Key abiotic and biotic determinants of occurrence and toxicological imapct of cyanobacterial blooms in a lowland dam reservoir of Sulejów, Poland
|
|
- Edwin Holland
- 5 years ago
- Views:
Transcription
1 N FKBR E ARE AH RE GR E Białko reporterowe (lucyferaza) Designed by M. Łapińska Substancje stanowiące wzorce obcości Substancje o charakterze trwałych zanieczyszczeń środowiska Substancje wywołujące stres oksydacyjny Substancje zaburzające szlaki endokrynne Key abiotic and biotic determinants of occurrence and toxicological imapct of cyanobacterial blooms in a lowland dam reservoir of Sulejów, Poland Joanna Mankiewicz-Boczek
2 Study site Sulejów Reservoir Established in 1973 Max surface [m2] mln Average depth [m] 3.30 Volume [m3] 78.9 mln Average flow for multi-year period [m3/s] Average water retention time [day] N 42 Used for retention & recreation Serves as alternative source of drinking water for Łódź aglomeration (till 2004 as main source drinking water) cyanobacterial bloom near the dam, 2012 Fot. A. Skowron
3 Cyanobacterial studies from 1997 IDENTIFICATION of key abiotic (physico-chemical, hydrological) parametersaffecting the development of toxic cyanobacterial blooms METHODS ELABORATIONfor monitoring of toxic cyanobacteria (application of molecular methods for risk assessment and early warning system) OPTYMISATION of biological structureof Pilica river floodplain for selfpurification enhancement and REDUCTION of diffusive and point sources pollutionin the Pilica basin IDENTIFICATION of the impact of biotic parameters and interactions on the trail: cyanobacteria / cyanophages / bacteria / cyanoabcterial toxins / other organisms ESTIMATION OF BIOLOGICAL POTENTIAL of cyanobacteria and cyanotoxins (cellular biosensors for detection and evaluation of novel mechanisms of noxious bioactivity of cyanobacteria
4 Cyanobacterial monitoring Proposed integral procedure of microcystin-producing cyanobacteria monitoring for bathing water quality Spring/Summer Determination of physico-chemical parameters including nutrients concentration: P-PO 4, TP (>0.1 mg/l*), N-NO 3, N-NH 4, TN (>1.5 mg/l*) Chlorophyll a (> 10 µg/l**) Phytoplankton analysis Occurrence of Microcystis, Planktothrix, Anabaena Detection of toxigenic (potentially toxic) strains of cyanobacteria PCR amplification of mcy genes (polymerase chain reaction) Occurrence of microcystins Application of screening tests: determination of microcystins concentration ELISA (enzyme-linked immunosorbent assay) determination of microcystins toxicity PPIA (protein phosphatase inhibition assay) Confirmation of microcystins if ELISA showed > 2.5 µg/l Quantitative and qualitative analysis of microcystins HPLC (high performance liquid chromatography) Transdisciplinary interpretation of results Following the first and second principle of Ecohydrology, the identification of cause-effect relationship with comparative studies of the lake/reservoir typology, hydrochemistry, phytoplankton diversity and water toxicity are fundamental for developing a strategy to reverse eutrophication. (Zalewski 2000; Wagner et al. 2009) Mankiewicz-Boczek et al. in Chorus[ed.], 2012, Current approaches to Cyanotoxin risk assessment, risk management and regulations in different countries. Mankiewicz-Boczek in Zalewski M., Urbaniak M. [eds.] Adaptation of ecohydrological system solutions and biotechnologies for Africa. Note: * critical values for eutrophication recommended by OECD (1983); ** relatively low probability of adverse health effect recommended by WHO (2003)
5 Influence of environmental factors on toxigenic activity and cyanobacterial toxicity Designed by M. Łapińska Interaction between cyanobacteria toxic genotypes toxin production- reservoir hydrology conditions Average water retention time: 55 days 18 days 1 µg/l average microcystins concentration 1 µg/l average microcystins concentration 1% toxic Microcystis genotypes 70% toxic Microcystis genotypes Gągała et al., 2014, Microbial Ecology Project NSC 0964/B/P01/2010/39
