PHOTOSYNTHETIC PICOPLANKTON AND BACTERIOPLANKTON IN THE CENTRAL BASIN OF LAKE ERIE DURING SEASONAL HYPOXIA. Audrey R. Cupp.

Transcription

1 PHOTOSYNTHETIC PICOPLANKTON AND BACTERIOPLANKTON IN THE CENTRAL BASIN OF LAKE ERIE DURING SEASONAL HYPOXIA Audrey R. Cupp A Thesis Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 2006 Committee: George S. Bullerjahn, Advisor R. Michael L. McKay Scott O. Rogers

2 ii ABSTRACT George S. Bullerjahn, Advisor In Lake Erie s central basin, a hypoxic region commonly termed the dead zone forms during late summer. Previous work has demonstrated an abundance of photosynthetic picocyanobacteria despite this lack of oxygen. High-throughput sequencing of over 400 cyanobacterial and eubacterial 16S rdna amplicons has characterized some of the major members of the microbial community both during and prior to the dead zone formation. In July, the bacterial communities mainly consisted of two unique clusters of Gram-positive Actinobacteria, with a smaller percentage of Flexibacter-Cytophaga-Bacteroides, α, β, and γ Proteobacteria. Cyanobacteria in the form of photosynthetic picoplankton was found at 16.5 m in July, but was absent from the 20 m library. During hypoxia in August, a community shift was demonstrated with a decrease in the Flexibacter-Cytophaga-Bacteroides, an increase in number and diversity of cyanobacteria, and an increase in an α-proteobacterial cluster. Diurnal oxygen production in the hypolimnion of Lake Erie was exhibited by in situ probes and showed actively photosynthetic picoplankton producing oxygen. Cyanobacterial 16S libraries showed an increase in diversity of photosynthetic picoplankton in August compared to July. The vast majority of clones similar to Synechococcus sp. MH301 were found in July with only a small percentage of clones from other groups. Conversely, during hypoxia, an increase of diversity was shown to exist. These differences in bacterial community members indicate the cycling of oxygen may influence the community structure in Lake

3 iii Erie. Novel primers specific for the cpeb gene in phyoerythrin-rich (PE-rich) cyanobacteria were used to study diversity of potential marine-like forms, indicating a new way to phylogenetically study PE-rich cyanobacteria.

4 iv ACKNOWLEDGEMENTS I would first like to acknowledge George Bullerjahn, my advisor and mentor for the past two years. I have learned so much, and I hope to be able to apply what I have learned to my future endeavors. I would also like to thank Mike McKay and Scott Rogers for serving on my committee, and for helping me become a better scientist, and in the process, a better writer. Without the help of my other lab members (Natasha, Masha, Linda, and Irina) I would have never finished my projects. I will never forget their knowledge and willingness to help. I would also like to thank some members from the University of Tennessee, especially Steven W. Wilhelm and Johanna Rinta-Kanto for their help with the chlorophyll and nutrient data. Last but not least, I would like to thank my parents, Beryl and Deborah Cupp, and my friends for their support and love throughout my college career. There is no way I could have endured this without you all.

5 v TABLE OF CONTENTS Page CHAPTER I. INTRODUCTION... 1 Rise and Evolution... 1 Marine Cyanobacterial Diversity... 2 Freshwater Photosynthetic Picoplankton (Ppicos)... 3 Lake Erie as a Model Ecosystem... 5 Invasive Species Issues in Lake Erie... 6 Lake Erie Anoxia... 6 Lake Erie Microbial Community... 7 CHAPTER II. METHODS Sampling DNA Extraction and PCR Amplification Cloning and Sequencing of Fragments Sequence Alignment and Phylogenetic Analysis Culturing of Picocyanobacteria CHAPTER III. RESULTS Oxygen and Lake Conditions Eubacterial Libraries Uncultured Actinobacteria and α-proteobacteria Clusters Ppico Libraries Cultured Ppico Sequences cpeb Library... 22

6 vi CHAPTER IV. DISCUSSION Eubacterial Library Diversity Ppico Libraries cpeb Library REFERENCES... 64

7 vii LIST OF TABLES/FIGURES Table Page 1 Primers with corresponding sequences and amplicon lengths used in the study Characterization of clones using the Ribosomal Database Project (RDP) using the Project Classifier S rdna sequences identified in Lake Erie prior to and during seasonal hypoxia as taken from the eubacterial libraries Reference sequences used in phylogenetic trees as taken from the GenBank database Table describing major species found in universal 16S libraries using BLAST search from samples collected in Lake Erie during

8 viii Figure Page 1 Estimated yearly hypoxia in Lake Erie Central Basin Map of select Lake Erie master stations % agarose gel visualizing all PCR products from August samples Graphs depicting dissolved oxygen and temperature in Lake Erie Comparison of chlorophyll a concentrations between July and August using varying filter sizes Bacterial assignment of clones from Station 84 July Bacterial assignment of clones from Station 84 August Neighbor-joining phylogenetic tree using universal 16S rrna sequences obtained from Lake Erie in July at 16.5 m depth Neighbor-joining phylogenetic tree from 16S rrna sequences obtained from Lake Erie in July at 20 m depth S rrna neighbor-joining phylogenetic tree from samples taken from August at 16.3 m S rrna neighbor-joining phylogenetic tree with major groups of bacteria from August at 22 m depth S rrna neighbor-joining phylogenetic tree of the major clusters of Ppicos from 16.5 m in July S rrna neighbor-joining phylogenetic tree of the major clusters of Ppicos from 20 m in July S rrna neighbor-joining phylogenetic tree of the major clusters of Ppicos from 16.3 m in August... 59

9 ix 15 16S rrna neighbor-joining phylogenetic tree of the major clusters of Ppicos from 22 m in August Percentage of clusters of Ppicos found at all depths and months in Lake Erie Neighbor-joining phylogenetic tree from 16S rrna sequences taken from cultured strains isolated from Lake Erie during and prior to hypoxia Neighbor-joining phylogenetic tree of the cpeb gene for phycoerythrin-rich cyanobacteria

10 1 CHAPTER 1 Rise and Evolution INTRODUCTION One of the most diverse and ecologically important groups of bacteria are the oxygenic phototrophic cyanobacteria. At the bottom of the microbial food web lie the cyanobacteria where they play a vital role in primary production in the world s oceans and lakes (Callieri and Stockner, 2002). With the extensive research done on marine carbon fixation, it has been noted that the marine Synechococcus and Prochlorococcus species fix anywhere between 32-80% of the carbon in oligotrophic oceans (Goericke, 1993; Johnson et al., 2006; Li, 1995; Liu, 1997; Rocap et al., 2002; Veldhuis, ). It is no wonder why there is so much interest in this group. Their importance in primary production does not overshadow their evolutionary significance in molding the primordial earth into its oxygenic form we experience today. From fossil evidence, the first appearance of cyanobacterial-like forms existed approximately 3.5 billion years ago (Schopf, 1978, 1993), but the forms most similar to modern-day cyanobacteria did not arise until about billion years ago (Atlas and Bartha, 1998). Prior to the existence of cyanobacteria, the primordial earth was primarily a reducing environment with elevated levels of carbon dioxide. The onset of oxygenic photosynthesis correlated with the changing of the Earth from a reducing atmosphere to an oxidizing one (Giovannoni, et al., 1988; Hayes, 1983; Schopf, 1983; Walter, 1987). The cyanobacteria were the first group to oxidize water to form oxygen. In recent years, the study of the 16S rrna in organisms has proven efficient in understanding the evolutionary relationships between (sometimes diverse) organisms (Woese, 1987; Olsen, 1987). Cyanobacteria, which were first described as the blue-green algae, were

11 2 reclassified under the Bacteria domain based on molecular evolution research. A second hypothesis that stemmed from molecular evolution work was that a symbionic relationship between a photosynthetic cyanobacteria and a eukaryote gave rise to the eukaryotic plastid. It is believed that the endosymbiosis was a monophyletic event that occurred between one cyanobacterial ancestor and a eukaryote (Gray, 1991). Marine Cyanobacterial Diversity: Given cyanobacteria s early origins, the ability to thrive in a number of different environments has been demonstrated. These organisms are common in most climates and conditions, including extreme environments of hot spring mats, hypersaline ponds, icecovered waters, or warm tropical lakes (Ward et al., 1998; Stockner, 2002). Information and research on cyanobacteria inhabiting marine environments has been abundant (Moore, 2002; Paerl, 2000; Partensky, 1999; Scanlan, 2002; Schmidt, 1991; Urbach, 1998; Zinser, 2006). Approximately fifty percent of the total primary production on Earth is due to phytoplankton (Ting et al., 2002), much of which comes from the world s oceans. The photosynthetic picoplankton (Ppicos) is a major group of cyanobacteria ranging in size from 0.2 to 2 µm (Callieri, 2002). Two major groups of PPicos, Prochlorococcus and Synechococcus, dominate the world s oceans, and contribute greatly to primary production (Partensky, 1999; Waterbury, 1986). Although they often co-occur in the water column, their spatial distributions (Scanlan, 2002; Moore, 1998), light-harvesting (Goericke, 1992; Ting et al., 2002; Urbach, 1998) size (Chisholm, 1988; Johnson, 1979) and nitrogen assimilation strategies (Moore, 2002; Lopez-Lozano, 2002) differ. Despite these differences, the two form sister clades within the cyanobacteria (Palenik, 1992; Urbach, 1992).

