ǻ) 44.26, 47.03, , 46.93, α, β, γ ( ) Resolution* (Ǻ) ( ) ( ) Completeness (%) 98.2 (89.2) 97.4 (92.0) R merge (0.071) (0.616) I/σI 36.3 (14.0) 15.7 (1.6) Redundancy 4.0 (2.3) 2.0 (1.9) Refinement Resolution* (Ǻ) ( ) ( ) Completeness (%) 98 (85) 97 (87) No. reflections (34552) R work /R free 16.0 (17.6) 17.9 (18.8) Complex in asymmetry unit 2 2 Protein residues Ligands 0 2 Most favoured # (%) Additionally allowed (%) Disallowed (%) 0 0 B-factor Protein : 10.6 Solvent: 24.9 Protein : 15.7 Solvent: 28.9 Uranyl: 15.6 R.m.s. deviations Bond lengths (Ǻ) Bond angles ( ) PDB accession code 4FZO 4FZP * Highest resolution shell is shown in parenthesis. # Values calculated using PROCHECK from CCP4 suite. NATURE CHEMISTRY 34

35 Supplementary Table S6. The primers used for the cloning and mutation of the synthesized gene. Name Sequence Purpose U09_MCSG_F U09_MCSG_R TACTTCCAATCCAATGCCCTGGATTGCCGTGAACGCATTGAAAAA TTATCCACTTCCAATGTTAACCTTCGATAATGCGGTGCAGCATA MCSG Cloning U09_L67T_F GTACGCGCAGGGCCTGACGGATAGCCTGCGTATG Mutagenesis U09_L67T_R CATACGCAGGCTATCCGTCAGGCCCTGCGCGTAC U09_Q64E_F ATCACGTACGCGGAGGGCCTGACGG Mutagenesis U09_Q64E_R CCGTCAGGCCCTCCGCGTACGTGAT U09_E17A_F CCTGGAAAACCTGGAAAAAGCACTGATGGAAATGAAAAGC Mutagenesis U09_E17A_R GCTTTTCATTTCCATCAGTGCTTTTTCCAGGTTTTCCAGG U09_E17Q_F CCTGGAAAACCTGGAAAAACAACTGATGGAAATGAAAAGC Mutagenesis U09_E17Q_R GCTTTTCATTTCCATCAGTTGTTTTTCCAGGTTTTCCAGG U09_D68A_F GAGGGCCTGACGGCTAGCCTGCGTATG Mutagenesis U09_D68A_R CATACGCAGGCTAGCCGTCAGGCCCTC U09_D68N_F GGAGGGCCTGACGAATAGCCTGCGTATGC Mutagenesis U09_D68N_R GCATACGCAGGCTATTCGTCAGGCCCTCC U09_N13D_F U09_N13D_R TGAACGCATTGAAAAAGACCTGGAAGACCTGGAAAAAGAAC GTTCTTTTTCCAGGTCTTCCAGGTCTTTTTCAATGCGTTCA Mutagenesis NATURE CHEMISTRY 35

36 Supplementary Table S7. Solution compositions and equilibrium constants used to determine the K d of SUP by carbonate competition and for speciation calculations at 25 C. Carbonate binding constants are adjusted for different ionic strengths using specific ion interaction coefficients 38. The components used in the equilibrium expressions are H +, UO 2+ 2, Ca 2+, CO 3 2-, DGA 2- and SUP. K d determination 2+ Sorption of UO 2 from water 2+ Sorption of UO 2 from seawater Ionic Strength, molal 0.30 < [CO 2-3 ] free, molal x x 10-5 a [UO 2+ 2 ] total, molal 1.0 x x x log [H + ] 8.02 / 8.74 b c Species log i or log hydr H 2 O (pk w ) CO 2 (aq) CO 2 (g) HCO H 2 CO UO 2 (CO 3 ) UO 2 (CO 3 ) UO 2 (CO 3 ) Ca 2 UO 2 (CO 3 ) 3 n.c. d n.c. d UO 2 (OH) e e UO 2 (OH) e e - UO 2 (OH) e e 2- UO 2 (OH) e e 2+ (UO 2 ) 2 (OH) e e + (UO 2 ) 3 (OH) e e HDGA f H 2 DGA 6.58 f UO 2 (DGA) 5.11 f 2- UO 2 (DGA) f a Total [CO 2-3 ] concentration in seawater calculated from constants in Appendix A of ref. 40 and corrected for ion pairing after ref. 41 b Proton activity coefficient from ref. 49, log[h + ] = 8.02 for U09Gln64Glu, Leu67Thr protein, log[h + ] = 8.74 for SUP protein. c Proton activity coefficient from ref. 50 d Species not considered in calculations because these solutions lack Ca e Maximum estimated value of the hydrolysis constant at this ionic strength. f ph = 6.0. Equilibrium constants from ref. 51 and proton activity coefficient from ref. 49. NATURE CHEMISTRY 36