6 Interaction CYANOBACTERIA / CYANOPHAGES Designed by M. Łapińska Detection of cyanophages (g91gene) capable of degrading cyanobacterial cells SpearmanRankOrder Correlation(p<0.05) Cyanophages (g91) 2010 (n=9) 2013 (n=10) Total Microcystis(16S rrna) Toxigenic Microcystis(mcyA) Phylogenetical analysis Cyanophage g91 BLAST homology analysis indicated 90% similarity to g91 gene described for cyanophage from the genera Myoviridae strain Ma-LMM01 14 ACCTAACCAGATTG 1 70 GCTGGAGTATTAGAGTTAMCAAG-AST-T--TCCTCTGTGCCCATCTCTAGCGGCGACCT ACATCAGCGTTCGTTTCGGCACTGTAGCCGGTGCAGCCCTCAWTATAGTAGAGGGTAATA 71 Study supported by the National Science Centre, project number UMO-2013/11/N/NZ8/00607
7 Interaction CYANOBACTERIA / OTHER BACTERIA Designed by M. Łapińska Detection of bacteria capable of degrading microcystins cyanobacterial hepatotoxins Microcystistoxigenic strains (mcya)/potential MCs degraders (mlra) [gene copy number per µl] mcya Microcystis (395 pz) [gene copy number/µl] mlra (120 bp) [gene copy number/µl] MCs [µg/l] MCs concentration [µg/l] Tresta Phylogenetical analysis Bacteria mlra BLAST homology analysis indicated 95% similarity to gene mlra described for bacteria from the genera Sphingopyxis sp. C1 andstenotrophomonas sp. 1 CTCCTCCCACAAATCAGGACGAGCCCAATGGCCACGGCGAATTCSACGAAATCCCAAGGG CGCCACCCGAGCCCTGCAACCGTTGGGGCCCACTCGGCAGTGACGTTTACGCCCAGTTCG TTATGGATCGCGTGAATGAGCACGCCACCCCACATCGATCCACCGAGCTTGTTGCATACG AAGACAGCGATGTTGGTGCCGGCAATGAACCCCGGAGCGATAACGAATTGCTTGACAATA ACGCCCCAGGCCGCGCCAGGATCGCCGGAGAACAGTGTCGGCAGGTCGCGCGGCAAATGC CAAGCCCACCACATTATGCCGAGGATCGCCGCTGCGGTCAGGGGGTCAAACTTCTTCAGG AGCTGCGGCAGCGCAGAGCCGCGCCAGCCCAGTTCTTCGAGCAGCGGGCCAGGGCTGAGT AGCAGCGATGCTGCCAGCCATCACATAAATGGCGA 455 Mankiewicz-Boczek et al. 2015; Open Life Sciences formerly Central European Journal of Biology Study supported by the National Science Centre, projects number 0964/B/P01/2010/39 and UMO 2012/07/N/NZ8/00599
8 Interaction CYANOBACTERIA / OTHER BACTERIA Designed by M. Łapińska Detection of bacteria capable of degrading microcystins cyanobacterial hepatotoxins Loss of microcystin-lr after one week [%] Kontrola Control- - woda destylowana withoutbacteria Mieszanina Mix 011 Mieszanina Mix 022 Mieszanina Mix 03 3 Mieszanina Mix 044 Mieszanina Mix 055 Mieszanina Mix 066 Mieszanina Mix 077 Mieszanina Mix 088 Mieszanina Mix 099 Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina Mix Mieszanina 30 Mix 30 Mieszanina 31 Mix 31 Mieszanina 32 Mix 32 Degradation efficiency 0.6 µg/ml/day BLAST homology analysis indicated 94% similarity to gene 16S rrna described for bacteria Aeromonas veroniiw-s AGCGGCGGACGGGTGAGTAATGCCTGGGGATCTGCCCAGTCGAGGGGGATAACTACTGGA AACGGTAGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGACCTTCGGGCCTTGCG CGATTGGATGAACCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGAC GATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACT CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGC CGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGTTGGT AGCTAATAACTGCCAGCTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCA GCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC GCAGGCGGTTGGATAAGTTAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTAA AACTGTCCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCG TAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAG GTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGAT GTCGATTTGGAGGCTGTGTCCTTGAGACGTGGCTTCCGGAGCTAACGCGTTAA-TCGACC GCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGC GGTGGAGCATGTGGTTTAATTCGATGCAACGCGAARAACCTTACCTGGCCTTGACATGTC TGGAATCCTGTAGAGATRCGGGAGTGCCTTCGGGAATCAGAACACAGGTGCTGCATGGCT 1022 phylogenetically identified colonies of bacteria, from which tested mixtures were created Mankiewicz-Boczek et al. 2015; Open Life Sciences formerly Central European Journal of Biology Study supported by the National Science Centre, projects number 0964/B/P01/2010/39 and UMO 2012/07/N/NZ8/00599