12 3 Freshwater Photosynthetic Picoplankton (Ppicos): Marine Ppico studies have vastly overshadowed work done on freshwater ecosystems. In freshwater habitats, only about five percent of the Ppicos are composed of eukaryotic green algae, whereas Synechococcus species dominate this size class (Weisse, 1993; Padisak et al., 1997). These Ppicos can be found in a variety of different freshwater ecosystems such as ultra-oligotrophic lakes (Boraas, et al., 1991), in polar and subpolar lakes (Vincent, 2000), and shallow productive eutrophic ponds or lakes (Vörös et al., 1998). The Ppicos fall into two distinct categories: the single-celled group monophyletic with marine Synechococcus and Prochlorococcus or the more taxonomically studied colony-forming group all of which are non-bloom forming (Stockner et al., 2000). The bloom forming cyanobacteria are well-known, especially in eutrophic lakes, but the non-bloom forming Ppicos are relatively unstudied. Until recently, the ease of microscopic enumeration for the colonial Ppicos gave them an advantage over working with the single-celled Ppicos (Stockner et al., 2000). Previously, these organisms were simply too small to investigate, or scientists ignored them completely (Stockner and Antia, 1986; Stockner, 1991). With the help of epifluorescence microscopy and flow cytometric analysis, more is known about the single-celled Ppicos than ever before (MacIsaac and Stockner, 1993). The phycobiliproteins (phycoerythrin (PE), phycocyanin (PC), or allophycocyanin (APC)) that form the phycobilisomes enable the Ppicos to harvest light at different wavelengths (Ting et al., 2002). These pigment proteins, as a result, fluoresce under certain excitation. For example, PE-rich Ppicos fluoresce a red-orange color under blue excitation, and a yellow-orange under green excitation, while the PC-rich Ppicos fluoresce a purple-red

13 4 under both green and blue light (Fahnenstiel and Carrick, 1992) enabling one to easily distinguish the two groups based on phycobiliprotein content. Ppico abundance in lakes has a seasonal pattern, no matter the trophic status of the lake (Weisse, 1993). Most often there is a spring and late summer peak abundance observed in lakes (Callieri and Stockner, 2002; Stockner et al., 2000) due to spring mixing and succeeding stratification. Two different assemblages of Ppicos usually dominate in these times, one for each instance of peak abundance (Stockner, 2000). During thermal stratification, a phenomena known as a subsurface algal maximum (SAM), subsurface chlorophyll maximum (SCM), or deep chlorophyll max has been shown to develop in lakes such as Lake Biwa in Japan (Maeda et al., 1992), the surface layers of Lake Kinneret, Israel (Malinsky-Rushanski, et al., 1995), and in the metalimnion of Lakes Maggiore, Baikal, Stechlin, and Constance (Callieri and Ponolini, 1995; Nagata et al., 1994; Padisak et al., 1997; Weisse and Schweizer, 1991). Several of the Great Lakes such as Lakes Erie, Huron, Michigan, and Superior (Carrick, 2004; Fahnenstiel and Carrick, 1992; Fahnenstiel and Glime, 1983) also have demonstrated a SAM. Since a SAM frequently occurs in oligotrophic waters (Carrick et al., 2000; Fahnenstiel and Scavia, 1987), it is surprising to find lakes such as Lake Erie supporting this assemblage although the eastern basin in this lake verges on oligotrophic status. A decline of Ppicos around mid-june is most likely due to nutrient depletion and competition from destabilization during water stratification (Callieri and Stockner, 2000; Weisse, 1993). It is during these times in spring to early summer that picoeukaryotes show peak abundances in the more isothermal conditions (Pick and Agbeti, 1991). The vertical distribution of the singled-celled Ppicos depends largely on parameters such as

14 5 light, temperature, and abundance or lack of predators (Weisse and Kenter, 1991; Pernthaler et al., 1996). Lake Erie as a Model Ecosystem: Approximately 20% of the world s freshwater supply is contained within of the Great Lakes (Wetzel, 2001). Lake Erie is the smallest by volume (average depth around 19 m), yet it is the most productive lake of the Laurentian Great Lakes (Munawar and Weisse, 1989). It ranks thirteenth in terms of surface area (26,657 km 2 ) and ranks eighteenth in terms of volume (483 km 3 ) (Herdendorf, 1982). Lake Erie has a rich supply of fish, exceeding that of all other Great Lakes combined (Burns, 1985). It is the southernmost, shallowest, and warmest of the Great Lakes. The large anthropogenic influence contributed by a population base of over 30 million people, in addition to agricultural and industrial impacts on Lake Erie has caused the lake s high productivity, yet it is known that this excessive human impact can degrade aquatic ecosystems (Munawar et al., 1999). During the 1960s and 1970s, Lake Erie was extremely eutrophic, and after the burning of the Cuyahoga River, was termed a dead lake. On the contrary, Lake Erie was actually too productive. Phosphorus was found to be the limiting nutrient in freshwater ecosystems (Schindler, 1977), and excessive loadings of this nutrient from anthropogenic impacts caused a proliferation of phytoplankton in Lake Erie. This yielded reduced water clarity, algal blooms, and anoxic conditions in portions of the lake. Since that time, stringent limitations mandated by the Great Lakes Water Quality Agreement have been implemented to reduce the amounts of phosphorus flowing into Lake Erie. During the past decade, limits of phosphorus have been lowered to approximately 11,000 tons per

15 6 year (Dolan, 1993). Since these reductions, the lake has gone from an extremely eutrophic lake to more mesotrophic conditions in the western and central basins, to an oligotrophic or ultraoligotrophic state in the deeper eastern basin (Charlton, 1994; MacDougall et al., 2001). Invasive Species Issues in Lake Erie: The first reported case of the exotic zebra mussel (Dreissena polymorpha) was reported in Lake St. Clair in 1988 (Herbert et al., 1989). Due to recreational boating, logs, and other vegetation, the zebra mussel was found to cover most of the Lake Erie floor by 1992 (Dermott and Munawar, 1993). Today, both zebra and quagga mussels have infiltrated most of the Great Lakes, especially Lake Erie. No doubt these organisms have altered the chemistry of the lake, leading to a huge ecological impact on the microbial loop. Research has shown that both zebra and quagga mussels consume phytoplankton (MacIsaac, 1996; MacIsaac et al., 1992; Makarewicz, et al., 1999; Nicholls and Hopkins, 1993) and that they can filter anywhere from 39-96% of the water column each day (Bunt et al., 1993). The most heavily impacted basin in Lake Erie is the shallowest western basin. The only portion of the lake in which these mussels cannot survive is the seasonal anoxic region of the central basin (Dermott and Munawar, 1993; Roe and MacIsaac, 1997). Overall, the impact of these filter feeders has yielded increased water clarity and a shift in primary productivity from the surface to the benthos (Carrick, 2004). Lake Erie Anoxia Lake Erie is divided into three separate basins (denoted western, central, and eastern basins, respectively), all of which are distinct in terms of depth, trophic status,

16 7 phytoplankton abundance, and dissolved oxygen. One area of interest for scientists has come from the natural-occurring anoxic zone that forms in the central basin during summer stratification. This phenomena has been present in the lake since it was first observed in 1930 (Bolsenga and Herdendorf, 1993), but the rate at which it has enlarged has only been documented for over thirty years (Charlton and Milne, 2004). During the 1960s through the 1970s it was demonstrated that Lake Erie had massive eutrophication problems. The response of the lake was a marked increase of the anoxic region in the central basin (Figure 1) from (Rosa and Burns, 1987). This increase was in part due to the phosphorus loading in addition to the lake morphology that also helped sustain this anoxic region. Increases in phosphorus caused a proliferation of phytoplankton and primary production, and the drawdown of this carbon source into the shallow (1-4 meter) hypolimnion caused a rapid export of dissolved oxygen that is unable to be replenished due to density consortia of the stratified water column. Often times the dissolved oxygen concentration in the central basin is depleted to less than 5 mg/l (Charlton et al., 1993). The regulations put on influxes of phosphorus into Lake Erie helped control the size of this so-called dead zone in the central basin for several years. Recently, however, the anoxic region has spread once again. Interestingly, the maximum load of 11,000 tons of phosphorus per year has been met, meaning parameters other than phosphorus may be to blame this time around. It has been hypothesized that things such as zebra mussel impacts, low lake levels, climatology, and unreliable phosphorus monitoring may be contributing. Lake Erie Microbial Community