37 Supplementary Table S8. Distribution of major uranyl-containing species in solution. Calculated for various solution compositions, in the absence of protein, from the equilibrium constants in Supplementary Table S7. 2+ Sorption of UO 2 from water 2+ Sorption of UO 2 from water 2+ Sorption of UO 2 from seawater Ionic Strength, molal < 0.01 < [CO 2-3 ] free, molal 2.15 x x x 10-5 a [UO 2+ 2 ] total, molal 6.66 x 10-7 b 1.26 x 10-8 c 1.30 x log [H + ] d Species Fraction total uranyl 2+ UO x 10-9 UO 2 (OH) UO 2 (OH) 2 (aq) UO 2 (OH) (UO 2 ) 3 (OH) <0.001 UO 2 (CO 3 ) (aq) UO 2 (CO 3 ) UO 2 (CO 3 ) Ca 2 UO 2 (CO 3 ) a Total [CO 2-3 ] concentration in seawater calculated from constants in Appendix A of ref. 40 and corrected for ion pairing after ref. 41 b 158 ppb uranium c 3 ppb uranium d Proton activity coefficient from ref. 50 NATURE CHEMISTRY 37

38 Supplementary References and Notes 38. Guillaumont R. et al., Eds., Update on the chemical thermodynamics of uranium, neptunium, plutonium, americium, and technetium, vol. 5 (Elsevier, New York, 2003). 39. Kalmykov, S. N., Choppin, G. R. Mixed Ca 2+ /UO 2+ 2 /CO 2-3 complex formation at different ionic strengths. Radiochim. Acta 88, (2000). 40. Zeebe, R. E., Wolf-Gladrow, D. CO 2 in Seawater: Equilibrium, Kinetics, Isotopes, volume 65 of Elsevier Oceanography Series. Elsevier, New York (2001). 41. Pytkowicz, R. M., Hawley, J. E. Bicarbonate and carbonate ion-pairs and a model of seawater at 25 C. Limnol. Oceanogr. 19, (1974). 42. Maeyer, M. D., Desmet, J., Lastres, I. All in one: a highly detailed rotamer library improves both accuracy and speed in the modelling of sidechains by dead-end elimination. Fold Des. 2, (1997). 43. Donnelly, M. I., Zhou, M., Millard, C. S., Clancy, S., Stols, L., Eschenfeldt, W. H., Collart, F. R., Joachimiak, A. An expression vector tailored for large-scale, high-throughput purification of recombinant proteins. Protein Expression Purif. 47, (2006). 44. Otwinowski, W. Z. Minor Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307 (1997). 45. Read, R. J. Pushing the boundaries of molecular replacement with maximum likelihood. Acta Crystallogr. D Biol. Crystallogr. 57, (2001). 46. Adams, P. D., Afonine, P.V., Bunkóczi, G., Chen, V.B., Davis, I.W., Echols, N., Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., McCoy, A.J., Moriarty, N.W., Oeffner, R., Read, R.J., Richardson, D.C., Richardson, J.S., Terwilliger, T.C., Zwart, P.H., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Cryst. D 66, (2010). 47. Emsley, P.; Cowtan, K. Statistical phase improvement without a solvent boundary. Acta Crystallogr. D Biol. Crystallogr. 60, (2004). NATURE CHEMISTRY 38

39 48. Rohwer, H., Rheeder, N., Hosten, E. Interactions of uranium and thorium with Arsenazo III in an aqueous medium. Anal. Chim. Acta 341, (1997). 49. Harned, H. S., Owen, B. B. The Physical Chemistry of Eectrolytic Solutions, volume 137 of ACS Monograph Series. Reinhold: New York (1958). 50. Khoo, K. H., Ramette, R. W., Culberson, C. H., Bates, R. G. Determination of hydrogen ion concentrations in seawater from 5 to 40 C: Standard potentials at salinities from 20 to 45. Anal. Chem. 49, (1977). 51. Smith, R., Martell, A., Motekaitis, R. NIST Critically Selected Stability Constants of Metal Complexes Database vol. 8; Standard Reference Data Program. NIST, Gaithersburg, MD (2004). 52. Puigdomenech, I. MEDUSA: Make Equilibrium Diagrams Using Sophisticated Algorithms, Royal Institute of Technology (KTH), Stockholm (2004). NATURE CHEMISTRY 39