9 Designed by M. Łapińska ESTIMATION OF BIOLOGICAL POTENTIAL of cyanobacteria and cyanotoxins Biosensor activation (fold of control value) Biosensor activation (fold of control value) NFKBRE Hep3B, crude cyanobacterial extracts CME1 467 µg MC/ml CME2191 µg MC/ml CME321 µg MC/ml Concentration [ppm] NFKBRE Hep3B, purified toxin preparations PME1 268 µg MC/ml PME2 94 µg MC/ml PME3 18 µg MC/ml Concentration [ppm] Pilotestudy Comparisonof influence of purifiedand crude cyanobacterial extracts on pattern recognition receptor Conclusions: 1. The activity of NFKBRE Hep3B cell line was different for crude and purified cyanobacterial extracts. 2. Response of NFKBRE Hep3B cell line was similar despite different microcystins concentration in extracts (both in case of crude and purified extracts). 3. Crude cyanobacterial bloom extracts contained other than microcystins metabolites, which activated cellular biosensor NFKBREbased on Hep3B cell line. Study supported by the National Science Centre, project number UMO 2012/07/B/NZ8/03991
10 Designed by M. Łapińska Elaboration of system solutions Demonstration zone in Zarzęcin: reduction ofgroundwater POLLUTION WITH PHOSPHORUS COMPOUNDS, by strengthening the plant ecotone zone with geochemical barrier based on limestone. ( Phosphates concentration [mg/l] Z1 Z2 Z3 Z4 Z Critical level for occurence of cyanoabcterial blooms (fot. EKOROB) GEOCHEMICAL BARRIER
11 Increasing the efficiency of the buffer zone by incorporation of geochemical barrier Designed by M. Łapińska (fot. EKOROB) 14 reservoir groundwater level river Phosphates concentration in groundwater [mgpo 4 /l] przed befor barrier za after barrier low concentration of phosphates in groundwater (fot. EKOROB) high concentration of phosphates in groundwater Izydorczyk et al. 2013, Ecohydrology & Hydrobiology
12 European Regional Centre for Ecohydrology PAS Prof. dr hab. Joanna Mankiewicz-Boczek Dr Katarzyna Izydorczyk Dr Ilona Gągała Mgr Aleksandra Jaskulska Dep. of Applied Ecology, University of Lodz Prof. dr hab. Joanna Mankiewicz-Boczek Dr Tomasz Jurczak Institute of Medical Biology PAS, Łódź Prof. dr hab. Jarosław Dziadek Dr hab. Łukasz Pułaski Dr Dorota Jaros Dr Jakub Pawełczyk Mgr inż. Iwona Karwaciak Department of Hydrobiology, Faculty of Biology, Adam Mickiewicz University, Poznań Dr hab. Mikołaj Kokociński Dziękuję za uwagę! Thank you for your attention! Gracias por su atención!
Main cyanobacterial genera that produce cyanotoxins: Dolichospermum sp. Source: Public Health Authority of the Slovak Republic
The Application of the Chromatographic Methods for the Cyanotoxins Analysis Kurejová E., Nagyová V., Drastichová I., Chomová L., Perczelová E. CYANOBACTERIA Known as blue-green algae, are widely distributed,
More informationOptimization of Permanganate Pretreatment of Drinking Water to Reduce Microcystin Toxicity. A study to optimize pretreatment
Optimization of Permanganate Pretreatment of Drinking Water to Reduce Microcystin Toxicity A study to optimize pretreatment Pretreatment of water sources As water is drawn from surface sources it is often
More informationIn Vivo Monitoring of Blue-Green Algae Using Hydrolab Multi- Parameter Sondes
In Vivo Monitoring of Blue-Green Algae Using Hydrolab Multi- Parameter Sondes Patrick A. Sanders Hach Hydromet Hydrolab and OTT Products E-Mail: psanders@hach.com What are Blue Green Algae Widely thought
More informationThe only contamination levels for microbial contaminants in recreational and source waters are coliforms and the fecal bacteria E.
