07/30/2012 Rose=a Conference. Principle for designing! ideal protein structures! Nobuyasu & Rie Koga University of Washington
|
|
- Carmel Wilkinson
- 5 years ago
- Views:
Transcription
1 07/30/2012 Rose=a Conference Principle for designing! ideal protein structures! Nobuyasu & Rie Koga University of Washington
2 Naturally occurring protein structures are complicated Functional site or junks of neutral drift? Bulges of beta- strands Disallowed torsion angles in loop SER 120(1fye) Kinks of helices Buried polar groups of sidechains and mainchains Make difficult to understand the principle for protein folding. => Design simple and ideal protein structures
3 Consistency principle Nobuhiro Go 1983 Local and non- local interacsons consistently stabilize nasve state INCONSISTENT! Helix: I have a kink Non-local interactions favor this structure Loop: I have a steric clash Strand: I want to be a helix Natural (real) proteins have the consistency in the first approximason. Ideal proteins have perfect consistency of local and non- local interacsons. Design the ideal proteins in reality
4 Consistency principle Nobuhiro Go 1983 Local and non- local interacsons consistently stabilize nasve state CONSISTENT Helix: I like this Non-local interactions favor this structure Loop: I like this Strand: I like this Natural (real) proteins have the consistency in the first approximason. Ideal proteins have perfect consistency of local and non- local interacsons. Design the ideal proteins in reality
5 Mapping from Secondary structure patterns (local) to Favorable tertiary structures (non-local) ββ αβ ββα βα αββ βαβ Simple rules describe favorable tersary structure, depending on SS lengths
6 Folding simulations with sequence-independent backbone model Rose=a centroid Fragment assembly with 1- mer Score terms: rg, vdw, sspair, rsigma, hspair hbond_sr_bb, hbond_lr_bb No amino- acid- type dependent terms Secondary structure lengths => ConformaSonal preference?
7 Fundamental rules: ββ, βα, αβ
8 ββ-rule: Chirality of β-hairpin is determined by loop length 2,3 5
9 βα-rule: Helix direction is determined by loop length & pleat direction of last strand residue 2 3
10 αβ-rule: Pleat of the first strand residue points away from the helix
11 Emergent rules ββα- rule αββ- rule βαβ- rule
12 αββ-rule αβ- rule determines helix direcson UP N ββ- rule determines chirality L R C Change strand-length Change loop-length DOWN Strand length determines pleat DOWN
13 βαβ-rule Strand and Helix lengths are codependent.
14 Design principle: Consistent local & non-local interactions lead to funnel-shaped energy landscape Random Sequence Foldable Sequence Non- local: Stabilize structures by packing, hydrophobic effect, Local: Choose secondary structure lengths based on the rules Stabilize the secondary structures => Eliminate non- nasve conformasons by local backbone preference.
15 Let s design protein structures
16 Design 5 target folds Fold-I Fold-II Fold-III Fold-IV Fold-V Ferredoxin- like Rossmann2x2 IF3- like Ploop2x2 Rossmann3x1
17 Design Protocol Design Topology Select secondary structure (SS) lengths based on the rules Build backbones by SS dependent fragment assembly Design Sidechains (Amino acid sequence is introduced) Relax both sidechains & backbone Rose=a Energy? Packing (Rose=aHoles)? Local sequence- structure compasbility? Explore energy landscape by structure predicson Funnel- like? Experimental characterizason (CD, SEC- MALS, NMR)
18 Characterization of designed proteins
19 Characterization of designed proteins Fold- I _5 Fold- II_10 Fold- III_14 Fold- IV_5 Fold- V_7
20 Design model and NMR structures Upper: Design model Lower: NMR Fold-I RMSD 1.2Å Fold-II 1.1Å Fold-III 1.1Å Fold-IV Fold-V 1.7Å 2.0Å NMR was solved by Gaohua Liu & Guy Montelione (Rutgers Univ.)