17 8 Studies on the microbial community in Lake Erie have vastly lagged behind work done on marine systems (e.g. Cottrell and Kirchman, 2000) and other freshwater lakes (e.g. Hahn et al., 2003; Hiorns et al., 1997). The limited amount of work done on Lake Erie bacterial communities has been restricted to viral impacts on bacterial communities (Dean et al, in press; Wilhelm and Smith, 2000) and bacterial abundances and primary production (DeBruyn et al., 2004). Furthermore, to fully understand the phenomenon of anoxia and what members are contributing to this process, we must first determine the prokaryotic community comprising the dead zone in the central basin. Few studies have been published describing the Ppicos and heterotrophic bacteria producing and consuming the oxygen in the dead zone. With the ability to now use culture-independent studies, we are able to take a shapshot of the structural diversity and make predictions as to their function (Smalla, 2004). Analyzing both environmental clones and isolates cultured from the same habitat have provided some insight as to how the two may reveal differing community members (Delong, 1992; Wright et al., 1997). The most widely used technique to study microbial diversity is by analyzing the 16S rrna gene using specific PCR primers (Giovannoni et al., 1990). This universally conserved region is only one portion of the ribosomal operon that can be found in all bacteria. In the work described below, samples were collected from Lake Erie in July (prior to hypoxia) and August (during hypoxia), These samples were used to generate 16S rdna libraries for all bacteria, and 16S libraries containing only cyanobacterial sequences to study the Ppico assemblage. To compare culture-independent with culturedependent studies, samples were taken to try and isolate major groups of Ppicos as well. The final step was to analyze the samples using primers specific for the cpeb gene, which

18 9 encodes the class I β-pe subunit for phycoerythrin-rich Ppicos. This 551 basepair gene is a part of the cpeba operon, and lies upstream to the cpea gene (Wilbanks and Glazer, 1993). Most sequences accumulated to date for the cpeb gene have been for marine-like cyanobacteria. The aim was to determine whether or not there are any novel phycoerythrin-rich Ppicos in Lake Erie during summer stratification.

19 10 CHAPTER 2 METHODS Sampling- Environmental sampling occurred during the July and August 2005 cruises aboard the CCGS Limnos. Thermally stratified water was collected in 10 L Niskin bottles on a General Oceanics Rosette sampler and filtered at Environment Canada Central Basin Station 84 (Latitude Longitude ) (Figure 2) from depths 16.5 meters and 20 meters in July and 16.3 meters and 22 meters in August for DNA extraction and culturing of picocyanobacteria. Duplicate volumes of water from ml of lakewater biomass was vacuum aspirated onto a 0.22 µm polycarbonate filter (Millipore) and immediately frozen at -20 C in TE buffer (1:10, 10 mm Tris-HCl [ph=8.0] to 1 mm EDTA) until arriving back into the laboratory where filters were frozen at -80 C until needed for DNA extraction. DNA Extraction and PCR Amplification- In July, 600 ml of water was filtered at depth 16.5 m, and 100 ml was filtered at 20 m. Interestingly, the 16.5 m filter appeared very pink, and was thus used for DNA extraction. Three-hundred ml of lake water was filtered for DNA extraction at both 16.3 m and 22 m in August. Approximately one-third of a filter was aseptically cut for DNA extraction, except for the concentrated 16.5 m July filter where only one-fourth of a filter was used for analysis. These amounts had efficient bacterial biomass for amplification. A DNeasy kit (Qiagen) was used to extract the DNA taken from filters. The protocol for extraction of gram-positive DNA was followed with a few minor changes. Lysozyme was added to a final volume of 3 mg/ml to facilitate lysis of gram positive bacteria and a

20 11 smaller volume (75 µl instead of 100 µl) of elution buffer (EB) was added in order to concentrate the elution of DNA. Eubacterial and cyanobacterial-specific primers (see Table 1) were used to amplify different segments of the 16S rrna gene. In addition, primers to amplify the cpeb gene for phycoerythrin-rich cyanobacteria were employed in this study. PCR was done in 50 µl volumes of: 5X green GoTaq buffer [ph=8.5] with 1.5 mm MgCl 2 (Promega), 2.5 mm deoxynucleotide triphosphates (Promega), 50 nm of each primer (Invitrogen), 6 µl DNA, and 0.5 units of Taq polymerase (Promega). Each reaction was carried out using a thermal cycler (MJ Research). Cycling conditions for 106F primers consisted of heating at 95 C for 10 minutes, followed by 30 cycles of 94 C for 1 minute, 58 C for 1 minute, 72 C for 2 minutes and a final extension time of 10 minutes. The cycling parameters for the cpeb primers consisted of an initial heating to 95 C for 5 minutes with 35 cycles of 94 C for 1 minute, 42 C for 1 minute, 72 C for 2 minutes followed by a final extension for 10 minutes at 72 C. Amplicons were visualized on 1-2% agarose gels stained with ethidium bromide. Cloning and Sequencing of Fragments- PCR amplicons of lake biomass were cloned into either a CT-TOPO Cloning Kit (Invitrogen) or the pcr 2.1 Cloning Kit (Invitrogen) using TOP10F competent Escherichia coli cells. Efficiency of reactions for each kit was comparable. Colonies were grown on Luria Bertani (LB) plates with 100 µg/ml ampicillin and 40 mg/ml X-gal in dimethyl sulfoxide (DMSO) with 100 mm isopropyl-beta-d-thiogalactopyranoside (IPTG) to select for transformants with DNA inserts. Colonies were restreaked and checked for efficiency by colony PCR before being sent for sequencing. High-throughput sequencing of libraries was performed by the Clemson University Genomics Institute

21 12 using an ABI 3730xl using the dye terminator method. All other sequencing reactions, including those done on isolated cultures were done at the University of Chicago Cancer Research Center DNA Sequencing Facility using either an Applied Biosystems 3730XL 96-capillary or a capillary automated DNA sequencer. Sequence Alignment and Phylogenetic Analysis- Sequences obtained were cleared of primers using the WinGene software Version (Hennig, 2002). Ambiguous bases were checked and altered using the BioEdit program (Hall, 1999). Sequences were compared to known cultured and environmental sample sequences using the BLASTN search tool (Altschul et al., 1990) on the National Center for Biotechnology Information website, while the Ribosomal Database Project (RDP) Release 9 Classifier (Cole et al., 2005) was used to characterize the sequences into specific phyla. The Classifier ranks the sequences into the taxonomical hierarchy of kingdom, phylum, class, order, family, genus, and species based on a confidence level of at least 80%. Anything below this level is considered to be unclassified. All sequences were aligned using the ClustalX program while phylogenetic and molecular evolutionary analyses were conducted using MEGA version 3.1 (Kumar, Tamura, Nei, 2004). Phylogenetic analysis shows ancestral-descent based on novel DNA sequence patterns, whereas BLAST searches solely on sequence similarity. Neighbor-joining analysis using Kimura-2 parameter was employed with subsequent bootstrapping analysis with 500 regroupings. Culturing of Picocyanobacteria-

22 13 Lakewater ( ml) was spiked with ammonium to a concentration of 30 µm in addition to the other 7 components of the BG-11 media. BG-11 components 2-8 were added to 1/5 the concentration of regular BG-11 (Allen, 1968). While sampling, 100 ml of lakewater was filtered onto 0.22 µm polycarbonate filters (Millipore) and subsequently placed onto low nutrient (1/5 BG-11) ammonium agarose (1.5%) plates with cycloheximide added to a concentration of 250 µg/ml to inhibit eukaryotic growth. Spiked water and plates were incubated under a light intensity of 4 µmol quanta m -2 s -1 (ambient lab lighting) at room temperature until noticeable growth accumulated on the filters and in the water. The spiked water was centrifuged at 6000 rpm for approximately one minute to concentrate the biomass which was subsequently streaked onto low nutrient BG-11 agarose (1.5%) plates with cycloheximide to a concentration of 250 µg/ml. Colonies from filters were aseptically picked with a sterile loop and also restreaked onto the media described above. These plates had nitrate as a nitrogen source, and again, components of BG-11 were scaled down to a concentration 1/5 of normal BG- 11 media. All strains were grown under continuous light ranging from 4-10 µmol quanta m -2 s -1 at room temperature. After four rounds of restreaking, single colonies were picked and resuspended into low nutrient BG-11 liquid medium and incubated as demonstrated above. Strains still contaminated with heterotrophic bacteria were treated with the antibiotic ampicillin using a protocol specific for cyanobacteria (J. Acreman, personal communication). Colony PCR using cyanobacterial-specific primers 106F was performed to extract DNA and PCR purification (Qiagen) was done before sequencing at the University of Chicago Cancer Research Center DNA Sequencing Facility using either an Applied Biosystems 3730XL 96-capillary or a capillary automated DNA

23 14 sequencer. Sequence alignment and phylogenetic analysis was performed the same way as the sequences obtained from the 16S rrna libraries.