The only contamination levels for microbial contaminants in recreational and source waters are coliforms and the fecal bacteria E. coli and Enterococci sp. With the threats to public health caused by emerging
More informationBinding affinity and Toxicity of Microcystin congeners. Debmalya Bhattacharyya Ph.D. Biologist Analytical Services, NEORSD
Binding affinity and Toxicity of Microcystin congeners Debmalya Bhattacharyya Ph.D. Biologist Analytical Services, NEORSD OVERVIEW HABs, Microcystin- Structure, Metabolism and Toxicity Methods of Quantification-
More informationEcology 3/15/2017. Today. Autotrophs. Writing Assignment: What does it mean. Last readings on Chlamydomonas populations
Chlorophyll measured in this assay is an indicator of algae levels University College Campus Bayou Average Spring 2008 Fall 2008 0.07 0.12 0.10 0.04 Spring 2009 0.06 0.05 0.04 0.02 2009 0.05 0.07 0.12
More informationToxic Algae and Cyanobacteria in Recreational Waters. Rang Cho Miriam Moritz
Toxic Algae and Cyanobacteria in Recreational Waters Rang Cho Miriam Moritz Algae Large, diverse group of eukaryotic organisms Contain chlorophyll and/or other pigments green, brown or red colour Perform
More informationWater and Community: A Public Forum on HABs. Testing for Toxins Assessing Whether a Cyanobacterial Bloom is Harmful or Not
Stephen Penningroth Director, Community Science Institute September 30, 2017, The Space @ Greenstar, Ithaca, New York Water and Community: A Public Forum on HABs Testing for Toxins Assessing Whether a
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationUnderstanding Harmful Algal Blooms and their potential impacts Native American Communities
Tribal Lands and Environment Forum (TLEF) August 15-18, 2016 Mohegan Sun Resort Uncasville, Connecticut Understanding Harmful Algal Blooms and their potential impacts Native American Communities Barry
More informationMeasurement of "total" microcystins using the MMPB method, and application to HAB impacted surface waters
U.S. Environmental Projection Agency, ffice of Research and Development Measurement of "total" microcystins using the MMPB method, and application to HAB impacted surface waters Toby T. Sanan US Environmental
More informationInductive reasoning and prediction of population dynamics of Cylindrospermopsis in the Wivenhoe Reservoir by means of evolutionary computation
Inductive reasoning and prediction of population dynamics of Cylindrospermopsis in the Wivenhoe Reservoir by means of evolutionary computation Friedrich Recknagel 1, Philip Orr 2 and Hongqing Cao 1 1 School
More informationPerfect synthetic biology project
Perfect synthetic biology project Something beautiful! Idea Community project Present Evaluate Improve Final product Our problem: Algal Blooms Explosion in the growth of bluegreen algae (cyanobacteria)
More informationAmanda Murby University of New Hampshire. Cyanobacteria Monitoring and Analysis Workshop June 26, Cyanobacteria. Importance of Toxins and Size
Amanda Murby University of New Hampshire Cyanobacteria Monitoring and Analysis Workshop June 26, 2013 Cyanobacteria Importance of Toxins and Size Single-cells breaking off of the Microcystis? Aphanizomenon
More informationPerfect synthetic biology project
Perfect synthetic biology project Something beautiful! Idea Community project Present Evaluate Improve Final product Our problem: Algal Blooms Explosion in the growth of bluegreen algae (cyanobacteria)
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationCh20_Ecology, community & ecosystems
Community Ecology Populations of different species living in the same place NICHE The sum of all the different use of abiotic resources in the habitat by s given species what the organism does what is
More informationInteractions Between Microorganisms and Higher Plants from Competition to Symbiosis p. 184
Introduction What Are Soils? p. 3 Introduction p. 3 Soil Genesis p. 4 Rock Weathering or Decay p. 4 Importance of Soil Texture p. 5 Input of Organic Matter into Soils and Aggregation p. 7 Migration Processes
More informationSupporting Information for. High permeation rates in liposome systems explain rapid glyphosate biodegradation
1 2 3 Supporting Information for High permeation rates in liposome systems explain rapid glyphosate biodegradation associated with strong isotope fractionation 4 5 Benno N. Ehrl, Emmanuel O. Mogusu,, Kyoungtea
More informationEPA Region 3 Mid-Atlantic State s Algae Identification Workshop
EPA Region 3 Mid-Atlantic State s Algae Identification Workshop GORDON MIKE SELCKMANN INTERSTATE COMMISSION ON THE POTOMAC RIVER BASIN AUGUST 10, 2016 Today s objectives Gain knowledge and experience identifying
More informationSuccessional changes of algae as toxicity indices in an induced semi-natural crude oil/dispersant contaminated aquatic ecosystem
Available online at www.pelagiaresearchlibrary.com European Journal of Experimental Biology, 2013, 3(2):402-406 ISSN: 2248 9215 CODEN (USA): EJEBAU Successional changes of algae as toxicity indices in
More informationWhat cyanobacteria are not: What Cyanobacteria are: Cyanobacteria Diversity. Blue Green Algae or Cyanobacteria?