21 Summary of experimental results Success criteria: Expressed & Soluble Expected CD spectrum Stable (Tm >=95C ) Monomeric Well resolved NMR
22 Top7 is also ideal protein Brian Kuhlman et al., Science (2003) 3 N C 3 3 Secondary structure lengths follow the rules!
23 Conclusion 1. We found Rules relasng secondary structure lengths to tersary mosfs local non- local 2. The rules enabled us to design ideal protein structures stabilized by completely consistent local & non- local interacsons 3. Consistent interacsons readily lead to funnel- shaped energy landscapes Non- nasve conformasons are disfavored by local backbone preferences 4. We designed ideal protein structures of 5 different folds based on the rules 5. The designed protein structures were monomeric, very stable (>95C), and adopt structure nearly idenscal to the computasonal models. 6. Natural proteins might use the rules for making funnel- shaped energy landscape
24 Thanks! Structure determinason Gaohua Liu Rong Xiao Thomas Acton Guy Montelione Fold suggesson Nick Grishin 1D- NMR for Fold- I & Fold- II Ponni Rajagopal Mass spec Jus5n Siegel De novo designer Javier Castellanos Yu- Ru Lin Amanda Clouser Our neighbor Boss T J505 David Baker ComputaSonal help Possu Huang Yih- En Andrew Ban
Presenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11600 Contents Supplementary Discussion 1 Emergent rules.... 3 Supplementary Figure 1 Emergent rules.... 5 Supplementary Figure 2 Torsion energies of loops are
More informationDesign of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationSupersecondary Structures (structural motifs)
Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric
More informationProtein Structure Prediction, Engineering & Design CHEM 430
Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment
More informationPhysiochemical Properties of Residues
Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)
More informationFrom Amino Acids to Proteins - in 4 Easy Steps
From Amino Acids to Proteins - in 4 Easy Steps Although protein structure appears to be overwhelmingly complex, you can provide your students with a basic understanding of how proteins fold by focusing
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*
More informationConformational Geometry of Peptides and Proteins:
Conformational Geometry of Peptides and Proteins: Before discussing secondary structure, it is important to appreciate the conformational plasticity of proteins. Each residue in a polypeptide has three
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationTemplate Free Protein Structure Modeling Jianlin Cheng, PhD
Template Free Protein Structure Modeling Jianlin Cheng, PhD Associate Professor Computer Science Department Informatics Institute University of Missouri, Columbia 2013 Protein Energy Landscape & Free Sampling
More informationTemplate Free Protein Structure Modeling Jianlin Cheng, PhD
Template Free Protein Structure Modeling Jianlin Cheng, PhD Professor Department of EECS Informatics Institute University of Missouri, Columbia 2018 Protein Energy Landscape & Free Sampling http://pubs.acs.org/subscribe/archive/mdd/v03/i09/html/willis.html
More informationProtein Structures: Experiments and Modeling. Patrice Koehl
Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:
More informationProtein Structure Determination
Protein Structure Determination Given a protein sequence, determine its 3D structure 1 MIKLGIVMDP IANINIKKDS SFAMLLEAQR RGYELHYMEM GDLYLINGEA 51 RAHTRTLNVK QNYEEWFSFV GEQDLPLADL DVILMRKDPP FDTEFIYATY 101
More informationCan protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU
Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO! Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr
More informationAlpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University
Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and
More informationProtein Structure Prediction
Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on
More informationProtein Structure. Hierarchy of Protein Structure. Tertiary structure. independently stable structural unit. includes disulfide bonds
Protein Structure Hierarchy of Protein Structure 2 3 Structural element Primary structure Secondary structure Super-secondary structure Domain Tertiary structure Quaternary structure Description amino
More informationHOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.
HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental
More informationPolypeptide Folding Using Monte Carlo Sampling, Concerted Rotation, and Continuum Solvation
Polypeptide Folding Using Monte Carlo Sampling, Concerted Rotation, and Continuum Solvation Jakob P. Ulmschneider and William L. Jorgensen J.A.C.S. 2004, 126, 1849-1857 Presented by Laura L. Thomas and
More informationDihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769
Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationProtein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror
Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major
More information114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009
114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 9 Protein tertiary structure Sources for this chapter, which are all recommended reading: D.W. Mount. Bioinformatics: Sequences and Genome
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationMonte Carlo simulations for protein denaturation
Author: Facultat de Física, Universitat de Barcelona, Diagonal 645, 08028 Barcelona, Spain. Advisor: Giancarlo Franzese Abstract: Proteins are usually in a water solution when they perform their biological
More informationCHAPTER 29 HW: AMINO ACIDS + PROTEINS
CAPTER 29 W: AMI ACIDS + PRTEIS For all problems, consult the table of 20 Amino Acids provided in lecture if an amino acid structure is needed; these will be given on exams. Use natural amino acids (L)
More informationCMPS 3110: Bioinformatics. Tertiary Structure Prediction
CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction
CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the
More informationproteins The dual role of fragments in fragmentassembly methods for de novo protein structure prediction
proteins STRUCTURE O FUNCTION O BIOINFORMATICS The dual role of fragments in fragmentassembly methods for de novo protein structure prediction Julia Handl, 1 * Joshua Knowles, 2 Robert Vernon, 3 David
More informationBiomolecules: lecture 10
Biomolecules: lecture 10 - understanding in detail how protein 3D structures form - realize that protein molecules are not static wire models but instead dynamic, where in principle every atom moves (yet
More informationTetraBASE: A Side Chain-Independent Statistical Energy for Designing Realistically Packed Protein Backbones
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. Cite This: pubs.acs.org/jcim
More informationAnalysis and Prediction of Protein Structure (I)
Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng
More informationALL LECTURES IN SB Introduction
1. Introduction 2. Molecular Architecture I 3. Molecular Architecture II 4. Molecular Simulation I 5. Molecular Simulation II 6. Bioinformatics I 7. Bioinformatics II 8. Prediction I 9. Prediction II ALL
More information4 Proteins: Structure, Function, Folding W. H. Freeman and Company
4 Proteins: Structure, Function, Folding 2013 W. H. Freeman and Company CHAPTER 4 Proteins: Structure, Function, Folding Learning goals: Structure and properties of the peptide bond Structural hierarchy
More informationProtein Structure. Role of (bio)informatics in drug discovery. Bioinformatics
Bioinformatics Protein Structure Principles & Architecture Marjolein Thunnissen Dep. of Biochemistry & Structural Biology Lund University September 2011 Homology, pattern and 3D structure searches need
More informationImportance of chirality and reduced flexibility of protein side chains: A study with square and tetrahedral lattice models
JOURNAL OF CHEMICAL PHYSICS VOLUME 121, NUMBER 1 1 JULY 2004 Importance of chirality and reduced flexibility of protein side chains: A study with square and tetrahedral lattice models Jinfeng Zhang Department
More informationModel Mélange. Physical Models of Peptides and Proteins
Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationProtein Secondary Structure Prediction
Protein Secondary Structure Prediction Doug Brutlag & Scott C. Schmidler Overview Goals and problem definition Existing approaches Classic methods Recent successful approaches Evaluating prediction algorithms
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationThe Structure and Functions of Proteins
Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University
More informationProtein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror
Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major
More informationPacking of Secondary Structures
7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary
More informationBCH 4053 Spring 2003 Chapter 6 Lecture Notes
BCH 4053 Spring 2003 Chapter 6 Lecture Notes 1 CHAPTER 6 Proteins: Secondary, Tertiary, and Quaternary Structure 2 Levels of Protein Structure Primary (sequence) Secondary (ordered structure along peptide
More informationBiochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,
Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,
More informationOutline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins
Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Margaret Daugherty Fall 2004 Outline Four levels of structure are used to describe proteins; Alpha helices and beta sheets
More informationBioinformatics. Macromolecular structure
Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationProtein Structure Prediction
Protein Structure Prediction Michael Feig MMTSB/CTBP 2006 Summer Workshop From Sequence to Structure SEALGDTIVKNA Ab initio Structure Prediction Protocol Amino Acid Sequence Conformational Sampling to
More informationPart II => PROTEINS and ENZYMES. 2.3 PROTEIN STRUCTURE 2.3a Secondary Structure 2.3b Tertiary Structure 2.3c Quaternary Structure
Part II => PROTEINS and ENZYMES 2.3 PROTEIN STRUCTURE 2.3a Secondary Structure 2.3b Tertiary Structure 2.3c Quaternary Structure Section 2.3a: Secondary Structure Synopsis 2.3a - Secondary structure refers
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationProtein Structure Determination from Pseudocontact Shifts Using ROSETTA
Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic
More informationDe novo protein structure determination using sparse NMR data
Journal of Biomolecular NMR, 18: 311 318, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 311 De novo protein structure determination using sparse NMR data Peter M. Bowers
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationOverview. The peptide bond. Page 1
Overview Secondary structure: the conformation of the peptide backbone The peptide bond, steric implications Steric hindrance and sterically allowed conformations. Ramachandran diagrams Side chain conformations
More informationLecture 26: Polymers: DNA Packing and Protein folding 26.1 Problem Set 4 due today. Reading for Lectures 22 24: PKT Chapter 8 [ ].