24 15 CHAPTER 3 RESULTS Oxygen and Lake Conditions: Profiles of the central basin master station 84 were taken during the July 14 and August 24, 2006 cruises aboard the C.G.G.S. Limnos. These profiles revealed a prominent thermocline for both months (Figure 4) due to summer stratification. During August, the temperatures throughout the metalimnion and hypolimnion were warmer than July which is normal for master station 84 (Wilhelm, in press), yet the surface temperatures remained the same for both months. In July, prior to seasonal hypoxia, the dissolved oxygen concentration in the hypolimnion reached a low of 6.0 mgl -1, whereas in August it reached approximately 3.5 mgl -1, indicating hypoxic although not anoxic conditions at the time of sampling. A slight oxygen increase was evident at around 16 meters during both months (Figure 4). Sampling showed a small increase in the concentration from late evening (approximately 22:47 GMT) in August which is later absent during the morning hours (around 10:02 GMT). This spike in oxygen may be due to an assemblage of actively photosynthetic Ppicos thriving in this region. Chlorophyll a concentrations at both 16.5 m and 16.3 m show an almost twofold increase for the picoplankton, nanoplankton, and microplankton in August compared to July (Figure 5). Eubacterial Libraries: To assess microbial diversity prior to, and during summer hypoxia, a total of 273 clones were analyzed following PCR with eubacterial primers 46F and 571R specific for the 16S rrna gene. As expected, a fraction of the clones yielded empty vectors, and thus were not used in analysis. Identical sequences were accumulated and following each

25 16 clone name the letters CC were added with the amount of identical sequences found. Phylogenetic analysis using the neighbor-joining method was used with the Kimura-2 parameter and bootstrap sampling. Two depths from the hypolimnion for each month were used for analysis; 16.5 m and 20 m for July and 16.3 m and 22 m for August. Both the Ribosomal Database Project (RDP) Classifier and phylogenetic analysis were utilized to properly determine phyla of all clones. In July at depth of 16.5 m, a total of 46 clones were used in the analysis. From the RDP Classifier, the dominant phyla at this depth consisted of unclassified bacteria (32.6%) and the Actinobacteria (26.1%) (Figure 6). The RDP Classifier designates the term unclassified bacteria to those amplicons which do not fit any phyla with at least an 80% confidence level. Also present to a lesser extent in July at 16.5 m were the groups Flexibacter-Cytophaga-Bacteroides (17.4%), cyanobacteria (13%), β-proteobacteria (4.35%), unclassified proteobacteria (4.35%), and the α-proteobacteria (2.2%). From phylogenetic analysis with representatives from the GenBank database (Figure 8), all but two of the unclassified bacterial clones clustered with the Actinobacteria. Of the two remaining clones, LE46F165m739 could not be determined by phylogenetic analysis or the RDP classifier, while the second clone clustered with the Flexibacter-Cytophaga- Bacteroides. All Ppico sequences obtained using the universal bacterial primer pair clustered with a phycoerythrin-rich Synechococcus sp. MH301 (Crosbie et al., 2003) indicating an overall lack of Ppico diversity. While descending deeper in the hypolimnion, the next depth to study microbial diversity was in July at 20 m. With the maximum depth at master station 84 being around 24.5 m, we expected to find a community closer to that found in sediments. Of the 47

26 17 clones, the two major groups comprising this depth were the actinobacteria (30%) and the unclassified bacteria (34%) (Figure 6). Groups affiliated with the Proteobacteria (α, β, γ, and unclassified) and the Flexibacter-Cytophaga-Bacteroides were also present. The unclassified and α-proteobacteria were most abundant with 10.6% of sequences, followed by the β-proteobacteria and Flexibacter-Cytophaga-Bacteroides group at 6.4% and the γ-proteobacteria with 2.1%. Using phylogenetic analysis, it was determined that all of the unclassified Proteobacterial sequences clustered within the α-proteobacteria and eleven of the 16 unclassified bacterial sequences clustered within the Uncultured Actinobacteria Cluster 2 (Figure 9). Two of the remaining unclassified sequences (LE84720m46F13 and LE84720m46F27) could not be divided into specific phyla based on the two methods applied. There is also an Uncultured Actinobacteria Cluster 1 which is most similar to uncultured environmental clones. In August, the dissolved oxygen concentration decreases dramatically changing the geochemical properties of the lake. Due to increased efficiency of cloning reactions, 91 clones were evaluated at 16.3 m. Upon first glance, the most striking difference at this depth and time is the major increase in amounts of Ppicos and cyanobacteria (19%) as well as the diversity in types (Figures 7 and 10). The three other bacterial affiliations which were prominent in addition to the cyanobacteria are the unclassified bacteria (20%), actinobacteria, (23%), and the unclassified proteobacterial sequences (33%). The subdivisions of α and β proteobacteria and Flexibacter-Cytophaga-Bacteroides were underrepresented in this library with only 1, 2, and 2% of the sequences, repectively. All 30 unclassified proteobacterial clones clustered within the Uncultured α-proteobacteria Cluster. Two unclassified bacterial sequences (LE46F163M811 and LE46F163M824)

27 18 cluster within the cyanobacterial lineage, yet the closest relative is an uncultured bacterial clone (DQ117395). Other unclassified bacterial clones phylogenetically cluster with the Flexibacter-Cytophaga-Bacteroides (LE46F163M851), α-proteobacteria (35% of the unclassified sequences), and the actinobacteria (41% of the unclassified sequences). Both Uncultured Actinobacteria Clusters were present at the depth. The final depth analyzed using the eubacterial primers was 22 m in August. For the 89 clones used, the major bacterial affiliations for this depth were the actinobacteria (40.4%), the unclassified proteobacteria (27%), and the unclassified bacteria (20.2%) (Figure 7). Similar to the results from the July 20 m analysis, a fraction of the sequences came from the γ-proteobacteria (2.2%) as well as an increase in the β-proteobacteria (10.1%). Unlike the other libraries, no clones from the Flexibacter-Cytophaga- Bacteroides group were found. From phylogenetic analysis, all 24 sequences labeled as unclassified proteobacteria due to low confidence levels clustered within the Uncultured α-proteobacteria Cluster (Figure 11). The other unclassified bacterium clones from the RDP yielded sequences that clustered with the cyanobacteria (LE46F22m839), β- proteobacteria (LE46F22m828), α-proteobacteria (3 sequences), and the actinobacteria (20 sequences). Again both Uncultured Actinobacteria Clusters were found at depth. No isolate from the Planctomycetales, Nitrospira, Spirochaetes, δ-proteobacteria, or ε-proteobacteria groups were found in the samples. The most abundant group in all libraries was the gram-positive, high G+C rich Actinobacteria. Other prominent groups overall were the α-proteobacteria, the cyanobacteria, and the Flexibacter-Cytophaga- Bacteroides groups. Table 3 demonstrates how the vast majority of sequences were found to have high similarity to other uncultured environmental clones rather than isolated

28 19 strains by BLAST searching the GenBank database. The function of these uncultured strains is unknown due to difficulty of culturing many groups of bacteria. Uncultured Actinobacteria and α-proteobacteria Clusters: All samples from July and August yielded two clusters of Actinobacteria. Uncultured Actinobacteria Cluster 1 had % similarity from all depths with a moderate to high bootstrap support (60-100%). Cluster 2 had an % similarity and followed with high bootstrap support of 84-99%. No sequences were similar to any cultured actinobacterial isolates, and using the GenBank database, the hits with the highest percent identity was with uncultured environmental clones (Table 3). A third cluster of α-proteobacteria was exhibited primarily in August, yet eight clones in July were also present. These sequences had a % similarity with bootstrap support of %, and like the Actinobacteria clusters, had closest relatives to uncultured environmental clones. Ppico Libraries: To assess Ppico genetic diversity in the Lake Erie dead zone, sequences for the 16S rrna gene were analyzed using 106F and 781R primers specific for all cyanobacteria and plastids (Nubel, 1996). As per sampling, the identical depths and months from master station 84 used for the eubacterial libraries were used in examining the Ppico community. High-throughput sequencing of clones in one direction yielded a total of 253 sequences. Of the 253 sequences, only 165 were cyanobacterial in origin. Since the primers were specific for both cyanobacterial and plastid sequences, many eukaryotic diatom sequences were obtained. A total of 57 plastid sequences were recovered, 27 of which came from the July 16.5 m library, 17 from the August 22 m

