Supporting Online Material for

Size: px

Start display at page:

Download "Supporting Online Material for"

Evangeline Hudson
5 years ago
Views:

www.sciencemag.org/cgi/content/full/science.

1 Supporting Online Material for Processive Movement of MreB-Associated Cell Wall Biosynthetic Complexes in Bacteria Julia Domínguez-Escobar, Arnaud Chastanet, Alvaro H. Crevenna, Vincent Fromion, Roland Wedlich-Söldner,* Rut Carballido-López* *To whom correspondence should be addressed. (R.W.-S.); (R.C.-L.) This PDF file includes: Materials and Methods Figs. S1 to S10 Tables S1 to S5 Captions for movies S1 to S7 References Published 2 June 2011 on Science Express DOI: /science Other Supporting Online Material for this manuscript includes the following: (available at Movies S1 to S7

2 Supporting Online Material 1. Materials and Methods General Methods. Methods for growth, transformation and selection of B. subtilis have been described extensively elsewhere (27). When required, 0.1% xylose and/or 20 mm MgSO 4 (final concentration) were added to growth media. Antibiotics were used at the following final concentrations: chloramphenicol, 5 µg/ml; kanamycin, 5 µg/ml; spectinomycin, 50 µg/ml; erythromycin, 1 µg/ml. DNA manipulations and cloning were carried out by standard methods. Gene disruptions were realized with PCRderived long flanking homology regions as previously described (28). Strains and Plasmids used are listed in Table S4. Oligonucleotides used are listed in Table S5. Plasmid construction. Vectors for generating fusion with the 3 terminus of mrfpruby. For this, the coding region of mrfpruby was PCR amplified from ptopo-mrfpruby (29) using primers RWS1640/RWS1641 and RWS1217/RWS1218, and PCR products were digested by PstI/SpeI and KpnI/BamHI, respectively. Resulting fragments were cloned into the corresponding sites of psg1151 (30) and psg1729 (30) respectively, replacing gfpmut1 and generating RWB2 and RWB3. GFP/mRFPruby N-terminal fusions. To generate GFP-MreB and mrfpruby-mreb fusions, the mreb open reading frame (orf) was PCR-amplified using primers RWS881/RWS996, restriction-digested with XhoI/HindIII and cloned into the corresponding sites of psg1729 and RWB3, generating RWB1 and RWB4, respectively. To generate GFP-Mbl and mrfpruby-mbl fusions, the mbl orf was PCR-amplified using primers RWS1527/RWS1528, digested with BamHI/EcoRI and cloned into the corresponding sites of psg1729 (30) and RWB3, generating RWB7 and RWB13, respectively. For GFP-MreBH, the mrebh orf was PCR- 1

3 amplified using primers RWS1529/RWS1530, digested with BamHI/EcoRI and cloned into the corresponding sites of psg1729 to generate plasmid RWB6. GFP/mRFPruby C-terminal fusions. A 640 base pair fragment corresponding to the 3 terminus of the mbl orf followed by a 60 bp linker was amplified from chromosomal DNA of strain 2521 (31) with primers RWS1642/RWS1051, digested and cloned into the XhoI and HindIII sites of RWB2 to generate plasmid RWB5. A 609 base pair fragment corresponding to the 3 terminus of the mrebh orf followed by a 60 bp linker was amplified with primers BH-6/BH-8 and cloned into the XhoI/EcoRI sites of plasmid psg1151 (30) to generate plasmid RWB14. Western Blot. Blots were performed as previously described (12). Primary (polyclonal anti-mreb, anti-mbl and anti-gfp) and secondary (anti-rabbit-hrp conjugate, Sigma) antibodies were added at 1:5,000 and 1:10,000 respectively, in PBS-T (0.1% Tween) plus 5% milk and incubated with gentle shaking over night at 4 C. Detection was performed with an ECL kit (Amersham). Cell wall drug treatments. For inhibition of cell wall biosynthesis, stock solutions were added to growing B. subtilis cultures to reach the following final concentrations: 700 μg/ml or 1-5 µg/ml phosphomycin, 100 μg/ml vancomycin and 2 mg/ml lysozyme min after addition of vancomycin and min after addition of phosphomycin cells were washed extensively with LB to observe recovery of MreB dynamics. Aliquots of non-treated cultures were grown as controls in parallel. Control cultures treated with antibiotics died after 2-3 hours. For disruption of cell wall integrity, 5 µl of a lysozyme stock solution was added to 100 µl B. subtilis cells (final concentration 100 μg/ml), incubated for 1-5 min and extensively washed with fresh LB medium. 2

