07/30/2012 Rose=a Conference. Principle for designing! ideal protein structures! Nobuyasu & Rie Koga University of Washington

Size: px
Start display at page:

Download "07/30/2012 Rose=a Conference. Principle for designing! ideal protein structures! Nobuyasu & Rie Koga University of Washington"

Transcription

1 07/30/2012 Rose=a Conference Principle for designing! ideal protein structures! Nobuyasu & Rie Koga University of Washington

2 Naturally occurring protein structures are complicated Functional site or junks of neutral drift? Bulges of beta- strands Disallowed torsion angles in loop SER 120(1fye) Kinks of helices Buried polar groups of sidechains and mainchains Make difficult to understand the principle for protein folding. => Design simple and ideal protein structures

3 Consistency principle Nobuhiro Go 1983 Local and non- local interacsons consistently stabilize nasve state INCONSISTENT! Helix: I have a kink Non-local interactions favor this structure Loop: I have a steric clash Strand: I want to be a helix Natural (real) proteins have the consistency in the first approximason. Ideal proteins have perfect consistency of local and non- local interacsons. Design the ideal proteins in reality

4 Consistency principle Nobuhiro Go 1983 Local and non- local interacsons consistently stabilize nasve state CONSISTENT Helix: I like this Non-local interactions favor this structure Loop: I like this Strand: I like this Natural (real) proteins have the consistency in the first approximason. Ideal proteins have perfect consistency of local and non- local interacsons. Design the ideal proteins in reality

5 Mapping from Secondary structure patterns (local) to Favorable tertiary structures (non-local) ββ αβ ββα βα αββ βαβ Simple rules describe favorable tersary structure, depending on SS lengths

6 Folding simulations with sequence-independent backbone model Rose=a centroid Fragment assembly with 1- mer Score terms: rg, vdw, sspair, rsigma, hspair hbond_sr_bb, hbond_lr_bb No amino- acid- type dependent terms Secondary structure lengths => ConformaSonal preference?

7 Fundamental rules: ββ, βα, αβ

8 ββ-rule: Chirality of β-hairpin is determined by loop length 2,3 5

9 βα-rule: Helix direction is determined by loop length & pleat direction of last strand residue 2 3

10 αβ-rule: Pleat of the first strand residue points away from the helix

11 Emergent rules ββα- rule αββ- rule βαβ- rule

12 αββ-rule αβ- rule determines helix direcson UP N ββ- rule determines chirality L R C Change strand-length Change loop-length DOWN Strand length determines pleat DOWN

13 βαβ-rule Strand and Helix lengths are codependent.

14 Design principle: Consistent local & non-local interactions lead to funnel-shaped energy landscape Random Sequence Foldable Sequence Non- local: Stabilize structures by packing, hydrophobic effect, Local: Choose secondary structure lengths based on the rules Stabilize the secondary structures => Eliminate non- nasve conformasons by local backbone preference.

15 Let s design protein structures

16 Design 5 target folds Fold-I Fold-II Fold-III Fold-IV Fold-V Ferredoxin- like Rossmann2x2 IF3- like Ploop2x2 Rossmann3x1

17 Design Protocol Design Topology Select secondary structure (SS) lengths based on the rules Build backbones by SS dependent fragment assembly Design Sidechains (Amino acid sequence is introduced) Relax both sidechains & backbone Rose=a Energy? Packing (Rose=aHoles)? Local sequence- structure compasbility? Explore energy landscape by structure predicson Funnel- like? Experimental characterizason (CD, SEC- MALS, NMR)

18 Characterization of designed proteins

19 Characterization of designed proteins Fold- I _5 Fold- II_10 Fold- III_14 Fold- IV_5 Fold- V_7

20 Design model and NMR structures Upper: Design model Lower: NMR Fold-I RMSD 1.2Å Fold-II 1.1Å Fold-III 1.1Å Fold-IV Fold-V 1.7Å 2.0Å NMR was solved by Gaohua Liu & Guy Montelione (Rutgers Univ.)

21 Summary of experimental results Success criteria: Expressed & Soluble Expected CD spectrum Stable (Tm >=95C ) Monomeric Well resolved NMR

22 Top7 is also ideal protein Brian Kuhlman et al., Science (2003) 3 N C 3 3 Secondary structure lengths follow the rules!