29 20 library, and 13 from the July 20 m library. The other 31 sequences came from other non- Ppicos, and thus were not used in analysis. All identical sequences were dealt with in the same manner as the eubacterial libraries. The remaining 165 sequences that did fall under the cyanobacterial radiation were divided into 4 phylogenetic trees based on month and depth of sampling. Picocyanobacterial phylogenetic tree references were taken from GenBank and all cluster designations were previous described (Crosbie et al., 2003; Ernst et al., 2003) using nearly full-length 16S rdna sequences. As seen from the eubacterial phylogenetic trees, little diversity in the cyanobacteria was evident in Lake Erie prior to hypoxia (July). In accordance to this, the major cluster for the Ppicos was the Syenchococcus sp. MH301 cluster which is a PE-rich strain isolated from Lake Mondsee, Austria (Crosbie et al, 2003). In July at 16.5 m depth, only 15 Ppico sequences were recovered, with the majority of sequences being diatoms (27 sequences) or other non-cyanobacterial sequences (16 sequences). Of the Ppico sequences, 10 clustered with Synechococcus sp. MH301 with a moderately high bootstrap support of 88%. Sequence LE106F165m73 fell under Group B (sensu Crosbie et al., 2003) which has been described as the Subalpine Cluster I by Ernst et al. and contains isolates from various locations around Europe. Sequences LE106F165m74 and LE106F165m711 both cluster with Group H with the latter being closely related with a high 99% bootstrap value. Two sequences lay outside of the Ppico clade, and are closely related to the cyanobacteria Anabaena sp. 66A. (Figure 12)

30 21 The library with the least amount of diversity found in the study came from 20 m in July (Figure 16). Of the 42 Ppico sequences obtained, 35 (83% of the total) clustered with the PE-rich MH301. The only other groups found at depth were two sequences (LE106F20m713 and LE106F20m722) closely related to Group A, also known as the Cyanobium gracile cluster by Ernst et al. This group contains members with both phycoerythrin and phycocyanin-rich isolates from many different lakes worldwide. Three sequences fell within the Group H cluster with moderate bootstrap values. Unlike the 16.5 m library, all sequences fell into the Ppico clade, and no other cyanobacterial sequences were extrapolated (Figure 13). In contrast to the July libraries, more diversity was found among Ppicos in August during the dead zone formation (Figure 16). At 16.3 m, a total of 37 Ppico sequences were analyzed with an additional 8 sequences also falling under the cyanobacterial radiation. This library contained sequences from cluster Groups B, H, and A and also with Synechococcus sp.mh301 (Figure 14). Seven sequences (16% of total) clustered with the PE-rich MH301, 7 sequences (16% of total) with Group B, 13 sequences (28% of total) with Group H, and 10 sequences (22% of total) with Group A. The Group H sequences had a high bootstrap support of 94%, while the MH301 cluster had an 89% bootstrap. For Group A, one sequence (LE106F163m811) clustered with reference sequences, while a cluster of 9 sequences were closely related to Group A with high bootstrap support, but formed a separate group. Sequence LE106F163m818 clustered with MH301 with a high bootstrap support of 89%, while 6 other sequences were closely related, yet did not lie within the assemblage. Eight sequences were not Ppico in nature, but did cluster with other cyanobacterial sequences. One sequence (LE106F163m825)

31 22 was found to cluster with Synechocystis PCC6803, while the other seven were similar to Snowella litoralis OTU35S07. Unlike the July libraries, the diversity of Ppicos remained equal while extending deeper in the water column. August 16.3 m and 22 m libraries look very similar, except for the addition of two clusters not previously seen in these library sets (Figure 16). Twenty-seven Ppico sequences were examined, with a total of 8 other cyanobacterial sequences of interest. No sequence had clustered within the Synechococcus sp. MH305 clade or the Lake Biwa cluster Group E (Crosbie et al., 2003) until the August 22m library where 4 and 3 sequences were revealed, respectively. The other groups indicated from analysis were Groups B and H, MH301, and other cyanobacteria. Highest bootstrap values were revealed with % support for all Ppico clusters. Non-Ppico cyanobacterial sequences show one Anabaena sequence with 7 Snowella litoralis sequences (Figure 15) Cultured Ppico Sequences: Five non-identical Ppico isolates were cultured in laboratory media from different depths and months of sampling using a modified low nutrient BG-11 recipe. This change in media was made to simulate concentrations closer to those found in Lake Erie water. It has been acknowledged that both nitrate and phosphate concentrations can affect the cultivability of certain cyanobacteria (especially PE-rich Synechococcus) from lownutrient environments (Ernst et al., 2005). Growing Ppicos on normal BG-11 would have selected for bacteria only able to grow on the nutrient-rich medium and inhibited the cyanobacteria that proliferate on low nutrients. Designations for these isolates are ARC- 1 through 5 (Figure 17). ARC-1 and ARC-2 were both isolated from 15 m in August, yet

32 23 ARC-1 clustered in Group A, while ARC-2 was found to cluster within Group B. ARC-3 was isolated in July at a depth of 16.5 m and clustered in Group A. ARC-4 was cultured from August at 22 m and clustered with Group B, whereas ARC-5 was isolated from July at 13.5 m and resembled Snowella litoralis OTU35S04. Clones of Snowella litoralis were found in both eubacterial and cyanobacterial libraries revealing the relative abundance of this cyanobacterium in Lake Erie. The Ppico abundant in Lake Erie which closely resembles Synechococcus sp. MH301 has to date not been successfully isolated. It can be concluded that isolates brought into culture are represented in the phylogenetic trees of environmental DNA samples. Characterization of these isolates based on parameters such as nutrient acquisition, optimal light intensity, and photosynthesis-irradiance response (PE) curves have not been done at present, but will be shown at a later date. cpeb Library: Results from the cpeb library are relatively limited due to the restricted amount of reference sequences available for other cyanobacteria. PCR was done on all samples and depths as for the other libraries, and yielded a small fragment around 150 basepairs in length. A total of 64 clones were used for phylogenetic analysis. Three new clusters were obtained using the neighbor-joining method for Lake Erie sequences. High bootstrap support of 83% and 92% for these new clusters demonstrates how this primer set, despite its small size, could be a marker to identify new groups of PE-rich cyanobacteria. One group containing 19 sequences clustered with Synechococcus rubescens and Synechococcus BO8807, while PE-rich cultured isolate ARC-2 clustered with these strains with a moderate bootstrap support of 65%. One unusual sequence (cpebe-09) was obtained from 16.3 m in August and clustered with Synechococcus CC9605 (Figure 18).

33 24 These data suggest that cpeb sequences can ultimately be used to sort out phylogenetic relationships among the PE-rich Ppicos.

34 25 CHAPTER 4 DISCUSSION Questions posed at the beginning of the study were those concerning the microbial community in Lake Erie prior to and during seasonal hypoxia. The goal was to determine whether or not the community changed or retained the same level of diversity during the transition to hypoxia and to identify spatial patterns in microbial communities as they relate to the production and consumption of oxygen in the lake. Upon completion and analysis of clone libraries, insight to the community structure has been unmasked in this region. The majority of the eubacterial libraries contained both aerobic and anaerobic heterotrophic bacteria and phototrophic prokaryotes. This mix of groups demonstrates the cycling of oxygen that persists in the Central Basin. Eubacterial Library Diversity: Bacterioplankton mediate a large portion of the carbon turnover in freshwater lakes (del Giorgio, 1999). Unfortunately, the function these organisms play in their environment is largely unknown due to the lack of knowledge on their physiology. The ability to culture members from both marine and freshwater ecosystems is very low with cultivation success for approximately 0.1% of marine and up to 1.4% of freshwater bacterioplankton (Bruns, 2003; Kogure, 1980; Page, 2004). With this inability to properly culture diverse populations, sequence analysis of 16S rrna gene was performed to asses the composition of these bacterial communities. Understanding the community composition of lakes will reveal the role of these microorganisms in biogeochemical processes.

35 26 The potential biases for using 16S libraries have been evident. The importance of proper DNA extraction methods must be used to ensure lysis of as much bacteria as possible. Annealing kinetics for PCR may skew products depending on the concentrations of PCR reagents used (Suzuki, 1998). In addition, cloning of products may favor certain PCR products over others. Random picking of E.coli colonies may also affect results. If certain bacteria are not abundant in the ecosystem, only a few PCR products would be obtained, and subsequent clones may not be picked for analysis, thus leaving out underrepresented populations. These potential biases must be considered when analyzing the results of the five libraries. The Ribosomal Database Project (RDP) Classifier was used to analyze the sequences into subsequent phyla and class designations. Neighbor-joining analysis using the Kimura-2 parameter from the Mega 3.1 software was used to cross-examine the sequences obtained. These together helped determine the microbial community. From the eubacterial libraries obtained from Lake Erie, the most prevalent phyla were the Actinobacteria comprising of almost half of all sequences (47%). Two separate clusters of Actinobacteria with high bootstrap support and similarity were phylogenetically found at both depths and months. It is well known that the Actinobacteria constitute many different habitats, one of which includes a wide variety of freshwater ecosystems of differing trophic status (Crump, 1999; Glöckner, 2000; Hahn, 2003; Hirons, 1997; Lindstrom, 2002; Zwart, 1998; Zwart, 1998). This group is often found in soils and sediments and was previously known as the high-g+c gram-positive bacteria obviously due to the high guanine and cytosine nucleotides found in its genome. This gram-positive bacteria has been found to account for up to 60% of freshwater

