Systematics - BIO 615

Transcription

1 ICZN UPDATE Several issues now confronting the zoological community make desirable the development of a 5th edition of the International Code of Zoological Nomenclature (Code). Prime among them are: 1) Electronic publication 2) Registration of names 3) Typification of newly discovered rare and endangered species Outline Dissemination WWW, e.g. Zookeys 3. Tools - Molecular data, species demarcation, phylogeography Prognosis Some numbers on the decline of alpha taxonomy Acarology : 41, : 9 (Taxacom, 3/01, #192) 71 museums - invertebrate curators 1980:364, 2001: 315 Authors of 6 + plant taxa : 44% deceased or emeritus Ann. Missouri Bot. Gard. 87: , % of curators of Diptera lost since mid-1970 s C. Thompson 3 4 Taxonomy old fashioned The Problem Loss of traditional skills The Problem Tower of Babel : each taxon has its own language (terminology) No single, on-line, depository of species names No accurate compilation of all described species 2,300 new beetle species named per year Taxonomic impediment or Bottleneck 5 6 1

2 Types" Catalogs " of types:" Nicrophorus - " Location " unknown" For types " of 67 of " 236 names." The Problem ZMHB: Berlin? Moscow, Leningrad, or Dresden? unknown; not ZMAS? (Gusarov in litt.) HNHM: Budapest? [not found] Moscow, Leningrad, or Dresden? NMPC: Praha? [not found] HNHM: Budapest? [not found] NMPC: Praha? [not found] ZMHB: Berlin? ZMHB: Berlin? ZMUC: Kobenhavn (Kiel?) Hamburg [destroyed?] MNHN: Paris? [not found]; not DEIC: Eberswalde [L. Zerche in litt.] MNHN: Paris? [not found] NMPC: Praha [not found; lost?] [lost?] unknown, not MZHF: Helsinki, lost? [Silfverberg in litt.] 7 - The toolbox of the alpha taxonomist grows with the advances of technology - Printing press, c.1450 AD - Microscope, c.1590 AD - Photography, color images, audio recordings - Scanning Electron Microscopy Phenotypic data 8 character: Heritable trait possessed by an organism e.g. Tail color character state: different conditions of a character e.g. Tail color blue e.g. Tail color red 9 Recall that alpha taxonomy seeks unique character states to diagnose taxa Is this population/species/genus unique? Is it diagnosable? How can one identify this species? What is different about it from all other species? Phylogenetics seeks shared character states to infer relationships among taxa 10 Phenotypic data management - morphology - behavior - pheromones - songs etc. Identification keys, guides - more & more online (e.g. lab web exercise) 11 Digitization of phenotypic data - Databases of biogeographic data - export material examined - Morphology: SEM, Auto-montage songs etc. - identification keys - multi-entry keys e.g. Scarab key 12 2

3 Important point - Modernization of traditional, alpha taxonomy is being done by taxonomists - many are becoming skilled web & database designers (the 1st 3 weeks of this course is part of the fix) In contrast - Molecular Biology is driven by many fields of research including the commercial sector Multi-entry keys offer many advantages over dichotomous keys Web Dissemination ZooKeys example Semantic Web: The Semantic Web is a collaborative movement led by the international standards body, the World Wide Web Consortium (W3C).[1] The standard promotes common data formats on the World Wide Web. By encouraging the inclusion of semantic content in web pages, the Semantic Web aims at converting the current web dominated by unstructured and semi-structured documents into a "web of data". According to the W3C, "The Semantic Web provides a common framework that allows data to be shared and reused across application, enterprise, and community boundaries Molecular data - PCR: Polymerase Chain Reaction DNA sequence data now the standard method to assess genetic characters (aka markers ) - Next - Gen sequencing PCR: - amplifies trace amounts of DNA by multiple cycles of heating (denaturation) and cooling (annealing) - new DNA is built with a heat stable enzyme (TAQ polymerase) PCR Requires Primers -short nucleotide sequences that match the template DNA - named TAQ after Thermus aquaticus - a heat loving bacterium