23 Conclusion 1. We found Rules relasng secondary structure lengths to tersary mosfs local non- local 2. The rules enabled us to design ideal protein structures stabilized by completely consistent local & non- local interacsons 3. Consistent interacsons readily lead to funnel- shaped energy landscapes Non- nasve conformasons are disfavored by local backbone preferences 4. We designed ideal protein structures of 5 different folds based on the rules 5. The designed protein structures were monomeric, very stable (>95C), and adopt structure nearly idenscal to the computasonal models. 6. Natural proteins might use the rules for making funnel- shaped energy landscape

24 Thanks! Structure determinason Gaohua Liu Rong Xiao Thomas Acton Guy Montelione Fold suggesson Nick Grishin 1D- NMR for Fold- I & Fold- II Ponni Rajagopal Mass spec Jus5n Siegel De novo designer Javier Castellanos Yu- Ru Lin Amanda Clouser Our neighbor Boss T J505 David Baker ComputaSonal help Possu Huang Yih- En Andrew Ban

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11600 Contents Supplementary Discussion 1 Emergent rules.... 3 Supplementary Figure 1 Emergent rules.... 5 Supplementary Figure 2 Torsion energies of loops are

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

Supersecondary Structures (structural motifs)

Supersecondary Structures (structural motifs) Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric

More information

Protein Structure Prediction, Engineering & Design CHEM 430

Protein Structure Prediction, Engineering & Design CHEM 430 Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment

More information

Physiochemical Properties of Residues

Physiochemical Properties of Residues Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)

More information

From Amino Acids to Proteins - in 4 Easy Steps

From Amino Acids to Proteins - in 4 Easy Steps From Amino Acids to Proteins - in 4 Easy Steps Although protein structure appears to be overwhelmingly complex, you can provide your students with a basic understanding of how proteins fold by focusing

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*

More information

Conformational Geometry of Peptides and Proteins:

Conformational Geometry of Peptides and Proteins: Conformational Geometry of Peptides and Proteins: Before discussing secondary structure, it is important to appreciate the conformational plasticity of proteins. Each residue in a polypeptide has three

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Template Free Protein Structure Modeling Jianlin Cheng, PhD

Template Free Protein Structure Modeling Jianlin Cheng, PhD Template Free Protein Structure Modeling Jianlin Cheng, PhD Associate Professor Computer Science Department Informatics Institute University of Missouri, Columbia 2013 Protein Energy Landscape & Free Sampling

More information

Template Free Protein Structure Modeling Jianlin Cheng, PhD

Template Free Protein Structure Modeling Jianlin Cheng, PhD Template Free Protein Structure Modeling Jianlin Cheng, PhD Professor Department of EECS Informatics Institute University of Missouri, Columbia 2018 Protein Energy Landscape & Free Sampling http://pubs.acs.org/subscribe/archive/mdd/v03/i09/html/willis.html

More information

Protein Structures: Experiments and Modeling. Patrice Koehl

Protein Structures: Experiments and Modeling. Patrice Koehl Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:

More information

Protein Structure Determination

Protein Structure Determination Protein Structure Determination Given a protein sequence, determine its 3D structure 1 MIKLGIVMDP IANINIKKDS SFAMLLEAQR RGYELHYMEM GDLYLINGEA 51 RAHTRTLNVK QNYEEWFSFV GEQDLPLADL DVILMRKDPP FDTEFIYATY 101

More information

Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU

Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO! Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748 CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr

More information

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and

More information

Protein Structure Prediction

Protein Structure Prediction Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on

More information

Protein Structure. Hierarchy of Protein Structure. Tertiary structure. independently stable structural unit. includes disulfide bonds

Protein Structure. Hierarchy of Protein Structure. Tertiary structure. independently stable structural unit. includes disulfide bonds Protein Structure Hierarchy of Protein Structure 2 3 Structural element Primary structure Secondary structure Super-secondary structure Domain Tertiary structure Quaternary structure Description amino

More information

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target. HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

More information

Polypeptide Folding Using Monte Carlo Sampling, Concerted Rotation, and Continuum Solvation

Polypeptide Folding Using Monte Carlo Sampling, Concerted Rotation, and Continuum Solvation Polypeptide Folding Using Monte Carlo Sampling, Concerted Rotation, and Continuum Solvation Jakob P. Ulmschneider and William L. Jorgensen J.A.C.S. 2004, 126, 1849-1857 Presented by Laura L. Thomas and

