Prochlorococcus (a model marine microbe)
|
|
- Roberta Gibbs
- 6 years ago
- Views:
Transcription
1 chlorococcus (a model marine microbe) 0.5μm Features of a Model Organism for Microbial Oceanography Widespread Abundant Predictable Simple Culture collection Amenable to study in the field Genomic Database Genetic System chlorococcus Divinyl Chl a Divinyl Chl b chlorococcus: the minimal phototroph Discovered in 1985 karyotic Cyanobacterium Divinyl chlorophylls a and b Most abundant oxygenic phototroph 0.6 microns wavelength [nm] Light CO N,P,S,Fe, Co etc. (only inorganic compounds) 1700 genes LIFE (that dominates the oceans) Cascade of Scales chlorococcus Ranges of reported values: Percent of total chlorophyll 670% 558% 58% 67% 57% Record concentration: 700,000 cells ml 1 Global Abundance: 10 5 cells 5 Gt C yr 1 SeaWiFS ject, NASA 1
2 Unique properties of photosynthesis Photosynthetic apparatus comprised of Chl a, Chl b1, b and phycobiliproteins Photosynthesis occurs over orders of magnitude of light High photosynthetic yield Red shifted (~10nm) Chl a & b Higher probability of absorbing than scattering light due to small size Photosynthetic antenna architecture Laser Flow Cytometry Cells Forward light scatter detector Pigment fluorescence detector DNA per cell Chlorophyll (Red) Fluorescence Pennates Nano Ultra Syn Forward Angle Light Scatter (Size) K. Bares chlorococcus Biomass 10 8 cholorococcus and Synechococcus integrated abundance at BATS chlorococcus Cells mm Synechococcus Partensky et al Sep89 Sep90 Sep91 Sep9 Sep9 Sep9 DuRand et al 001 DSR 8:198
3 red fluorescence chlorococcus highlight/lowlight populations 5m 75m 15m red fluorescence red fluorescence forward scatter forward scatter forward scatter chlorococcus spp. strain diversity Photophysiological differences among high and low light ecotypes 5 psba (108bp) NJ MIT90 MIT91 MIT901 MIT91 MIT90 MIT911 High Light Low Light a* (m (mg Chl a) 1 ) g C g Chl a 1 hr Irradiance (μmol quanta m sec 1 ) Chl b / a (g/g) growth rate (d 1 ) Growth Irradiance (μmol quanta m sec 1 ) Wavelength (nm) Growth Irradiance (μmol quanta m sec 1 ) After Moore and Chisholm, 1999 chlorococcus spp. strain diversity of N utilization psba (108bp) NJ N utilization key: MIT90 NH MIT91 NH MIT901, NO MIT91 NH, NO, NO MIT90 MIT911 after Moore et al 00 Cells mm and Syn abundance in N. Atlantic (Integrated abundance) chlorococcus Synechococcus Sep89 Sep90 Sep91 Sep9 Sep9 Sep9 Winter Deep Mixing High NO Spring Bloom of Syn DuRand et al 001 DSR 8:198
4 Question chlorococcus genetic diversity clusters into clades What are the important other niche dimensions?.let the cells tell us MIT90 MIT91 MIT901 MIT91 MIT90 e e e e e MIT911 emit911 psba (108bp) NJ N1 o N5 o N8 o 0 0 Red Fls o C e 50 e e 50 depth (m) 100 e depth (m) 100 Total e1 1e 1e5 1e1 1e 1e5 1e1 1e 1e5 cells/ml cells/ml cells/ml after Johnson et al. 006 Integrated Total Abundance Clade Abundance cells/mm o C 1e7 1e6 1e5 1e 1e Σ chlorococcus e e e e emit911 o C S0 S0 EQ N0 N0 after Johnson et al. 006 after Johnson et al. 006
5 Question: What is the lower bound of Ecologically relevant Taxonomic Units (ETUs? Genomovars?) within a group of organisms? How many different ETUs exist at HOT? at BATS? in the oceans? chlorococcus genetic diversity psba (108bp) NJ MIT90 MIT91 MIT901 MIT91 MIT90 MIT911 chlorococcus genomics Genome Feature Length (bp) 1,657,990,10,87 GC content (%) tein Coding 88 8 tein coding genes with assigned function conserved hypothetical hypothetical Genes with orthologs: chlorococcus 15 chlorococcus 15 Synechococcus Genes without orthologue in: and 57 and 8 Transfer RNA 7 Ribosomal RNA operons 1 Other structures RNAs after Rocap et al. 00 Sequence alignment shows conservation, loss, gain, and extensive rearrangement (HL) Genome features reflect niche dimensions NH NO org P Temperature Upwelling Mixed Layer High Light Ecotype Alk phosphatase HLIP DNA Repair No nitrite reductase no nitrate reductase (LL) NO, PO Low Light Ecotype No Alk phosphatase Fewer HLIP LL adap.. Genes nitrite reductase no nitrate reductase 5