36 27 bacterioplankton (Glöckner, 2000) perhaps due to the fact that certain strains of Actinobacteria are resistant to grazing from bacterivorous microorganisms (Hahn, 2003; Pernthaler, 2001). This resistance, along with its facultative anaerobic respiration, may have allowed for the abundance and proliferation of this group during hypoxia. Several clusters of freshwater Actinobacteria can be evident in most ecosystems. Three sequences (LE46F20m73, LE46F20m716, and Le46F20m720) were found to be closely related to an Actinobacterial isolate Mycobacterium hodleri. This species is a fast-growing Actinomycete that is able to degrade polycyclic aromatic hydrocarbons (PAHs) and other environmentally hazardous elements (Kleespies, 1996). The Proteobacteria are divided into five distinct classes, while three of these five (α, β, and γ) are often found in marine and freshwater habitats (Glöckner et al., 1999). Not surprisingly, these three groups were all represented in the present libraries. 23% of all sequences obtained were assigned to the α-proteobacteria. Relative abundance of this group normally found in freshwater ecosystems varies from 0-20% of all bacteria (Glöckner et al., 1999). The α-proteobacteria cluster, like the Actinobacteria clusters, did not yield any isolated strains from the GenBank database, showing these groups are most similar to uncultured environmental samples than to any cultured strain. This group was a major constituent of in the August library, but was reduced drastically in July showing a dynamic shift of community members from July to August. The cultured isolate this group clustered with was a marine α-proteobacteria Alpha Proteobacteria SKA48 (Simu, 2003). The inability to assign a specific metabolic function to this cluster is due to a lack of physiological characterization of many environmental samples.

37 28 From GenBank BLAST searches, several other sequences were found to be closely related to isolated strains, including the α-proteobacteria. Two groups were found to be very similar to other α-proteobacterial Crater Lake isolates Sphingomonas sp. HTCC503 and Rhodobacter sp. HTCC515 (Page, 2004). The aerobic Gram-negative Sphingomonas species are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAHs) as a source of energy and carbon (Bastiaens, 2000; Khan, 1996; Mueller, 1990; Pinyakong, 2000) and have also been shown to degrade pesticides (Nagata, 1999) and herbicides (Adkins, 1999). Two sequences from Lake Erie (LE46F20m719 and LE46F165m738) resembled this isolate and were only found in July libraries. Whereas Lake Erie is still recovering from the phosphorus loadings and other anthropogenic impacts induced on the ecosystem during the 1970s and 1980s, it still receives the most industrial pollution of all the Great Lakes. It is not surprising to find potential pollutant-degrading organisms in the soils and water column. The studies on the chemoautotrophic Rhodobacter species from freshwater habitats have, like Ppicos, lagged behind marine work. The Rhodobacter group consists of purple bacteria capable of anaerobic anoxygenic photosynthesis by the use of bacteriochlorophyll a, but does not evolve oxygen like cyanobacteria (Yurkov and Beatty, 1998). Alternatively, they grow heterotrophically as unpigmented nonphotosynthetic aerobes. One sequence (LE46F20m737) from July was found to be closely related to this group. Increased water clarity due to filtering of the zebra mussels may drive the proliferation of this photosynthetic purple bacterium in Lake Erie in the hypolimnion.

38 29 One sequence similar to a Caulobacter sp. FJI423 was found from the July library. This Gram-negative aerobic α-proteobacteria is often found in both marine and freshwater ecosystems. This prosthecate group is able to adhere to objects by the use of holdfasts and have been found in hypolimnia at anaerobic depths which suggest their survival at cooler, anaerobic locations (Staley, 1987). Six percent of all sequences were assigned to the class β-proteobacteria with representatives found in all libraries with a higher percentage of sequences found at depth. The β-proteobacteria contains chemoheterotrophs or chemoautotrophs which derive their nutrients from the decomposition of organic material (Dexter-Dyer, 2003). Two sequences from August (LE46F22m810 and LE46F22m828) closely resembled a species of Nitrosovibrio which is a chemoautotrophic ammonia-oxidizing bacterium which is the first step in nitrification. Nitrosovibrio converts ammonia into nitrite that is later converted into nitrate by the nitrite-oxidizing bacteria (Bock, 1989) in the nitrogen cycle. Several species of Nitrosovibrio are able to survive in oxygen limitation and even anoxia for periods of time (Kowalchuk, 1998). Since these sequences were found at depth in August, this may facilitate the survival of this species in the Central Basin during hypoxia. Only 1% of sequences was assigned to γ-proteobacteria and thus was underrepresented in the libraries. These less abundant groups often have high cellspecific activities (Bernard, 2000; Zubkov, 2001) and may indicate their low presence. This Gram-negative group contains facultative anaerobes and comprises the Pseudonomads, Azotobacter, and Acinetobacter. All sequences obtained came from depth for both July and August indicating their preference for anaerobic conditions, and may

39 30 indicate soils and sediments that may have stirred and resuspended into the lower water column during sampling. The aerobic Flexibacter-Cytophaga-Bacteroides group made up 6% of all sequences with 13 of these sequences found in July libraries. Due to the lack of sequences found during hypoxia may demonstrate the inability for this group to survive this oxygen limitation. Ppico sequences were obtained by PCR with universal primers from both July and August at 16 m depth. The influence of light, nutrients, and oxygen gradients may indicate their preference for the metalimnion over the hypolimnion. Thirteen percent of July sequences and 19% of August sequences were Ppico in nature, indicating a significant increase during seasonal hypoxia. It has been acknowledged from qpcr data taken from 2002 that there is indeed an increase of cyanobacteria during the dead zone formation (Wilhelm, in press). Furthermore, the lack of diversity of these sequences was evident with all July sequences clustering with Synechococcus sp. MH301, while August contained sequences from several different groups of Ppicos. Overall, it appears that there is indeed a dynamic community shift in Lake Erie during seasonal hypoxia. Nutrient data taken at this time indicate no significant difference of ammonia, nitrate, or total phosphorus concentrations between July and August (data not shown), indicating that the bacterial community shift may be explained by the presence or absence of oxygen. The Uncultured α-proteobacteria Cluster is much more pronounced, there is an increase in number and diversity of cyanobacteria (including the Ppicos), and there is a decrease in the aerobic Flexibacter-Cytophaga- Bacteroides group. It is accepted that community diversity shown in these libraries may

40 31 not exactly exhibit the natural community structure found in Lake Erie, but it presents the key members that play a role in the ecosystem. Ppico Libraries: This study was the first to characterize the Ppico community both during and prior to seasonal hypoxia. Using Ppico cluster designations presented by Crosbie et al., 2003 and Ernst et al., 2003, we are able to study the diversity of freshwater Ppicos in Lake Erie. Crosbie elucidated 6 distinct clusters of freshwater Ppicos, some cosmopolitan in nature and some specific for particular locations with lakes of similar physical properties and trophic status. The four libraries constructed in the present study demonstrate the increasing diversity of Ppicos in August compared to July. The July library was overwhelmed by clones similar to PE-rich Synechococcus sp. MH301, which was not unexpected due to the pink discoloration of the concentrated filter used to extract DNA. This species comprised a significant fraction of the total Ppicos in July, demonstrating its importance in the Lake Erie assemblage. Decreasing diversity was found among the Ppicos with depth. Other clusters present in the July libraries were Groups B, H, and A, but these groups were poorly represented in the library. It can be concluded that PE-rich isolates seem to be the prominent group in July. It has been noted that PE-rich isolates normally inhabit oligotrophic ecosystems (Ernst et al., 2003) making it somewhat surprising to find this type of cyanobacteria in Lake Erie due to the characteristic eutrophic status of Lake Erie. This may be attributed to more mesotrophic conditions in the Central Basin from regulated nutrient loadings and filtering of the water column from zebra and quagga mussels

41 32 In August, two new clusters not previously seen in the July libraries were revealed, in addition to a decline in the number of isolates similar to the Synechococcus sp. MH301. In August at 22 m, sequences clustering with Group E, which contain strains isolated from Lake Biwa, Japan were obtained. This group contains PC-rich strains isolated solely from these Japanese lakes indicating a group not normally cosmopolitan in nature. High bootstrap support for most of the clusters in the libraries was exhibited. In addition, other sequences clustered with Synechococcus sp. MH305 as described by Crosbie, et al. In August of 2004, PC-rich Synechococcus ARC-11 was able to be cultured from this station from a depth of 16 m, indicating members of this group have been present in the dead zone in previous years. It has been previously noted that marine-like strains of Ppicos have persisted in the dead zone in 2002 using primers specific for Prochlorococcus species (Zinser et al., 2006) and the Ribulose-1, 5-bisphosphate carboxylase-oxygenase (RuBisCO) large subunit gene (Wilhelm, in press). Isolation of these species has, to date, been unsuccessful. Furthermore, none of the sequences obtained in our 16S libraries were found to be marine-like in form. PCR and cloning biases suggested previously are likely the cause of this absence, and thus the presence of these marine-like forms cannot be ruled out. The major caveat for using the 106F primers was the fact that both cyanobacteria and plastid sequences were obtained. Our focus was on the Ppico community, so the plastid sequences were of no use for our analysis. Primers used by Crosbie et al. collected almost complete 16S rrna sequences strictly for cyanobacteria while the 106F primer product was only a fraction of the gene. Therefore, using these primers would