4 Sample preparation for microscopy. For sample preparation, overnight pre-cultures of B. subtilis were grown in LB medium supplemented with 20 mm MgSO 4 (LB-Mg) and appropriate antibiotic selection, from freshly isolated colonies on plates. Day cultures were performed by diluting pre-culture to an OD 600 of in LB-Mg and grown at 30 C. Expression of fluorescent xylose-inducible fusions was induced by addition of xylose to 0.5% for MreB fusions, 0.3% for MreC/D fusions and 0.05% for PBP fusions. Escherichia coli strain FB72 was grown at 37 C in LB as described (32). Caulobacter crescentus strain LS3814 was grown at 30 C in PYE supplemented with 0.03% xylose for induction of the gfp-mreb fusion as described (33). Samples for microscopic observation were taken at mid-exponential phase (OD 600 of ) and immobilized on 1.2% agarose-coated microscope slides as described (34). To localize nascent PG synthesis in B. subtilis cells, vancomycin-fluorescein staining was added as previously described (5). Briefly, a mixture of equal amounts of vancomycin (Sigma) and a BODIPY-FL conjugated vancomycin (Van-FL, MolecularProbes) was added for 5 minutes to a final concentration of 1 µg/ml. Microscopy. All images were acquired on a custom TIRFM setup from Till Photonics based on a fully automated imic-stand with climate control chamber and an Olympus 1.45 NA 100x objective. DPSS lasers with output powers of 75 mw at 488 nm (Coherent Sapphire) and 75 mw at 561 nm (Cobolt Jive) were used as light sources. Lasers were selected through an AOTF and directed through a broadband fiber to the imic. A galvanometer- driven 2-axis scanner head was used to adjust TIRFM incidence angles or FRAP positions and an additional galvanometer was used to switch between epifluorescence, FRAP mode and TIRFM. Images were collected with an Andor ixon DU-897 EM CCD camera at maximum gain setting (300) attached to a 2x magnification lense. Acquisition was controlled by the Live Acquisition (Till Photonics) software package. For two-colour TIRFM experiments a double colour filter set was used. Incidence angles and z-position were adjusted 3

5 individually for both channels to obtain comparable evanescent wave penetration depth and focus position. Image acquisition and analysis. Time-lapse movies were taken on at least three different days for each strain. Unless stated otherwise exposure time was 100 ms and frame rate 2 s. Kymographs depict the temporal evolution of intensities along a defined line and int his manuscript time is always shown top to bottom (Time bar are all vertical). Directionally moving patches are represented as diagonal lines, static signals as vertical lines. Kymographs for speed analysis were obtained by drawing a line along the tracks visible in maximum projections. Lines were generated with 3 pixel width and average intensities used. Speeds were obtained by drawing lines along linear traces visible in kymographs and calculating the angle of these lines. Conversion into speed was performed in Microsoft Excel using the formula: speed = 1/TAN(RADIANS(angle))*0.085/2 (using 2 s frame rate and a pixel size of 85 nm). If not indicated otherwise box plots wee calculated from pooled speed values as the variability between individual measurements was larger than between cells. Averaging by cell showed no change of median values (Fig. S3 and Table S1). Angles of patch trajectories were obtained by calculating the difference between the trace angles and the angle of the respective cell long axis. All images were processed in Metamorph v7.1.2 (Molecular Devices) using local background subtraction (flatten background function) and Gaussian filtering (kernel 1-3-1; 3-7-3; 1-3-1). Kymographs, linescans, color overlay, morphometric analysis and image montages were performed with the respective functions in Metamorph. Images were rotated and zoomed (at 320%) for visualization purposes only. FRAP analysis. For live FRAP, a single spot (0.5 µm diameter) was bleached with reduced intensity (laser power 10%, 10 ms) so that only part of the patch intensity was bleached. A kymograph was then obtained along the movement of the patch and a 4