6 As we learn the function of more of the ecotype specific genes. Cell surface properties are likely important in selection (HL) (LL) 171 genes 5 genes 59 genes 15 genes 909 genes we will learn more about niche differentiation Analysis of genomes revealed many LPS insertions and deletions Comparison of Cultures with Fosmid from HOT reveals cell envelope insertions Gene Function lowaffinity P transporter out membrane porin highaddinity P i binding Gene Name pita,b phoe psts Syn uvrd cpeb cpea cpez mpex cpey cpet cpes ppec pucc xylb metk LL P i channel components Plimitationinducible porins phosphonate ABCtype transport psta,b,c som phnc,d,e LL phosphonate operon regulator phosphonate biodegradation phno phnfn,p Fosmid clone HF101F1 alkaline phosphatase 5 nucleotidase APaselike phoa usha deda exopolyphosphatase gppa Epimerases (cell envelope) Unknown function Potentially cell envelope Fosmid clone HF101D8 polyphosphate utilization (kinase) P i sensor kinase response regulator modulator of P i transduction potential transcriptional regulator P i starvationinducible ppk phor phob phou ptra phohlike Coleman et al. 006 P i starvationinducible psip1 after Moore et al. 005 Whole Genome Analysis: nitrogen utilization nira narb NO NO NH chlorococcus spp. strain diversity of N utilization nira Syn HY1 cysg ppk tet HY HY HY5 nira ppk moabhymoea moac CA tet cysg deletion G narbnapa HY1 cysg F deletion E moaa moba orfg urec B A D D A B urec E after Post et al. psba (108bp) NJ N utilization key: MIT90 NH MIT91 NH MIT901, NO MIT91 NH, NO, NO MIT90 MIT911 after Moore et al 00 6
7 What other environmental variables are important Cu More chlorococcus genomes Depth NH NO Light NO Temperature Upwelling Mixed Layer MIT90 MIT91 MIT901 MIT91 MIT90 MIT911 What genes are shared by all ecotypes in the chlorococcus cluster? Core of common genes How are the remaining genes distributed among ecotypes? Myoviridae chlorococcus Cyanophage Siphoviridae Podoviridae 100nm Sullivan et al 7
8 Cyanophage Genomes (JGI) Host Range Oxygenic Photosynthesis Core reaction Center teins Podovirus (6 kb) Host Specific HL D1 e D e NADPH Myovirus 1 (55 kb) different LL,, MIT911 PSII PSI Ferridoxin Myovirus (181 kb) different HL and LL,,, HLIP H O O Plastocyanin Sullivan et al 005 Photosynthetic Genes in Encoded Photosynthetic Genes = overlapping start / stop codons Podovirus = contiguous ORFs HLIP D1 Myovirus PC HLIPs Fd D1 1kb kb Myovirus HLIPs D1 D ~500 bp Cluster with chlorococcus Functional Widespread bable reciprocal evolutionary influence Other host genes 6.kb Lindell, Sullivan et al.8kb 8
Marine Ecology I: Phytoplankton and Primary production
Marine Ecology I: Phytoplankton and Primary production Osvaldo Ulloa University of Concepcion, Chile oulloa@profc.udec.cl From SOLAS Science Plan Phytoplankton, biogeochemistry and climate I Uptake (through
More informationPHOTOSYNTHESIS. The Details
PHOTOSYNTHESIS The Details Photosynthesis is divided into 2 sequential processes: 1. The Light Dependent Reactions (stages 1 & 2) 2. The Light Independent Reactions (stage 3) a.k.a. the Calvin Cycle THE
More informationVariable Fluorescence 4/13/10. Fluorescence HEAT
Fluorescence HEAT Variable Fluorescence 1 F Start with a pulse of weak light--this will cause weak (background) fluorescence and is called the probe flash 0 Time 1 Variable Fluorescence 1 F 0 Time Turn
More informationLESSON THREE Time, Temperature, Chlorophyll a Does sea surface temperature affect chlorophyll a concentrations?