Ecology of Cyanobacteria in Lakes What cyanobacteria are not: NOT Infectious Pathogens NOT Invasive Species Jim Haney Center for Freshwater Biology University of New Hampshire What Cyanobacteria are: Integral
More information'Adaptation in natural populations: tools and mechanisms'
SFB 680 / 17. Seminar Day 'Adaptation in natural populations: tools and mechanisms' Tuesday, May 31, 2011 Luc De Meester Title: Life in a mosaic of stressors: an evolving metacommunity approach Ecological
More informationCommunities Structure and Dynamics
Communities Structure and Dynamics (Outline) 1. Community & niche. 2. Inter-specific interactions with examples. 3. The trophic structure of a community 4. Food chain: primary, secondary, tertiary, and
More informationSeasonal variation of phytoplankton and cyanobacteria composition and associated microcystins in six Portuguese freshwater reservoirs
Ann. Limnol. - Int. J. Lim. 2008, 44 (3), 189-196 Seasonal variation of phytoplankton and cyanobacteria composition and associated microcystins in six Portuguese freshwater reservoirs E. Valério 1,2*,
More informationGrowth Responses of Harmful Algal Species Microcystis (Cyanophyceae) under Various Environmental Conditions
Interdisciplinary Studies on Environmental Chemistry Environmental Research in Asia, Eds., Y. Obayashi, T. Isobe, A. Subramanian, S. Suzuki and S. Tanabe, pp. 269 275. by TERRAPUB, 29. Growth Responses
More informationLowndes County Biology II Pacing Guide Approximate
Lowndes County Biology II Pacing Guide 2009-2010 MS Frameworks Pacing Guide Worksheet Grade Level: Biology II Grading Period: 1 st 9 weeks Chapter/Unit Lesson Topic Objective Number 1 The Process of 1.
More informationCommunities Structure and Dynamics
Communities Structure and Dynamics (Outline) 1. Community & niche. 2. Inter-specific interactions with examples. 3. The trophic structure of a community 4. Food chain: primary, secondary, tertiary, and
More informationMarine Resources Development Foundation/MarineLab Grades: 9, 10, 11, 12 States: AP Biology Course Description Subjects: Science
Marine Resources Development Foundation/MarineLab Grades: 9, 10, 11, 12 States: AP Biology Course Description Subjects: Science Highlighted components are included in Tallahassee Museum s 2016 program
More informationProject: Deliverable: Title: Work package: Deadline: Nature: Dissemination level: Responsible contact person: Introduction
Project: BLUEPRINT Deliverable: 3.2 Title: New knowledge on gene expression in Baltic Sea cyanobacteria relative to growth under changing environmental conditions Work package: 3 Deadline: Month 35, Nature:
More informationOscillatoria sp. PCC 6407 fresh water, USA (1964) 1. Oscillatoria sp. PCC 6412 fresh water, USA (1964) 1
Table S1. Cyanobacterial strains and environmental samples used in the study. All numbered strains are maintained at the Helsinki University Cyanobacteria Culture Collection, all PCC strains are maintained
More informationMissouri Educator Gateway Assessments
Missouri Educator Gateway Assessments June 2014 Content Domain Range of Competencies Approximate Percentage of Test Score I. Science and Engineering Practices 0001 0003 21% II. Biochemistry and Cell Biology
More informationbelonging to the Genus Pantoea
Emerging diseases of maize and onion caused by bacteria belonging to the Genus Pantoea by Teresa Goszczynska Submitted in partial fulfilment of the requirements for the degree Philosophiae Doctoriae in
More informationProkaryotes Vs. Eukaryotes
The Microbial World Prokaryotes Vs. Eukaryotes Mircrobes of the Ocean Primary Producers Are the organisms that produce bio-mass from inorganic compounds (autotrophs). -Photosynthetic autotrophs Phytoplankton
More informationMarine Ecology I: Phytoplankton and Primary production
Marine Ecology I: Phytoplankton and Primary production Osvaldo Ulloa University of Concepcion, Chile oulloa@profc.udec.cl From SOLAS Science Plan Phytoplankton, biogeochemistry and climate I Uptake (through
More informationContents. List of Contributors. Acknowledgements. Section I Introduction 1
Contents List of Contributors Preface Acknowledgements xvii xxvi xxviii Section I Introduction 1 1 Introduction: Cyanobacteria, Cyanotoxins, Their Human Impact, and Risk Management 3 Geoffrey A. Codd,
More informationADVANCED ANALYTICAL LABORATORY
An Information Brochure on ADVANCED ANALYTICAL LABORATORY ANDHRA UNIVERSITY Visakhapatnam - 530 003 Andhra Pradesh, India Sponsored by DEPARTMENT OF SCIENCE & TECHNOLOGY Government of India New Delhi 110016
More informationI. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
More informationValley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
More informationMap of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationAquatic Chemistry (10 hrs)
Aquatic Chemistry (10 hrs) Water -The quality and quantity of water available to human have been vital factors in determining their well-being. -More then 70% of the earth is covered by water. Living cells
More informationFINAL VERSION_ Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea
Secondary Preservice Teacher Standards -- Life Science AFK12SE/NGSS Strand Disciplinary Core Idea LS1: From Molecules to Organisms: Structures and Processes LS1.A: Structure and Function How do the structures
More informationIntroduction to Biology
Introduction to Biology Course Description Introduction to Biology is an introductory course in the biological sciences. Topics included are biological macromolecules, cell biology and metabolism, DNA
More informationStudying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life
Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain
More informationTABLE OF CONTENTS CHAPTER NO. TITLE PAGE NO. LIST OF TABLES LIST OF FIGURES 1 INTRODUCTION AIM AND SCOPE OF THE PRESENT INVESTIGATION 7
viii TABLE OF CONTENTS ABSTRACT LIST OF TABLES LIST OF FIGURES iii xxiii xxviii 1 INTRODUCTION 1 1.1 AIM AND SCOPE OF THE PRESENT INVESTIGATION 7 2 LITERATURE REVIEW 8 2.1 AN OVERVIEW OF TEA 8 2.2 TEA
More informationEcology of Cyanobacteria. Lisa B. Cleckner, Director September 30, 2017
Ecology of Cyanobacteria Lisa B. Cleckner, Director cleckner@hws.edu September 30, 2017 Finger Lakes Institute @ HWS Research Education Outreach Economic Development Halfman 2016 http://www.fingerlakessustainablefarming.org/
More informationTEST SUMMARY AND FRAMEWORK TEST SUMMARY
Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills
More informationBasic Biology. Content Skills Learning Targets Assessment Resources & Technology
Teacher: Lynn Dahring Basic Biology August 2014 Basic Biology CEQ (tri 1) 1. What are the parts of the biological scientific process? 2. What are the essential molecules and elements in living organisms?