More information

Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769

Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769 Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral

More information

Basics of protein structure

Basics of protein structure Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu

More information

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major

More information

114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009

114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 9 Protein tertiary structure Sources for this chapter, which are all recommended reading: D.W. Mount. Bioinformatics: Sequences and Genome

More information

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure

More information

Monte Carlo simulations for protein denaturation

Monte Carlo simulations for protein denaturation Author: Facultat de Física, Universitat de Barcelona, Diagonal 645, 08028 Barcelona, Spain. Advisor: Giancarlo Franzese Abstract: Proteins are usually in a water solution when they perform their biological

More information

CHAPTER 29 HW: AMINO ACIDS + PROTEINS

CHAPTER 29 HW: AMINO ACIDS + PROTEINS CAPTER 29 W: AMI ACIDS + PRTEIS For all problems, consult the table of 20 Amino Acids provided in lecture if an amino acid structure is needed; these will be given on exams. Use natural amino acids (L)

More information

CMPS 3110: Bioinformatics. Tertiary Structure Prediction

CMPS 3110: Bioinformatics. Tertiary Structure Prediction CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite

More information

Secondary and sidechain structures

Secondary and sidechain structures Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the

More information

proteins The dual role of fragments in fragmentassembly methods for de novo protein structure prediction

proteins The dual role of fragments in fragmentassembly methods for de novo protein structure prediction proteins STRUCTURE O FUNCTION O BIOINFORMATICS The dual role of fragments in fragmentassembly methods for de novo protein structure prediction Julia Handl, 1 * Joshua Knowles, 2 Robert Vernon, 3 David

More information

Biomolecules: lecture 10

Biomolecules: lecture 10 Biomolecules: lecture 10 - understanding in detail how protein 3D structures form - realize that protein molecules are not static wire models but instead dynamic, where in principle every atom moves (yet

More information

TetraBASE: A Side Chain-Independent Statistical Energy for Designing Realistically Packed Protein Backbones

TetraBASE: A Side Chain-Independent Statistical Energy for Designing Realistically Packed Protein Backbones This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. Cite This: pubs.acs.org/jcim

More information

Analysis and Prediction of Protein Structure (I)

Analysis and Prediction of Protein Structure (I) Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng

More information

ALL LECTURES IN SB Introduction

ALL LECTURES IN SB Introduction 1. Introduction 2. Molecular Architecture I 3. Molecular Architecture II 4. Molecular Simulation I 5. Molecular Simulation II 6. Bioinformatics I 7. Bioinformatics II 8. Prediction I 9. Prediction II ALL

More information

4 Proteins: Structure, Function, Folding W. H. Freeman and Company

4 Proteins: Structure, Function, Folding W. H. Freeman and Company 4 Proteins: Structure, Function, Folding 2013 W. H. Freeman and Company CHAPTER 4 Proteins: Structure, Function, Folding Learning goals: Structure and properties of the peptide bond Structural hierarchy

More information

Protein Structure. Role of (bio)informatics in drug discovery. Bioinformatics

Protein Structure. Role of (bio)informatics in drug discovery. Bioinformatics Bioinformatics Protein Structure Principles & Architecture Marjolein Thunnissen Dep. of Biochemistry & Structural Biology Lund University September 2011 Homology, pattern and 3D structure searches need

More information

Importance of chirality and reduced flexibility of protein side chains: A study with square and tetrahedral lattice models

Importance of chirality and reduced flexibility of protein side chains: A study with square and tetrahedral lattice models JOURNAL OF CHEMICAL PHYSICS VOLUME 121, NUMBER 1 1 JULY 2004 Importance of chirality and reduced flexibility of protein side chains: A study with square and tetrahedral lattice models Jinfeng Zhang Department

More information

Model Mélange. Physical Models of Peptides and Proteins

Model Mélange. Physical Models of Peptides and Proteins Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.