42 33 have eliminated the plastid sequences and provided more 16S information that would produce additional sequences of interest. Primers specific for the internal transcribed spacer (ITS) region has also been found as a useful tool to identify bacteria (Ernst et al., 2003; Gürtler & Stanisich, 1996). This region is less conserved than the 16S rrna gene, and is ultimately removed from the primary transcript after processing of rrna (Ernst et al., 2003). The goal of isolating the Ppicos was to be able to culture the major members found in the libraries. We have cultured 5 strains of Ppicos which have been isolated from Lake Erie in July and August, producing insight to the cultivability of these assemblages from environmental samples. Using low-nutrient BG-11 (containing onefifth of the original nutrients) has furthered evidence that this lower nutrient concentration increases the isolation success of certain cyanobacteria. The difficulty in isolating and maintaining PE-rich strains has been acknowledged (Ernst et al., 2003; Rippka et al., 2000), and this is furthered by the inability to culture the PE-rich isolate similar to Synechococcus sp. MH301. One PE-rich strain (ARC-2) was isolated from Lake Erie, but growth on agarose plates has yet to be determined. This isolate clusters within Group B which contains mostly freshwater PE-rich isolates obtained from Lakes Mondsee and Hallstättersee (Crosbie et al., 2003). All other PC-rich isolates are similar to clones found within the libraries, indicating the ability to culture major members of the Ppico community. cpeb Library: Phylogenetic analysis revealed two novel clusters of PE-rich cyanobacteria supported by high bootstrap support. After obtaining sequences of two other PE-rich

43 34 freshwater isolates Synechococcus rubescens and Synechococcus sp. BO8807, a third lineage from Lake Erie was found to cluster with this group with high bootstrap support. It is hypothesized that the large cluster of sequences obtained are from the Synechococcus sp. MH301-like isolates, but the sequencing of this gene has yet to be done with this strain. Most interestingly, one sequence from 16.3 m in August clustered with Synechococcus CC9605, which is found to group into Marine A Synechococcus clade II, a group with 96-99% identity and clusters with motile Marine A Synechococcus clade III. As previously noted, no marine-like strains were found in 16S libraries, but one sequence was found to come from oceanic origin. The ability to use a novel gene to study diversity in PE-rich cyanobacteria is shown through phylogenetic analysis with high bootstrap support, and so may yet provide another tool by which the fine structure of Ppico communities can be determined. Overall, this study has shown insight to some community members present in Lake Erie prior to and during seasonal hypoxia. The study has proven that there seems to be a possible shift in the microbial community. During hypoxia there is an increase in cyanobacterial sequences in addition to an increase of diversity. There also seems to be an α proteobacteria cluster found in August that is vastly reduced in July. Despite these differences, there lie some similarities in the libraries (i.e. the Actinobacteria Clusters) demonstrating that although the geochemistry of the water column has changed, the extent of it still supports a similar microbial community.

44 TABLES AND FIGURES 35

45 36 Table 1: The primers with corresponding sequences and amplicon lengths used in the study. Amplifying Type: Sequence 5-3 : Base Length: Reference: Eubacterial-Specific (46F) 46F: GCYTAACACATGCAAGTCGA 519R: TTATTACCGCGGCKGGTG 473 Bases Kaplan et al and Lane, 1991 Cyanobacterial/Plastid Specific (106F) 106F: CGGACGGGTGAGTAACGCGTGA 781R: GACTACATAGGGGTATCTAATCCCA TTT 675 Bases Nubel, 1997 cpebgene cpebf: CGTCACCGGCATGATCTGYGARAA YAC cpebr: CGCCCAGGGCGATGTANGTYTCYTT 148 Bases Bullerjahn and Wilhelm, unpublished `

46 37 Table 2: Characterization of clones using the Ribosomal Database Project (RDP) using the Project Classifier. An 80% confidence level against type strains in the RDP database was used to classify these sequences into proper class levels for both depths and months in Lake Erie. Class 16.5m July 20m July 16.3m Aug. 22m Aug. Total Flavobacteria α-proteobacteria β-proteobacteria γ-proteobacteria Actinobacteria Cyanobacteria Unclassified Bacteroidetes Unclassified Proteobacteria Unclassified Bacteria

47 38 Phylum Representative Clone Cyanobacteria 46F165m73 46F165m74 46F165m736 α Proteobacteria No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon 5 Synechococcus sp. MH301 46F163m851 1 Uncultured Prochlorococcus sp. clone JL-WNPG-T27 46F163m840 1 Synechococcus PCC F163m810 3 Synechococcus sp. 46F163m825 LBG2 46F163m847 46F163m89 1 Synechococcus sp. TAG 46F163m84 46F163m826 46F163m838 46F163m81 46F163m831 46F163M814 46F163M822 46F163m839 46F22M839 46F163m850 46F20m719 46F165m738 46F22M811 46F22M817 46F22M821 46F22M829 46F22M834 46F22M844 46F22M846 46F163M86 46F163M87 46F163M88 46F163M812 46F163M819 46F163m829 46F163m841 46F163m848 46F163m852 46F163m859 46F163m860 46F163m866 46F20m76 46F20m714 46F20m734 46F165m716 46F165m721 3 Synechococcus sp. MW73B4 3 Synechococcus sp. MW6B4 Synechococcus sp. MH305 GenBank Accession number % Identity AY % AY % AF % AF % AF % AY % AY % AY % 1 1 Snowella rosea 1LM40S01 AJ % 1 1 Sphingomonas sp. AY % HTCC uncultured alpha AF proteobacterium clone 100% CR_FL10

48 39 Phylum α Proteobacteria β Proteobacteria γ Proteobacteria Flexibacter- Cytophaga- Bacteroides Representative Clone No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon GenBank Accession number % Identity 46F20m729 1 Caulobacter sp. Tibet-DQ % S913 46F20m737 1 Rhodobacter sp. HTCC515 AY % 46F20m Uncultured alpha AY F165m76 proteobacterium clone LiUU % 46F22M851 1 uncultured alpha AY % proteobacterium clone SL38 46F22M845 1 uncultured alpha AF % proteobacterium clone SFD1-3 46F22M810 3 Nitrosovibrio sp. AY % 46F22M828 FJI423 46F22M823 2 uncultured beta AF % proteobacterium clone CRE-FL50 46F22M841 2 uncultured beta AY % 46F22M848 proteobacterium clone LiUU F163M uncultured beta AF F20M77 proteobacterium clone 100% CRE-FL37 46F163M uncultured beta AY % 46F20M722 proteobacterium clone PRD18F06 46F165m77 1 Uncultured beta AF % proteobacterium clone TLM05/TLMdgge10 46F165m727 1 uncultured beta AJ % proteobacterium clone B9-D12 46F22M824 2 Methylobacter AF % 46F22M847 psychrophilus 46F20m726 1 Uncultured gamma AY % proteobacterium clone LV60-A12 46F165m711 1 Uncultured Fibrobacteres bacterium clone LiUU AY % 46F163m83 1 uncultured AJ % Sphingobacteriales 46F20m79 46F20m721 2 Uncultured Flavobacteriales bacterium clone LiUU AY %

49 40 Phylum Flexibacter- Cytophaga- Bacteroidetes Firmicutes Representative Clone 46F20m730 46F165m725 46F165m732 46F20m739 46F165m713 46F165m714 46F165m730 No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon 2 1 Uncultured Flavobacteriales bacterium clone LiUU Uncultured Bacteroidetes bacterium clone PI_4g12e 2 Uncultured Bacteroidetes bacterium clone IRD18C04 46F165m718 1 Uncultured Cytophagales bacterium clone 15 46F165m719 1 Uncultured Bacteroidetes bacterium clone LiUU f22M815 46F163M823 46F20m725 46F20m731 46F20m732 46F20m735 46F165m71 46F165m78 46F165m79 46F165m723 46F165m733 Actinobacteria 46F22M83 46F163m842 46F163m843 46F163m853 46F163m uncultured firmicute clone CRE-FL47 GenBank Accession number % Identity AY % AY % AY % AF % AY % AF % 46F20m71 1 Uncultured firmicute AF % clone CR-PA uncultured DQ actinobacterium clone 100% TW F22M84 46F165m731 46F165m uncultured actinomycete clone CRO-FL9 AF %