More informationPalmer Algal Posters to Cyanotoxins; changes in our knowledge of cyanobacteria (bluegreens)
Palmer Algal Posters to Cyanotoxins; changes in our knowledge of cyanobacteria (bluegreens) North Carolina Lake Management Society Spring Workshop 2016 Mark Vander Borgh, Linda Ehrlich and Astrid Schnetzer
More informationA pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan.
SUPPLEMENTARY INFORMATION A pentose bisphosphate pathway for nucleoside degradation in Archaea Riku Aono 1,, Takaaki Sato 1,, Tadayuki Imanaka, and Haruyuki Atomi 1, * 7 8 9 10 11 1 Department of Synthetic
More informationGuide for Students Departmentofbiology
Guide for Students Departmentofbiology Josip Juraj Strossmayer University of Osijek STEP into your FUTURE DEPARTMENT OFBIOLOGY Josip Juraj Strossmayer University of Osijek Ulica cara Hadrijana 8/a +385
More informationCyanobacteria species are distributed worldwide and extensive growth can result
FONDARIO GRUBBS, LAURA, M.S. Quantification of Select Cyanobacteria and Cyanotoxins in Piedmont North Carolina s using Real-Time PCR. (2014) Directed by Dr. Parke A. Rublee 70pp. Cyanobacteria species
More informationA A A A B B1
LEARNING OBJECTIVES FOR EACH BIG IDEA WITH ASSOCIATED SCIENCE PRACTICES AND ESSENTIAL KNOWLEDGE Learning Objectives will be the target for AP Biology exam questions Learning Objectives Sci Prac Es Knowl
More informationMicrocystin-LR ELISA Kit
Microcystin-LR ELISA Kit Catalog Number KA1496 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3 General
More informationShirley E. Clark, Ph.D., P.E., D. WRE Robert E. Pitt, Ph.D., P.E., BCEE, D. WRE
Shirley E. Clark, Ph.D., P.E., D. WRE Robert E. Pitt, Ph.D., P.E., BCEE, D. WRE Current PA Guidance Many guidance documents apply expected pollutant removals based on literature. However, typically presented
More informationEnvironmental Science and Technology
Environmental Science and Technology Are You Ready for the June Exam? THE MATERIAL WORLD Properties of solutions: Concentration I can determine the concentration of an aqueous solution (g/l, percentage,
More informationCurriculum Vitae of: Hendrik Johannes Niemann
Curriculum Vitae of: Hendrik Johannes Niemann Address: 20 Maine ave., Roodekrans, Roodepoort South Africa Tel: +27 84 711 2827 Email: hennieniemann92@gmail.com PROFILE A diligent student researcher currently
More informationNano-Ecotoxicology Assessment of Potential Effects of Engineered Nanomaterials in the Environment
Source: Armin Springer Source: Clemson University Nano-Ecotoxicology Assessment of Potential Effects of Engineered Nanomaterials in the Environment Dana Kühnel Department Bioanalytical Ecotoxicology Toxicology
More informationCommunities Structure and Dynamics
Communities Structure and Dynamics (Outline) 1. Community & niche. 2. Inter-specific interactions with examples. 3. The trophic structure of a community 4. Food chain: primary, secondary, tertiary, and
More informationField Identification of Algae
Field Identification of Algae H. Dail Laughinghouse IV, Ph.D. Asst. Professor of Applied Phycology Ft Lauderdale Research & Education Center University of Florida / IFAS hlaughinghouse@ufl.edu http://flrec.ifas.ufl.edu/faculty/h-dail-laughinghouse/
More informationVancouver Lake Biotic Assessment
Vancouver Lake Biotic Assessment Washington State University Vancouver Aquatic Ecology Laboratory Dr. Stephen M. Bollens Dr. Gretchen Rollwagen-Bollens Co-Directors Problem: Noxious cyanobacteria blooms
More informationTracers in the Hydrologic Cycle: A Jigsaw Activity Peter Lea Geology Department Bowdoin College
Tracers in the Hydrologic Cycle: A Jigsaw Activity Peter Lea Geology Department Bowdoin College plea@bowdoin.edu Background: Although most students have encountered the hydrologic or water cycle multiple
More informationBIOGEOCHEMICAL CYCLES
BIOGEOCHEMICAL CYCLES BASICS Biogeochemical Cycle: The complete path a chemical takes through the four major components, or reservoirs, of Earth s system (atmosphere, lithosphere, hydrosphere and biosphere)