More information

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its

More information

Protein Secondary Structure Prediction

Protein Secondary Structure Prediction Protein Secondary Structure Prediction Doug Brutlag & Scott C. Schmidler Overview Goals and problem definition Existing approaches Classic methods Recent successful approaches Evaluating prediction algorithms

More information

CAP 5510 Lecture 3 Protein Structures

CAP 5510 Lecture 3 Protein Structures CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity

More information

The Structure and Functions of Proteins

The Structure and Functions of Proteins Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University

More information

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major

More information

Packing of Secondary Structures

Packing of Secondary Structures 7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary

More information

BCH 4053 Spring 2003 Chapter 6 Lecture Notes

BCH 4053 Spring 2003 Chapter 6 Lecture Notes BCH 4053 Spring 2003 Chapter 6 Lecture Notes 1 CHAPTER 6 Proteins: Secondary, Tertiary, and Quaternary Structure 2 Levels of Protein Structure Primary (sequence) Secondary (ordered structure along peptide

More information

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,

More information

Outline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins

Outline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Margaret Daugherty Fall 2004 Outline Four levels of structure are used to describe proteins; Alpha helices and beta sheets

More information

Bioinformatics. Macromolecular structure

Bioinformatics. Macromolecular structure Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain

More information

BIRKBECK COLLEGE (University of London)

BIRKBECK COLLEGE (University of London) BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology

More information

Protein Structure Prediction

Protein Structure Prediction Protein Structure Prediction Michael Feig MMTSB/CTBP 2006 Summer Workshop From Sequence to Structure SEALGDTIVKNA Ab initio Structure Prediction Protocol Amino Acid Sequence Conformational Sampling to

More information

Part II => PROTEINS and ENZYMES. 2.3 PROTEIN STRUCTURE 2.3a Secondary Structure 2.3b Tertiary Structure 2.3c Quaternary Structure

Part II => PROTEINS and ENZYMES. 2.3 PROTEIN STRUCTURE 2.3a Secondary Structure 2.3b Tertiary Structure 2.3c Quaternary Structure Part II => PROTEINS and ENZYMES 2.3 PROTEIN STRUCTURE 2.3a Secondary Structure 2.3b Tertiary Structure 2.3c Quaternary Structure Section 2.3a: Secondary Structure Synopsis 2.3a - Secondary structure refers

More information

CS612 - Algorithms in Bioinformatics

CS612 - Algorithms in Bioinformatics Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing

More information

Nature Structural and Molecular Biology: doi: /nsmb.2938

Nature Structural and Molecular Biology: doi: /nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

More information

Protein Structure Determination from Pseudocontact Shifts Using ROSETTA

Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic

More information

De novo protein structure determination using sparse NMR data

De novo protein structure determination using sparse NMR data Journal of Biomolecular NMR, 18: 311 318, 2000. KLUWER/ESCOM 2000 Kluwer Academic Publishers. Printed in the Netherlands. 311 De novo protein structure determination using sparse NMR data Peter M. Bowers

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

Overview. The peptide bond. Page 1

Overview. The peptide bond. Page 1 Overview Secondary structure: the conformation of the peptide backbone The peptide bond, steric implications Steric hindrance and sterically allowed conformations. Ramachandran diagrams Side chain conformations

More information

Lecture 26: Polymers: DNA Packing and Protein folding 26.1 Problem Set 4 due today. Reading for Lectures 22 24: PKT Chapter 8 [ ].

Lecture 26: Polymers: DNA Packing and Protein folding 26.1 Problem Set 4 due today. Reading for Lectures 22 24: PKT Chapter 8 [ ]. Lecture 26: Polymers: DA Packing and Protein folding 26.1 Problem Set 4 due today. eading for Lectures 22 24: PKT hapter 8 DA Packing for Eukaryotes: The packing problem for the larger eukaryotic genomes

More information

Details of Protein Structure

Details of Protein Structure Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives

More information

Denaturation and renaturation of proteins

Denaturation and renaturation of proteins Denaturation and renaturation of proteins Higher levels of protein structure are formed without covalent bonds. Therefore, they are not as stable as peptide covalent bonds which make protein primary structure

More information

Protein Structure Bioinformatics Introduction

Protein Structure Bioinformatics Introduction 1 Swiss Institute of Bioinformatics Protein Structure Bioinformatics Introduction Basel, 27. September 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute of Bioinformatics Klingelbergstr

More information

Computer design of idealized -motifs

Computer design of idealized -motifs Computer design of idealized -motifs Andrzej Kolinski a) University of Warsaw, Department of Chemistry, Pasteura 1, 02-093 Warsaw, Poland and The Scripps Research Institute, Department of Molecular Biology,

More information

Short Announcements. 1 st Quiz today: 15 minutes. Homework 3: Due next Wednesday.