6 linescan along the kymograph trace was used to measure fluorescence recovery. In all FRAP movies five frames were imaged as reference prior to the FRAP event. For inverse FRAP (ifrap) a region was drawn around the cell with a small patch left out. While continuously acquiring images, timing of bleach events could be controlled from a module in LA software package and with the Live-FRAP control unit from Till photonics. All FRAP analyses were performed at least for 10 different cells and 20 different patches per condition/strain. ifrap was performed for 4 cells. Data presentation and statistical analysis. All speed and angle measurements are shown as box plots. Box edges indicate 25 th and 75 th percentiles, line indicates median, whiskers indicate 10 th and 90 th percentiles and individual points indicate outliers. Distributions were compared using unpaired t-tests with Welsh correction and p-values are given. All values with means, standard deviations (SD) and sample sizes are listed in Table S1-3. Box plots of speeds and angles were plotted with Matlab (2008b). 5

7 2. Supplementary Figures Figure S1. Expression levels of GFP fusions to MreB/Mbl/MreBH used in this study. (A-D) Western blot analysis comparing endogenous expression levels to expression from the xylose-inducible promoter. Blots were performed with polyclonal antibodies against GFP (A, D), Mbl (B) and MreB (C), respectively. Samples in (A) were prepared from cultures grown without or with 0.5% xylose as indicated. The bands shown correspond to the GFP-MreB/Mbl/MreBH fusions in strains 3723, 2523 and 2566J, respectively. The non-labelled band in (C) is an unspecific cross reactivity of the MreB antibody. (D) Expression of GFP fusions to MreBH from the endogenous (strain RWSB19) and the xylose-inducible (strain 2566J) promoters. 6

Figure S2. (A) 4D representation of a GFP-Mbl patch (strain RWSB10) observed by TIRFM. The position of highest intensity at each time point is marked with a red asterisk.

8 Figure S2. (A) 4D representation of a GFP-Mbl patch (strain RWSB10) observed by TIRFM. The position of highest intensity at each time point is marked with a red asterisk. Kymographs in false colours indicate the focus shift during patch movement across the cell. (B) Banded appearance of GFP-Mbl (strain 2523) in cells from a stationary phase culture. Shown are images taken by TIRFM and regular epifluorescence as well as their overlay and an LED image indicating the cell outlines. The arrow indicates an elongated band. (C) Epifluorescence and TIRFM images of MreB-RFP in E. coli strain FB72 and GFP-MreB in C. crescentus strain LS3814. A typical kymograph showing patch movement is depicted. (D) Selection of kymographs showing movement of GFP-MreB patches (strain 3723) along defined tracks and examples of patch reversal (arrowhead) and crossover (asterisk). Scale bars: 1 µm. Time bars: 30 s. 7

9 Figure S3. Patch speed distributions by cell. (A-C) Histograms of patch speeds for the indicated markers (strains 2523, 3723 and 2566J). (D-F) Speed values for patches in individual cells (plotted on y-axis). (G) Box plots of speed values from pooled measurement or by cell (all values in one cell were averaged and then the average for all cells calculated). 8

10 Figure S4. Effect of growth conditions on MreBs speeds. (A-B) Box plots of speed distributions of GFP-Mbl in Δmbl (strain 2523) grown at different temperatures (A) or with and without 10 mm magnesium (B). (C) Box plots of speed distributions of GFP fusions to the three MreB isoforms expressed as the sole copy or in the presence of the respective untagged endogenous protein (wt). 9