Lecture 26: Polymers: DA Packing and Protein folding 26.1 Problem Set 4 due today. eading for Lectures 22 24: PKT hapter 8 DA Packing for Eukaryotes: The packing problem for the larger eukaryotic genomes
More informationDetails of Protein Structure
Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives
More informationDenaturation and renaturation of proteins
Denaturation and renaturation of proteins Higher levels of protein structure are formed without covalent bonds. Therefore, they are not as stable as peptide covalent bonds which make protein primary structure
More informationProtein Structure Bioinformatics Introduction
1 Swiss Institute of Bioinformatics Protein Structure Bioinformatics Introduction Basel, 27. September 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute of Bioinformatics Klingelbergstr
More informationComputer design of idealized -motifs
Computer design of idealized -motifs Andrzej Kolinski a) University of Warsaw, Department of Chemistry, Pasteura 1, 02-093 Warsaw, Poland and The Scripps Research Institute, Department of Molecular Biology,
More informationShort Announcements. 1 st Quiz today: 15 minutes. Homework 3: Due next Wednesday.
Short Announcements 1 st Quiz today: 15 minutes Homework 3: Due next Wednesday. Next Lecture, on Visualizing Molecular Dynamics (VMD) by Klaus Schulten Today s Lecture: Protein Folding, Misfolding, Aggregation
More informationContact map guided ab initio structure prediction
Contact map guided ab initio structure prediction S M Golam Mortuza Postdoctoral Research Fellow I-TASSER Workshop 2017 North Carolina A&T State University, Greensboro, NC Outline Ab initio structure prediction:
More informationBio nformatics. Lecture 23. Saad Mneimneh
Bio nformatics Lecture 23 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinff18.html Proteins and Protein Structure
More informationLecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability
Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions Van der Waals Interactions
More informationPrediction and refinement of NMR structures from sparse experimental data
Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk
More informationProtein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix)
Computat onal Biology Lecture 21 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely
More informationAnnouncements. Primary (1 ) Structure. Lecture 7 & 8: PROTEIN ARCHITECTURE IV: Tertiary and Quaternary Structure
Announcements TA Office Hours: Brian Eckenroth Monday 3-4 pm Thursday 11 am-12 pm Lecture 7 & 8: PROTEIN ARCHITECTURE IV: Tertiary and Quaternary Structure Margaret Daugherty Fall 2003 Homework II posted
More informationProtein Structures. Sequences of amino acid residues 20 different amino acids. Quaternary. Primary. Tertiary. Secondary. 10/8/2002 Lecture 12 1
Protein Structures Sequences of amino acid residues 20 different amino acids Primary Secondary Tertiary Quaternary 10/8/2002 Lecture 12 1 Angles φ and ψ in the polypeptide chain 10/8/2002 Lecture 12 2
More informationChemical Shift Restraints Tools and Methods. Andrea Cavalli
Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationImproved Beta-Protein Structure Prediction by Multilevel Optimization of NonLocal Strand Pairings and Local Backbone Conformation
65:922 929 (2006) Improved Beta-Protein Structure Prediction by Multilevel Optimization of NonLocal Strand Pairings and Local Backbone Conformation Philip Bradley and David Baker* University of Washington,
More informationWhy Do Protein Structures Recur?