Short Announcements. 1 st Quiz today: 15 minutes. Homework 3: Due next Wednesday. Short Announcements 1 st Quiz today: 15 minutes Homework 3: Due next Wednesday. Next Lecture, on Visualizing Molecular Dynamics (VMD) by Klaus Schulten Today s Lecture: Protein Folding, Misfolding, Aggregation

More information

Contact map guided ab initio structure prediction

Contact map guided ab initio structure prediction Contact map guided ab initio structure prediction S M Golam Mortuza Postdoctoral Research Fellow I-TASSER Workshop 2017 North Carolina A&T State University, Greensboro, NC Outline Ab initio structure prediction:

More information

Bio nformatics. Lecture 23. Saad Mneimneh

Bio nformatics. Lecture 23. Saad Mneimneh Bio nformatics Lecture 23 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinff18.html Proteins and Protein Structure

More information

Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability

Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Lecture 2-3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions Van der Waals Interactions

More information

Prediction and refinement of NMR structures from sparse experimental data

Prediction and refinement of NMR structures from sparse experimental data Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk

More information

Protein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix)

Protein folding. α-helix. Lecture 21. An α-helix is a simple helix having on average 10 residues (3 turns of the helix) Computat onal Biology Lecture 21 Protein folding The goal is to determine the three-dimensional structure of a protein based on its amino acid sequence Assumption: amino acid sequence completely and uniquely

More information

Announcements. Primary (1 ) Structure. Lecture 7 & 8: PROTEIN ARCHITECTURE IV: Tertiary and Quaternary Structure

Announcements. Primary (1 ) Structure. Lecture 7 & 8: PROTEIN ARCHITECTURE IV: Tertiary and Quaternary Structure Announcements TA Office Hours: Brian Eckenroth Monday 3-4 pm Thursday 11 am-12 pm Lecture 7 & 8: PROTEIN ARCHITECTURE IV: Tertiary and Quaternary Structure Margaret Daugherty Fall 2003 Homework II posted

More information

Protein Structures. Sequences of amino acid residues 20 different amino acids. Quaternary. Primary. Tertiary. Secondary. 10/8/2002 Lecture 12 1

Protein Structures. Sequences of amino acid residues 20 different amino acids. Quaternary. Primary. Tertiary. Secondary. 10/8/2002 Lecture 12 1 Protein Structures Sequences of amino acid residues 20 different amino acids Primary Secondary Tertiary Quaternary 10/8/2002 Lecture 12 1 Angles φ and ψ in the polypeptide chain 10/8/2002 Lecture 12 2

More information

Chemical Shift Restraints Tools and Methods. Andrea Cavalli

Chemical Shift Restraints Tools and Methods. Andrea Cavalli Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Improved Beta-Protein Structure Prediction by Multilevel Optimization of NonLocal Strand Pairings and Local Backbone Conformation

Improved Beta-Protein Structure Prediction by Multilevel Optimization of NonLocal Strand Pairings and Local Backbone Conformation 65:922 929 (2006) Improved Beta-Protein Structure Prediction by Multilevel Optimization of NonLocal Strand Pairings and Local Backbone Conformation Philip Bradley and David Baker* University of Washington,

More information

Why Do Protein Structures Recur?

Why Do Protein Structures Recur? Why Do Protein Structures Recur? Dartmouth Computer Science Technical Report TR2015-775 Rebecca Leong, Gevorg Grigoryan, PhD May 28, 2015 Abstract Protein tertiary structures exhibit an observable degeneracy

More information

Computational Protein Design

Computational Protein Design 11 Computational Protein Design This chapter introduces the automated protein design and experimental validation of a novel designed sequence, as described in Dahiyat and Mayo [1]. 11.1 Introduction Given

More information

The protein folding problem consists of two parts:

The protein folding problem consists of two parts: Energetics and kinetics of protein folding The protein folding problem consists of two parts: 1)Creating a stable, well-defined structure that is significantly more stable than all other possible structures.

More information

RNA and Protein Structure Prediction

RNA and Protein Structure Prediction RNA and Protein Structure Prediction Bioinformatics: Issues and Algorithms CSE 308-408 Spring 2007 Lecture 18-1- Outline Multi-Dimensional Nature of Life RNA Secondary Structure Prediction Protein Structure

More information

Orientational degeneracy in the presence of one alignment tensor.