More informationCOST Action FA1103: Endophytes in Biotechnology and Agriculture. WG1-4 Meeting on RISK ASSESSMENT OF ENDOPHYTES November 2014
COST Action FA1103: Endophytes in Biotechnology and Agriculture WG1-4 Meeting on RISK ASSESSMENT OF ENDOPHYTES 03-07 November 2014 University of Ege, Faculty of Agriculture, Department of Plant Protection,
More informationMetagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies
Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa,
More informationIdentify stages of plant life cycle Botany Oral/written pres, exams
DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce
More informationSeasonal Variation of Cyanobacteria in Relation to Physico-Chemical Parameters of Some Fresh Water Ecosystems in the Nigerian Guinea Savanna
Sengupta, M. and Dalwani, R. (Editors). 2008 Proceedings of Taal2007: The 12 th World Lake Conference: 1383-1387 Seasonal Variation of Cyanobacteria in Relation to Physico-Chemical Parameters of Some Fresh
More informationChetek-Weyerhaeuser High School
Chetek-Weyerhaeuser High School Unit 1 The Science of Biology (5 days) Biology I Units and s Biology I A s 1. I can design a scientific experiment that includes a control group, experimental group, constants,
More informationBiology Unit Overview and Pacing Guide
This document provides teachers with an overview of each unit in the Biology curriculum. The Curriculum Engine provides additional information including knowledge and performance learning targets, key
More informationPACING GUIDE ADVANCED PLACEMENT BIOLOGY
PACING GUIDE ADVANCED PLACEMENT BIOLOGY BIG IDEAS: 1: The process of evolution drives the diversity and unity of life. 2: Biological systems utilize free energy and molecular building blocks to grow, to
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationBiophysical Interactions
1 River Ecology Senior Geography Biophysical Interactions Checking the Pulse of the Hawkesbury River Name 2 River Ecology Senior Geography Senior Geography Outcomes PRELIMINARY COURSE OUTCOMES P2 describes
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationBacteria, Friends or Foes?
Bacteria, Friends or Foes? This unit integrates molecular biology techniques with the role of bacteria in our environment, specifically in the marine environment. The unit starts with introductory activities
More informationRange of Competencies
BIOLOGY Content Domain Range of Competencies l. Nature of Science 0001 0003 20% ll. Biochemistry and Cell Biology 0004 0005 13% lll. Genetics and Evolution 0006 0009 27% lv. Biological Unity and Diversity
More informationBIOL4. (JAN13BIOL401) WMP/Jan13/BIOL4. General Certificate of Education Advanced Level Examination January Unit 4 Populations and environment
Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initials General Certificate of Education Advanced Level Examination January 2013 Question 1 2 Mark
More informationSuccess Criteria Life on Earth - National 5
Success Criteria Life on Earth - National 5 Colour the box at the side of each objective: RED I don t know much about this or am confused by it. AMBER I know a bit about this but do not feel I know it
More informationToxic Cyanoprokaryotes in resource waters : monitoring of their occurrence and toxin detection
Toxic Cyanoprokaryotes in resource waters : monitoring of their occurrence and toxin detection Bouaïcha, N. 1, Via-Ordorika, L. 1, Vandevelde, T. 2, Fauchon, N. 2, Puiseux-Dao, S. 1 1 : CEMATMA, Cryptogamie,
More informationWest Windsor-Plainsboro Regional School District AP Biology Grades 11-12
West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels
More informationFish Passage Studies III: Sediment Redistribution and Impact Analysis: Springborn Dam - Enfield, Connecticut
University of Massachusetts Amherst ScholarWorks@UMass Amherst International Conference on Engineering and Ecohydrology for Fish Passage International Conference on Engineering and Ecohydrology for Fish
More informationProf. Dr. Biljana Škrbić, Jelena Živančev
5 th CEFSER Training Course Analysis of chemical contaminants in food and the environment Faculty of Technology, University of Novi Sad, Novi Sad, Republic of Serbia 7-11 May 2012 Analysis of heavy elements