STUDENT PAGES LESSON THREE A partnership between California Current Ecosystem Long Term Ecological Research (CCE LTER) and Ocean Institute (OI) Beth Simmons, Education and Outreach Coordinator, CCE LTER,
More informationACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC
SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ
More informationNext-generation Imaging Flow Cytometry
1 4/21/13 Next-generation Imaging Flow Cytometry New instruments, such as the Amnis system, combine flow cytometry with imaging you get the advantage of having a microscope-like image combined with lasers,
More informationProchlorococcus, a Marine Photosynthetic Prokaryote of Global Significance
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 1999, p. 106 127 Vol. 63, No. 1 1092-2172/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Prochlorococcus, a Marine
More informationEngineering & construction of a Bio-photo-generator
Engineering & construction of a Bio-photo-generator Roy I. Pinhassi 4, Gadi Schuster 1, Noam Adir 2 and Avner Rotchild 4 1. Faculty of Biology 2. Schulich Faculty of Chemistry 3. Department of Materials
More informationPatterns and Implications of Gene Gain and Loss in the Evolution of Prochlorococcus
Patterns and Implications of Gene Gain and Loss in the Evolution of Prochlorococcus Gregory C. Kettler 1,2[, Adam C. Martiny 2[, Katherine Huang 2, Jeremy Zucker 3, Maureen L. Coleman 2, Sebastien Rodrigue
More informationInfluence of light and temperature on Prochlorococcus ecotype distributions in the Atlantic Ocean
Limnol. Oceanogr., 52(5), 2007, 2205 2220 E 2007, by the American Society of Limnology and Oceanography, Inc. Influence of light and temperature on Prochlorococcus ecotype distributions in the Atlantic
More informationPhytoplankton Photosynthesis
Phytoplankton Photosynthesis RedOx Reactions Some more history Quantum Yields Photosynthetic Units Physical Structure The Z-Scheme The Calvin-Benson Cycle Measuring Photosynthesis ABSORBPTION SPECTRUM
More informationPhytoplankton Photosynthesis
Phytoplankton Photosynthesis RedOx Reactions Some more history Quantum Yields Photosynthetic Units Physical Structure The Z-Scheme The Calvin-Benson Cycle Measuring Photosynthesis Phytoplankton Zooplankton
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationPhotosynthesis is the main route by which that energy enters the biosphere of the Earth.
Chapter 5-Photosynthesis Photosynthesis is the main route by which that energy enters the biosphere of the Earth. To sustain and power life on Earth, the captured energy has to be released and used in
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationPhoto-Phosphorylation. Photosynthesis 11/29/10. Lehninger 5 th ed. Chapter 19
1 Photo-Phosphorylation Lehninger 5 th ed. Chapter 19 2 Photosynthesis The source of food, and therefore life on earth. It uses water to produce O 2. However E 0 of water is 0.816V (NADH s is -0.32V).