50 41 Phylum Representative Clone Actinobacteria 46F22M82 46F22M86 46F22M812 46F22M813 46F22M816 46F22M822 46F22M825 46F22M830 46F22M833 46F22M835 46F22M836 46F22M842 46F22M843 46F22M854 46F163M820 46F163M821 46F163m827 46F163m828 46F163m862 46F20m715 46F20m741 No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon uncultured actinomycete clone SFD F22M87 1 uncultured actinomycetales bacterium clone B64 46F22M88 46F22M819 46F22M831 46F22M849 46F163M816 46F20m710 46F20m718 46F20m734 46F20m736 46F20m742 46F165m712 46F165m734 46F22M818 46F22M837 46F163M832 46F163M836 46F20M711 46F20M717 46F20M724 46F20M733 46F165M728 46F165M729 46F22M826 46F165M uncultured actinobacterium clone SL uncultured Crater Lake bacterium CL GenBank Accession number % Identity AF % AY % AY % AF % 1 1 uncultured DQ % actinobacterium clone ST5-1

51 42 Phylum Representative Clone Actinobacteria 46F22M827 46F165m717 Unclassified 46F22M838 46F22M853 46F22M840 46F163M815 46F22M855 46F163M821 46F163M85 46F163M817 46F163m837 46F163m846 46F163m848 46F163m863 46F20m72 46F165m722 46F165m726 No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon GenBank Accession number % Identity 1 1 uncultured AJ % actinobacterium clone S4 2 uncultured Crater AF % Lake bacterium CL uncultured AJ % actinobacterium clone N uncultured Crater AF % Lake bacterium CL F163m818 1 uncultured AJ % actinobacterium clone N5 46F163m Uncultured AY % 46F20m712 46F165m72 actinobacterium clone LiUU F163m865 1 Mycobacterium hodleri strain CIP AF % 46F20m73 46F20m716 46F20m720 46F20m740 46F165m715 3 Uncultured Crater Lake bacterium CL AF % 1 1 Uncultured AY % actinobacterium clone LiUU AF % 46F165m75 1 Uncultured actinomycete clone SFD F165m720 1 Uncultured Crater Lake bacterium CL F22M81 46F22M89 46F22M814 46F22M820 46F163m834 46F20m74 4 uncultured bact. gene clone S uncultured lake bacterium P F22M850 1 uncultured bacterium clone 253 AF % AB % AY % AJ %

52 43 Phylum Representative Clone No. of clones in library Closest Relative 16.5m J 20m J 16.3m A 22m A Taxon Unclassified 46F22M852 1 uncultured bacterium clone Sta F22M85 1 uncultured lake bacterium P38.20 GenBank Accession number % Identity AJ % AY % 46F163m811 46F163m824 2 uncultured bacterium clone RS.muc DQ % 46F163m830 46F163m854 46F163m856 46F163m857 46F163m867 5 uncultured bacterium clone:s9f-17 46F163m835 1 Uncultured bacterium clone LEDZ42 AB % DQ % 46F163m844 46F163m855 46F165m uncultured bacterium clone SII-26 46F163m861 1 Uncultured soil bacterium clone M05_Pitesti 46F163m864 1 Uncultured lake bacterium S F20m75 1 Uncultured lake bacterium P38.41 AJ % DQ % AY % AY % 46F20m78 1 Uncultured soil bacterium clone HSB OF22_C02RU 46F20m713 1 Uncultured bacterium clone RA13C9 46F20m727 1 Uncultured bacterium clone HTA2 46F20m728 1 Uncultured soil bacterium clone L1A.5A05 46F165m737 1 Uncultured bacterium clone JL-ECS-D54 46F165m739 1 Uncultured bacterium clone HTH4 DQ % AY % AF % AY % AY % AF % Table 3: 16S rdna sequences identified in Lake Erie prior to and during seasonal hypoxia as taken from the eubacterial libraries. Corresponding frequency numbers from each depth and month with the closest relative as taken from the GenBank database were analyzed with percent identity.

53 44 Table 4: Reference sequences used in phylogenetic trees as taken from the GenBank database. This list includes representatives from the major bacterial groups and corresponding accession numbers for each is given. Phyla Name Accession Number Cyanobacteria Snowella rosea 1LM40S01 AJ Cyanobacteria Synechococcus sp.mw6b4 AY Cyanobacteria Syechococcus sp.mw73b4 AY Cyanobacteria Syechococus sp.mh301 AY Cyanobacteria Synechococcus sp.tag AF Cyanobacteria Syechococcus sp.lbg2 AF Cyanobacteria Synechococcus sp.mh305 AY Cyanobacteria Synechococcus sp.7920 AF Cyanobacteria Synechococcus sp.ps723 AF Cyanobacteria Synechococcus PCC9005 AF Cyanobacteria Prochlorococcus sp. MIT9313 NC_ Cyanobacteria Prochlorococcus marinus subsp pastoris str CCMP1986 NC_ Cyanobacteria Synechococcus sp. BS5 AF Cyanobacteria Merismopedia tenuissima AJ BB46S01 Actinobacteria Streptomyces sp.id01-12c DQ Actinobacteria Uncultured Crater Lake bacterium AF CL Actinobacteria Streptomyces coelicolor AY Actinobacteria Mycobacterium tuberculosis DQ Actinobacteria Mycobacterium hodleri strain CIP AF Actinobacteria Kineosporia sp.im-1356 AF Actinobacteria Candidatus Microthrix calida DQ strain TNO2-4 α-proteobacteria Brevundimonas diminuta strain AJ LMG 2337 α-proteobacteria Bradyrhizobium japonicum AB strain:nk6 α-proteobacteria Sphingomonas sp.44/40 AY571829

54 45 Phyla Name Accession Number α-proteobacteria Rhodopseudomonas sp.tut3625 AB α-proteobacteria Sphingomonas agrestis strain DQ MP17 α-proteobacteria Caulobacter sp.tibet-s913 DQ α-proteobacteria Rhodobacter sp.htcc515 AY α-proteobacteria Anaplasma ovis AY α-proteobacteria Trojanella thessalonices AF α-proteobacteria Ixodes ricinus endosymbiont 1 AJ (IricES1) α-proteobacteria Alpha proteobacterium SKA48 AY β-proteobacteria Ramlibacter sp.htcc332 AY β-proteobacteria Beta proteobacterium HTCC541 AY β-proteobacteria Neisseria sp.j01 DQ β-proteobacteria Comamonadaceae bacterium BP- AY β-proteobacteria Rhodoferax ferrireducens DSM NC_ β-proteobacteria Methylotenera mobila strain DQ JLW8 β-proteobacteria Nitrosovibrio sp.fji423 AY γ-proteobacteria Vibrio vulnificus strain 1003BG- AY R γ-proteobacteria Acinetobacter sp.mub1 AY γ-proteobacteria Methylobacter psychrophilus AF γ-proteobacteria Escherichia coli K12 NC_ Flexibacter- Cytophaga- Bacteroides Flexibacter- Cytophyga- Bacteroides Flavobacteria Fibrobacteria Cytophaga sp. SA1 Cytophaga sp.dex80-37 Flavobacterium limicola strain:st-82 Uncultured Fibrobacteres bacterium clone LiUU AF AJ AB AY509504

55 46 Phyla Name Accession Number Fibrobacteria Uncultured Fibrobacteres bacterium clone LiUU AY Firmicutes Bacillus subtilis strain MA139 DQ Firicutes Firmicutes Clostridium lundense strain DSM Staphylococcus aureus subsp aureus Mu50 AY NC_ Unclassified LEDZ124 bacterium DQ Unclassified Antarctic bacterium R-7666 AJ Archaea Methanosarcina acetivorans M59137

56 47 Table 5: Table describing major species found in universal 16S libraries using BLAST search from samples collected in Lake Erie during Organism Taxonomic group Growth Comments Sphingomonas sp α-proteobacteria aerobic Often isolated from contaminated soils Able to use polycyclic aromatic hydrocarbons Caulobacter sp. α-proteobacteria aerobic oligotrophic environments prosthecate group Rhodobacter sp. α proteobacteria aerobic Purple bacteria capable of anoxygenic photosynthesis (AAP) by bchla Nitrosovirbio sp. β-proteobacteria chemoautotrophic ammonia-oxidizing bacterium Methylobacter sp. γ-proteobacteria facultative anaerobic Type I methanotroph Actinomyces sp. Mycobacterium sp. Firmicutes (high GC gram positive) Firmicutes * some species exhibit anaerobic growth facultative anaerobic* facultative anaerobic Pleomorphic rods/filaments can be grazerresistant Fast-growing Degrade polycyclic aromatic hydrocarbons (PAHs)

57 Figure 1: Taken from Bolsenga and Herdendorf, Estimated yearly hypoxia in Lake Erie Central Basin. 48

58 49 Ontario Pennsylvania Ohio Cleveland Figure 2: Map of select Lake Erie master stations. Sampling took place at Station 84 in July and August of 2005.

59 kb -2.0 kb -1.5 kb -1.0 kb -0.5 kb Figure 3: A 1.5% agarose gel visualizing all PCR products from August samples. Lanes 1 and 2 contain amplicons using 46F eubacterial primers, while lanes 3 and 4 are cyanobacterial-specific primers 106F. Lane 5 contains a 1Kb molecular weight ladder.