More informationDSP Rapid Kit. DSP: Diarrhetic Shellfish Poisoning (A colorimetric phosphatase inhibition assay)
DSP Rapid Kit DSP: Diarrhetic Shellfish Poisoning (A colorimetric phosphatase inhibition assay) Distributed by SCETI K.K. http://www.sceti.co.jp/medical/english medical@sceti.co.jp Notice The PP2A Stock
More informationSIR MICHELANGELO REFALO CENTRE FOR FURTHER STUDIES VICTORIA GOZO
SIR MICHELANGELO REFALO CENTRE FOR FURTHER STUDIES VICTORIA GOZO Half-Yearly Exam 2013 Subject: BIOLOGY Level: INT 1 st Yr Time: 2hrs Name: Course: Year: SECTION A: Answer ALL questions in this section
More informationCOMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationCasein (Bovine) ELISA Kit
Casein (Bovine) ELISA Kit Catalog Number KA1955 96 assays Version: 01 Intended for research use only www.abnova.com Introduction and Background A. Test principle The principle of the double antibody sandwich
More informationThe EOC tests include both multiplechoice and constructed-response items.
The EOC tests include both multiplechoice and constructed-response items. The multiple choice will be administered in two, 45-minute sessions. Each section has 35-38 multiple-choice items. You will complete
More informationMicrocystin-LR ELISA Kit
Microcystin-LR ELISA Kit Catalog Number KA1496 96 assays Version: 10 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3 General
More informationBig Idea 1: Does the process of evolution drive the diversity and unit of life?
AP Biology Syllabus 2016-2017 Course Overview: AP Biology is equivalent to an introductory college level biology program in order to develop student led inquiry into science. The class is designed to go
More informationNadia Langha Biology 106 Honors Project
Nadia Langha Biology 106 Honors Project Cyanobacteria Domain Bacteria Division Cyanophyta Cyanobacteria also known as BlueGreen Algae -Cyano=blue Bacteria are more closely related to prokaryotic bacteria
More informationGeochemical study of arsenic release mechanisms in the Bengal Basin groundwater
Geochemical study of arsenic release mechanisms in the Bengal Basin groundwater Carolyn B. Dowling, Robert J. Poreda, Asish R. Basu, and Scott L. Peters Sampling Sixty-eight groundwater samples Bangladesh
More informationDemonstration of a TEQ Selective PCB Immunoassay
Demonstration of a TEQ Selective PCB Immunoassay Robert E. Carlson and Robert O. Harrison* ECOCHEM Research, Inc., MD 23, 1107 Hazeltine Blvd., Chaska MN 55318 * CAPE Technologies, L.L.C., 3 Adams St.,
More informationQSAR MODELS FOR PREDICTING TOXICITIES OF MICROCYSTINS IN CYANOBACTERIA USING GETAWAY DESCRIPTORS
QSAR MODELS FOR PREDICTING TOXICITIES OF MICROCYSTINS IN CYANOBACTERIA USING GETAWAY DESCRIPTORS 2 Alex A. Tardaguila, 2 Jennifer C. Sy, and 1 Eric R. Punzalan 1 Chemistry Department, De La Salle University,
More informationBiology Paper 1 1hr 15mins 70 marks
Biology Paper 1 1hr 15mins 70 marks Cell Biology (Yr9) Cell Organisation (Yr9) Infection and Response (Yr10) Bioenergetics (Yr10) Cells Cell Organisation Competition Photosynthesis Microscopy Enzymes Abiotic
More informationFlow Cytometric Analysis for Cyanobacteria in 36 New Jersey Freshwater Bodies
Seton Hall University erepository @ Seton Hall Seton Hall University Dissertations and Theses (ETDs) Seton Hall University Dissertations and Theses Spring 5-14-2016 Flow Cytometric Analysis for Cyanobacteria
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes
More informationThe digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand).
http://researchcommons.waikato.ac.nz/ Research Commons at the University of Waikato Copyright Statement: The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand). The thesis
More informationBinding of Polar Organic Contaminants at Water-Mineral Interfaces: Experimental and Computational Studies
Binding of Polar rganic ontaminants at Water-Mineral Interfaces: Experimental and omputational Studies Ludmilla Aristilde Assistant Professor ollege of Agricultural and Life Sciences Binding of Polar rganic
More information