More informationHeterotrophs: Organisms that depend on an external source of organic compounds
Heterotrophs: Organisms that depend on an external source of organic compounds Autotrophs: Organisms capable of surviving on CO2 as their principle carbon source. 2 types: chemoautotrophs and photoautotrophs
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationNatural Fluorescence Calculations: Terminology and Units
APPLICATION NOTE: Natural Fluorescence Calculations: Terminology and Units The purpose of this document is to provide a ready reference for the equations, coefficients, and units used in the calculation
More informationSunday, August 25, 2013 PHOTOSYNTHESIS
PHOTOSYNTHESIS PREFACE The sun is the ultimate source of energy. The sun powers nearly all life forms. Photosynthesis converts solar energy into chemical energy. Photoautotrophs use solar energy to synthesize
More informationThe North Atlantic Bloom: Species composition and vertical fluxes
The North Atlantic Bloom: Species composition and vertical fluxes T. Rynearson Graduate School of Oceanography, University of Rhode Island North Atlantic-Arctic ecocsystems Develop a process-based understanding
More informationPhotosynthesis 1. Light Reactions and Photosynthetic Phosphorylation. Lecture 31. Key Concepts. Overview of photosynthesis and carbon fixation
Photosynthesis 1 Light Reactions and Photosynthetic Phosphorylation Lecture 31 Key Concepts Overview of photosynthesis and carbon fixation Chlorophyll molecules convert light energy to redox energy The
More informationPhotosynthesis 05/03/2012 INTRODUCTION: Summary Reaction for Photosynthesis: CO 2 : H 2 O: chlorophyll:
Photosynthesis INTRODUCTION: metabolic process occurring in green plants, algae, some protists and cyanobacteria Photosynthesis is an PROCESS (building organic molecules which store radiant energy as chemical
More informationUnveiling Prochlorococcus
Unveiling Prochlorococcus Unknown to us 25 years ago, this remarkable and abundant organism performs a sizable part of the planet s photosynthesis Sallie W. Chisholm Our task now is to resynthesize biology;
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationTitle Temporal Dynamics of Prochlorococcus Ecotypes in the Atlantic and Pacific Oceans
Title Temporal Dynamics of Prochlorococcus Ecotypes in the Atlantic and Pacific Oceans Authors Rex R. Malmstrom 1, Allison Coe 1, Gregory C. Kettler 1, Adam C. Martiny 1,2, Jorge Frias- Lopez 1,3, Erik
More informationMicroorganisms suitable for studying biomarkers within the atmosphere in a test tube project
Microorganisms suitable for studying biomarkers within the atmosphere in a test tube project Nicoletta La Rocca Photosynthesis and Algae Biotechnology Research Group Department of Biology AIMS Study the
More informationOutline - Photosynthesis
Outlin Photosynthesis Photosynthesis 1. An Overview of Photosynthesis & Respiration 2. Autotrophs and producers 3. Electromagnetic Spectrum & light energy 4. Chloroplasts: Structure and Function 5. Photosynthetic
More informationMark Heinnickel, Ph.D.