Orientational degeneracy in the presence of one alignment tensor. Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two

More information

April, The energy functions include:

April, The energy functions include: REDUX A collection of Python scripts for torsion angle Monte Carlo protein molecular simulations and analysis The program is based on unified residue peptide model and is designed for more efficient exploration

More information

Protein Structure and Function. Protein Architecture:

Protein Structure and Function. Protein Architecture: BCHS 6229 Protein Structure and Function Lecture 2 (October 13, 2011) Protein Architecture: Symmetry relationships and protein structure Primary & Secondary Structure Motifs & Super-secondary Structure

More information

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To

More information

Outline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins

Outline. Levels of Protein Structure. Primary (1 ) Structure. Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Lecture 6:Protein Architecture II: Secondary Structure or From peptides to proteins Margaret Daugherty Fall 2003 Outline Four levels of structure are used to describe proteins; Alpha helices and beta sheets

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture

More information

Basic structures of proteins

Basic structures of proteins Basic structures of proteins Structural Hierarchy of Protein Primary structure Functional elements : α-helix, strands, β-sheet, loops.. - Structure, affinity, activity, specificity, stability etc. Secondary

More information

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization. Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the

More information

Lecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability

Lecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Lecture 2 and 3: Review of forces (ctd.) and elementary statistical mechanics. Contributions to protein stability Part I. Review of forces Covalent bonds Non-covalent Interactions: Van der Waals Interactions

More information

A topology-constrained distance network algorithm for protein structure determination from NOESY data

A topology-constrained distance network algorithm for protein structure determination from NOESY data University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network

More information

Read more about Pauling and more scientists at: Profiles in Science, The National Library of Medicine, profiles.nlm.nih.gov

Read more about Pauling and more scientists at: Profiles in Science, The National Library of Medicine, profiles.nlm.nih.gov 2018 Biochemistry 110 California Institute of Technology Lecture 2: Principles of Protein Structure Linus Pauling (1901-1994) began his studies at Caltech in 1922 and was directed by Arthur Amos oyes to

More information

A Path Planning-Based Study of Protein Folding with a Case Study of Hairpin Formation in Protein G and L

A Path Planning-Based Study of Protein Folding with a Case Study of Hairpin Formation in Protein G and L A Path Planning-Based Study of Protein Folding with a Case Study of Hairpin Formation in Protein G and L G. Song, S. Thomas, K.A. Dill, J.M. Scholtz, N.M. Amato Pacific Symposium on Biocomputing 8:240-251(2003)

More information

PROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration:

PROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration: PTEI STUTUE ydrolysis of proteins with aqueous acid or base yields a mixture of free amino acids. Each type of protein yields a characteristic mixture of the ~ 20 amino acids. AMI AIDS Zwitterion (dipolar

More information

1. What is an ångstrom unit, and why is it used to describe molecular structures?

1. What is an ångstrom unit, and why is it used to describe molecular structures? 1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter

More information

HMM applications. Applications of HMMs. Gene finding with HMMs. Using the gene finder

HMM applications. Applications of HMMs. Gene finding with HMMs. Using the gene finder HMM applications Applications of HMMs Gene finding Pairwise alignment (pair HMMs) Characterizing protein families (profile HMMs) Predicting membrane proteins, and membrane protein topology Gene finding

More information

FlexPepDock In a nutshell

FlexPepDock In a nutshell FlexPepDock In a nutshell All Tutorial files are located in http://bit.ly/mxtakv FlexPepdock refinement Step 1 Step 3 - Refinement Step 4 - Selection of models Measure of fit FlexPepdock Ab-initio Step

More information

Outline. The ensemble folding kinetics of protein G from an all-atom Monte Carlo simulation. Unfolded Folded. What is protein folding?

Outline. The ensemble folding kinetics of protein G from an all-atom Monte Carlo simulation. Unfolded Folded. What is protein folding? The ensemble folding kinetics of protein G from an all-atom Monte Carlo simulation By Jun Shimada and Eugine Shaknovich Bill Hawse Dr. Bahar Elisa Sandvik and Mehrdad Safavian Outline Background on protein

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information