4 Mitochondrial genome - circular 13 protein coding genes 2 rrna genes 22 trna genes DNA Sequence data e.g. mtdna - COII gene N. americanus ATGATAACATGAAAAACACTTATATCACCAGATAGAGCTTCACCATTAATAGAACAATTAT! N. concolor ATGATAACATGAAAAACATTAATGTCTCCTGACAGTGCCTCTCCATTGATAGAACAACTTA! 61 base-pairs (nucleotides) - each site is a character 12 differences between these 2 species (19.7%) This is the uncorrected distance between these sequences N. americanus ATGATAACATGAAAAACACTTATATCA! N. concolor ATGATAACATGAAAAACATTAATGTCT! 61 base-pairs (nucleotides) - each site is a character Problems - some 1. Sample size issues - costly to obtain large sample sizes Each nucleotide is a character state Advantages - some: 1. All living organisms have DNA 2. Sequence is most basic level of biological information 3. We understand much about the processes of 2. Lack of information or too much information (+misinformation) [same problem for morphology] 3. Multiple substitutions at one site overwrite prior substitutions sequence evolution Species demarcation using DNA Wiens & Penkrot 2002 Haplotype: A set of closely linked alleles (genes or DNA polymorphisms) inherited as a unit. A contraction of the phrase "haploid genotype." Different combinations of polymorphisms are known as haplotypes. Flow chart from Wiens, J. J. & T. A. Penkrot (2002) Delimiting Species Using DNA and Morphological Variation and Discordant Species Limits in Spiny Lizards (Sceloporus). Systematic Biology 51:

5 Species demarcation Johnson et al Neglected taxonomy of rare desert fishes: Congruent evidence for two species of Leatherside chub. Systematic Biology 53(6): Identification of species is challenging because 1) differences of opinion on whether species are real 2) differences of opinion on what concept to use - Conservation biologists require reliable, unambiguous classifications - Legal protection of species - Used fish, Leatherside chub, - approached species question as a testable hypothesis 25 Species demarcation Johnson et al Neglected taxonomy of rare desert fishes: Congruent evidence for two species of Leatherside chub. Systematic Biology 53(6): Was classified as 1 species, Gila copei - Genetic data suggested there might be 2 species - Used data applicable to 3 different species concepts: - Phylogenetic - Phenotypic similarity - Ecological 26 Phylogeography Allopatric Ecology

6 Examined taxonomic boundaries with 3 species concepts: 1) phylogenetic - reciprocal monophyly & fixed diagnostic character states (mtdna & ndna) 2) Similarity - statistical differences in cranial shape 3) Ecology - local adaptation in growth & foraging rates Changed the classification - often not done in such studies (left for a taxonomist to do ) - Moved the Northern leatherside chub to another genus to make Lepidomeda copei - because the type specimen of copei is from the north Conclusion: there are 2 species 31 - The Southern leatherside chub would need a new name, however, there already exists a junior synonym for the southern population: L. aliciae (Jouy, 1881) 32 New tools in the taxonomist s toolbox: For phenotypic, traditional data - digitization - databases - web dissemination For molecular data - phylogeography & species demarcations - DNA sequence data 33 Terms - from lecture & readings Taxonomic impediment / bottleneck Phenotypic data Character Character state Molecular data Proteins, Isozymes Cytogenetics Karyotyping RFLPs PCR Primers TAQ polymerase Nucleotides Base-pairs Uncorrected sequence difference haplotype 34 You should be able to Describe the taxonomic impediment - what are some key problems? What are some solutions? Be able to list different aspects of the new digitized alpha taxonomy, e.g. web databases, on-line multi-access identification keys etc. (& what are some advantages of multi -entry keys) Be able to briefly describe how PCR works Be able to describe pros & cons of DNA data for alpha taxonomy (including DNA bar-coding). Describe what steps you think are best to identify a new species (data types, methods, etc). 35 6