Increasing the photosynthetic rate of cyanobacteria by optimizing expression of heterologous oxygenases Mark Heinnickel, Ph.D. Senior Scientist, Matrix Genetics Algae Biomass Organization Annual Meeting
More informationTurbulence and the Spring Phytoplankton Bloom
Turbulence and the Spring Phytoplankton Bloom Raffaele Ferrari Earth, Atmospheric and Planetary Sciences, MIT Collaborators: Sophia Merrifield and John Taylor Toronto, February 2, 2012 Phytoplankton Bloom
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationA Plenitude of Ocean Life
May 2003 A Plenitude of Ocean Life A new census of the sea is revealing that microbial cells thrive in undreamed-of numbers. They form an essential part of the food web. By Edward F. DeLong The Polar Duke,
More informationPhotosynthesis Lecture 7 Fall Photosynthesis. Photosynthesis. The Chloroplast. Photosynthetic prokaryotes. The Chloroplast
Photosynthesis Lecture 7 Fall 2008 Photosynthesis Photosynthesis The process by which light energy from the sun is converted into chemical energy 1 Photosynthesis Inputs CO 2 Gas exchange occurs through
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationPHOTOSYNTHESIS. Light Reaction Calvin Cycle
PHOTOSYNTHESIS Light Reaction Calvin Cycle Photosynthesis Purpose: use energy from light to convert inorganic compounds into organic fuels that have stored potential energy in their carbon bonds Carbon
More informationUnveiling Prochlorococcus The Life and Times of the Ocean s Smallest Photosynthetic Cell
Microbes and Evolution: The World That Darwin Never Saw 23 Edited by R. Kolter and S. Maloy 2012 ASM Press, Washington, DC doi:10.1128/9781555818470.ch23 Unveiling Prochlorococcus The Life and Times of
More informationTransduction of Light Energy in Chloroplasts
Module 0210101: Molecular Biology and Biochemistry of the Cell Lecture 16 Transduction of Light Energy in Chloroplasts Dale Sanders 9 March 2009 Objectives By the end of the lecture you should understand
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationTemporal dynamics of Prochlorococcus ecotypes in the Atlantic and Pacific oceans
(2010) 4, 1252 1264 & 2010 International Society for Microbial Ecology All rights reserved 1751-7362/10 www.nature.com/ismej ORIGINAL ARTICLE Temporal dynamics of Prochlorococcus ecotypes in the Atlantic
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationContra Costa College Course Outline
Contra Costa College Course Outline Department & Number: BIOSC 110 Course Title: Introduction to Biological Science Pre-requisite: None Corequisite: None Advisory: None Entry Skill: None Lecture Hours:
More informationOcean sensors, the information explosion and biological oceanography
Supported by NSERC, ONR, NOPP, CFCAS Ocean sensors, the information explosion and biological oceanography John J. Cullen Dalhousie University University of Hawaiʼi June 28, 2008 20th century oceanography:
More informationChapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow
COLLEGE BIOLOGY PHYSICS Chapter 8 PHOTOSYNTHESIS Chapter # Chapter Title PowerPoint Image Slideshow Figure 8.0 Photosynthesis Figure 8.1 Earth s distribution of photosynthesis as seen via chlorophyll a
More informationLIGHT DEPENDENT & INDEPENDENT REACTIONS
LIGHT DEPENDENT & INDEPENDENT REACTIONS Photosynthesis is a two stage process Light dependent reactions o requires DIRECT light energy omakes energy carrier molecules that are used in the dark reaction
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More information1. Introduction. 1. Introduction. 1.1 Diatoms Diatoms in General
1. Introduction 1.1 Diatoms 1.1.1 Diatoms in General Diatoms belong to the division of the Bacillariophyceae within the phylum of Heterokontophyta. They are unicellular or chain forming algae that colonize
More informationChemical Oceanography Spring 2000 Final Exam (Use the back of the pages if necessary)(more than one answer may be correct.)
Ocean 421 Your Name Chemical Oceanography Spring 2000 Final Exam (Use the back of the pages if necessary)(more than one answer may be correct.) 1. Due to the water molecule's (H 2 O) great abundance in
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationSingle-cell genomics applied to the picobiliphytes using next-generation sequencing
Department of Ecology, Evolution and Natural Resources and Institute of Marine and Coastal Sciences Rutgers University, NJ 08901 Single-cell genomics applied to the picobiliphytes using next-generation
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationIn Vivo Monitoring of Blue-Green Algae Using Hydrolab Multi- Parameter Sondes