Why Do Protein Structures Recur? Dartmouth Computer Science Technical Report TR2015-775 Rebecca Leong, Gevorg Grigoryan, PhD May 28, 2015 Abstract Protein tertiary structures exhibit an observable degeneracy
More informationComputational Protein Design
11 Computational Protein Design This chapter introduces the automated protein design and experimental validation of a novel designed sequence, as described in Dahiyat and Mayo [1]. 11.1 Introduction Given
More informationThe protein folding problem consists of two parts:
Energetics and kinetics of protein folding The protein folding problem consists of two parts: 1)Creating a stable, well-defined structure that is significantly more stable than all other possible structures.
More informationRNA and Protein Structure Prediction
RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationApril, The energy functions include:
REDUX A collection of Python scripts for torsion angle Monte Carlo protein molecular simulations and analysis The program is based on unified residue peptide model and is designed for more efficient exploration
More informationProtein Structure and Function. Protein Architecture:
BCHS 6229 Protein Structure and Function Lecture 2 (October 13, 2011) Protein Architecture: Symmetry relationships and protein structure Primary & Secondary Structure Motifs & Super-secondary Structure
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationOutline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins
Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Margaret Daugherty Fall 2003 Outline Four levels of structure are used to describe proteins; Alpha helices and beta sheets
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison
CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture
More informationBasic structures of proteins
Basic structures of proteins Structural Hierarchy of Protein Primary structure Functional elements : α-helix, strands, β-sheet, loops.. - Structure, affinity, activity, specificity, stability etc. Secondary
More information1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.
Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the
More informationLecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability
Lecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions: Van der Waals Interactions
More informationA topology-constrained distance network algorithm for protein structure determination from NOESY data
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network
More informationRead more about Pauling and more scientists at: Profiles in Science, The National Library of Medicine, profiles.nlm.nih.gov
2018 Biochemistry 110 California Institute of Technology Lecture 2: Principles of Protein Structure Linus Pauling (1901-1994) began his studies at Caltech in 1922 and was directed by Arthur Amos oyes to
More informationA Path Planning-Based Study of Protein Folding with a Case Study of Hairpin Formation in Protein G and L
A Path Planning-Based Study of Protein Folding with a Case Study of Hairpin Formation in Protein G and L G. Song, S. Thomas, K.A. Dill, J.M. Scholtz, N.M. Amato Pacific Symposium on Biocomputing 8:240-251(2003)
More informationPROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration:
PTEI STUTUE ydrolysis of proteins with aqueous acid or base yields a mixture of free amino acids. Each type of protein yields a characteristic mixture of the ~ 20 amino acids. AMI AIDS Zwitterion (dipolar
More information1. What is an ångstrom unit, and why is it used to describe molecular structures?
1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter
More informationHMM applications. Applications of HMMs. Gene finding with HMMs. Using the gene finder
HMM applications Applications of HMMs Gene finding Pairwise alignment (pair HMMs) Characterizing protein families (profile HMMs) Predicting membrane proteins, and membrane protein topology Gene finding
More informationFlexPepDock In a nutshell
FlexPepDock In a nutshell All Tutorial files are located in http://bit.ly/mxtakv FlexPepdock refinement Step 1 Step 3 - Refinement Step 4 - Selection of models Measure of fit FlexPepdock Ab-initio Step
More informationOutline. The ensemble folding kinetics of protein G from an all-atom Monte Carlo simulation. Unfolded Folded. What is protein folding?
The ensemble folding kinetics of protein G from an all-atom Monte Carlo simulation By Jun Shimada and Eugine Shaknovich Bill Hawse Dr. Bahar Elisa Sandvik and Mehrdad Safavian Outline Background on protein
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More information