In Vivo Monitoring of Blue-Green Algae Using Hydrolab Multi- Parameter Sondes Patrick A. Sanders Hach Hydromet Hydrolab and OTT Products E-Mail: psanders@hach.com What are Blue Green Algae Widely thought
More informationPhotosynthesis Harness light energy and use it to move electrons through an electron transport chain. Electron carriers are arranged, in order of
Photosynthesis Harness light energy and use it to move electrons through an electron transport chain. Electron carriers are arranged, in order of increasing electro positivity within a membrane. Through
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationA. Structures of PS. Site of PS in plants: mostly in leaves in chloroplasts. Leaf cross section. Vein. Mesophyll CO 2 O 2. Stomata
PS Lecture Outline I. Introduction A. Structures B. Net Reaction II. Overview of PS A. Rxns in the chloroplast B. pigments III. Closer looks A. LD Rxns B. LI Rxns 1. non-cyclic e- flow 2. cyclic e- flow
More informationPhytoplankton. Zooplankton. Nutrients
Phytoplankton Zooplankton Nutrients Patterns of Productivity There is a large Spring Bloom in the North Atlantic (temperate latitudes remember the Gulf Stream!) What is a bloom? Analogy to terrestrial
More informationThe Minimal-Gene-Set -Kapil PHY498BIO, HW 3
The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000
More informationSupporting Information
Supporting Information Farrant et al. 1.173/pnas.1524865113 Prochlorococcus % % 8% % % 5% 4% 3% 2% 1% % A Assignment level: Phylum Genus SubCluster Clade Synechococcus % % 8% % % 5% 4% 3% 2% 1% % 1-26-125
More informationEBS 566/666 Lecture 8: (i) Energy flow, (ii) food webs
EBS 566/666 Lecture 8: (i) Energy flow, (ii) food webs Topics Light in the aquatic environment Energy transfer and food webs Algal bloom as seen from space (NASA) Feb 1, 2010 - EBS566/666 1 Requirements
More informationBoolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationProteorhodopsin phototrophy in the ocean
Nature 411, 786-789 (14 June 2001) doi:10.1038/35081051; Received 3 January 2001; Accepted 26 March 2001 Proteorhodopsin phototrophy in the ocean Oded Béjà, Elena N. Spudich, John L. Spudich, Marion Leclerc
More informationBimolecular processes
Bimolecular processes Electron transfer *A + B A + + B - *A + B A - + B + EA IP *EA *IP LUMO An excited state is a better oxidant and a better reductant than the ground state HOMO X X* Kinetic of electron
More informationPhotosynthesis Definition and Superficial Overview
Photosynthesis Photosynthesis Definition and Superficial Overview Photosynthesis is the process used by plants to convert light energy from the sun into chemical energy that can be later released to fuel
More informationPlants. Anatomy, Physiology & Photosynthesis
Plants Anatomy, Physiology & Photosynthesis Plant anatomy Aerial portion absorb light energy gas exchange of O 2, CO 2 & H 2 O stomata (holes) Structural support Terrestrial portion anchorage H 2 O absorption
More informationProkaryotes Vs. Eukaryotes
The Microbial World Prokaryotes Vs. Eukaryotes Mircrobes of the Ocean Primary Producers Are the organisms that produce bio-mass from inorganic compounds (autotrophs). -Photosynthetic autotrophs Phytoplankton
More informationWritten Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
More informationModule: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment
Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Introduction to Bioinformatics online course : IBT Jonathan Kayondo Learning Objectives Understand
More information4.1. Photosynthesis Light-Dependent Reactions
4.1 Photosynthesis Light-Dependent Reactions Photosynthesis Each year, Canada s boreal forest convert 12.5 million tonnes of carbon into energy-rich compounds for billions of organisms Photosynthesis
More informationLight reaction. Dark reaction
Photosynthesis Light reaction Dark reaction Electro-magnetic irradiance and sunlight CO 2 and O 2 fixation by Rubisco Oxygenic photosynthesis was established in Cyanobacteria Localisation of the
More informationCHLOROPLASTS, CALVIN CYCLE, PHOTOSYNTHETIC ELECTRON TRANSFER AND PHOTOPHOSPHORYLATION (based on Chapter 19 and 20 of Stryer )
CHLOROPLASTS, CALVIN CYCLE, PHOTOSYNTHETIC ELECTRON TRANSFER AND PHOTOPHOSPHORYLATION (based on Chapter 19 and 20 of Stryer ) Photosynthesis Photosynthesis Light driven transfer of electron across a membrane
More informationThe Growth and Activity of Genetically Diverse Prochlorococcus. Yajuan Lin. Marine Science and Conservation Duke University.
The Growth and Activity of Genetically Diverse Prochlorococcus by Yajuan Lin Marine Science and Conservation Duke University Date: Approved: Zackary Johnson, Supervisor Erik Zinser Dana Hunt Jennifer Wernegreen
More informationPhotosynthesis in Detail. 3/19/2014 Averett
Photosynthesis in Detail 1 In photosynthesis many chemical reactions, enzymes and ions work together in a precise order. Enzymes Biological catalyst Substance that initiates or speeds up the rate of a
More information1.9 Practice Problems
1.9 Practice Problems 1. Solution: B It s not only chlorophyll a but a combination of pigments. 2. Solution: D See at what wavelength rate of photosynthesis is the highest. 3. Solution: D It s a fact.
More informationPigment packaging effects in Thalassiosira pseudonana under light regulated steady-state growth
Pigment packaging effects in Thalassiosira pseudonana under light regulated steady-state growth B. Greg Mitchell, Niu Du, Elliot Weiss and Maria Vernet Scripps Institution of Oceanography, UCSD Acknowledgements:
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationFluorometry Project Chlorophyll Temperature Time Series
Fluorometry Project Ocean Institute + Scripps Institution of Oceanography Chlorophyll Temperature Time Series The California Current Long Term Ecological Research (CCE LTER) Phytoplankton Phytoplankton
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationA genomic insight into evolution and virulence of Corynebacterium diphtheriae
A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8
More informationLecture 9: Photosynthesis
Lecture 9: Photosynthesis I. Characteristics of Light A. Light is composed of particles that travel as waves 1. Comprises a small part of the electromagnetic spectrum B. Radiation varies in wavelength
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Describing & Modeling Patterns
More informationMicrobiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
More informationPhotosynthesis. Diffusion. Basic Properties of Molecules in Motion. Osmosis- passive transport of water across a membrane
The detailed structure of an animal cell s plasma membrane, in cross section Photosynthesis Basic Properties of Molecules in Motion Diffusion: the random movement of molecules from a region of high concentration
More informationWHAT ARE PHYTOPLANKTON?
WHAT ARE PHYTOPLANKTON? Richard Kirby IVONA CETINIĆ NASA GSFC / USRA @teuta PHYTOPLANKTON drifting plants, 1887 DINOFLAGELLATE DIATOM COCCOLITHOPHORE SILICOFLAGELLATE 2 Ljubesic & Bosak GREAT GENETIC DIVERSITY
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationName Lab Exercise 2 - Standard Curves Nitrate, Ammonia, Phosphorus, and Chlorophyll
Name Lab Exercise 2 - Standard Curves Nitrate, Ammonia, Phosphorus, and Chlorophyll For most analytical chemical procedures, we use "standard curves" to calibrate our measurements. For example, we want
More informationLecture Series 13 Photosynthesis: Energy from the Sun
Lecture Series 13 Photosynthesis: Energy from the Sun Photosynthesis: Energy from the Sun A. Identifying Photosynthetic Reactants and Products B. The Two Pathways of Photosynthesis: An Overview C. Properties
More informationGene annotation and functional analysis of a newly sequenced Synechococcus strain
Gene annotation and functional analysis of a newly sequenced Synechococcus strain Y. Li, N.N. Rao, Y. Yang, Y. Zhang and Y.N. Gu Center for Information in BioMedicine, School of Life Science and Technology,
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationThe light reactions convert solar energy to the chemical energy of ATP and NADPH
10.2 - The light reactions convert solar energy to the chemical energy of ATP and NADPH Chloroplasts are solar-powered chemical factories The conversion of light energy into chemical energy occurs in the
More informationTime-series observations in the Northern Indian Ocean V.V.S.S. Sarma National Institute of Oceanography Visakhapatnam, India
The Second GEOSS Asia-Pacific Symposium, Tokyo, 14-16 th April 28 Time-series observations in the Northern Indian Ocean V.V.S.S. Sarma National Institute of Oceanography Visakhapatnam, India Seasonal variations
More informationBig Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
More information