11 Figure S5. Intensity distributions and correlation curves for MreB isoforms. (A-C) examples of maximum projections, linescans and correlation functions for GFP- MreB (A, strain 3723), GFP-Mbl (B, strain 2523) and GFP-MreBH (C, strain 2566J) expressed as sole copy. ICF: Intensity correlation function. (D) Correlation curves for a cell shown at different frames of a time series. Note the high variability of autocorrelation peaks. 10

12 Figure S6. Speed distributions in colocalization strains. Box plots of speed values of individual GFP and RFP fusions co-expressed in the same cell. MreB/Mbl (strain RWSB18), PbpH/Mbl (strain RWSB57) and PbpH/MreB (strain RWSB70). G: GFP, R: RFP. 11

Figure S7. Diffusive movement of PBPs and LytE. (A) Maximum projections (upper row) and kymographs (lower row) of all vegetatively expressed PBPs and the autolysin LytE.

13 Figure S7. Diffusive movement of PBPs and LytE. (A) Maximum projections (upper row) and kymographs (lower row) of all vegetatively expressed PBPs and the autolysin LytE. HMW: high molecular weight, MW: molecular weight. (B) Kymographs showing partially diffusive behaviour (short traces or background signal) of MreD, PbpH, PBP2A and RodA. The three MreB isoforms and MreC, in contrast, exclusively show directional movement. Scale bars: 1 µm. Time bars: 30 s. 12

Figure S8. FRAP after cell wall perturbation with phosphomycin. (A-C). FRAP of GFP-MreB (strain RWSB1) or GFP-Mbl (strain 2523) after treatment with 700 µg/ml phosphomycin.

14 Figure S8. FRAP after cell wall perturbation with phosphomycin. (A-C). FRAP of GFP-MreB (strain RWSB1) or GFP-Mbl (strain 2523) after treatment with 700 µg/ml phosphomycin. Images were taken by TIRFM (A, B) or epifluorescence (C). (D, E) TIRF-FRAP of GFP-MreB (D) and GFP-Mbl (E) after treatment with 5 µg/ml phosphomycin. No recovery was seen in immobilized (A-C) or slow moving (D-E) patches. Kymographs were taken along the indicated red dotted lines. Time points in (A) and (C) in s. Scale bars: 1 µm. Time bars: 30s. 13

15 Figure S9. Effects of cell wall perturbations. (A, B) Box plots for trace angles of GFP-MreB (strain 3723) and GFP-Mbl (strain 2523) patches with and without phosphomycin treatment (A) and after deletion of either pbph or pbpa (B). (C) Growth curves of indicated strains. 14

16 Figure S10. Effects of individual or combined gene deletions on motility of patch markers. (A-E) Box plots for patch speed distributions of GFP-MreB (A), GFP-Mbl (B), GFP-MreBH (C), GFP-PBPH (D) and RodA-GFP (E). Deletions are indicated in colour. 15

17 3. Supplementary Tables Table S1. Patch speeds By trace* By cell* Strain Mean Mean (nm/s) SD N (nm/s) SD N GFP Mbl ΔmreB Δmbl GFP Mbl ΔmreB GFP Mbl Δmbl GFP Mbl wt GFP Mbl ΔpbpH GFP Mbl ΔmreBH GFP Mbl Δmbl ΔmreBH GFP Mbl ΔpbpA Mbl RFP GFP MreB RFP Mbl GFP PbpH GFP MreB ΔmreBH GFP MreB ΔmreB ΔmreBH GFP MreB wt GFP MreB Δmbl GFP MreB ΔmreB GFP MreB ΔpbpA GFP MreB ΔpbpH GFP MreB MblRFP RFP MreB GFP PbpH GFP MreBH ΔmreBH ΔmreB GFP MreBH ΔmreBH GFP MreBH Δmbl ΔmreBH GFP MreBH wt GFP MreBH Δmbl GFP MreBH ΔmreB GFP PbpH wt GFP PbpH ΔmreB GFP PbpH ΔpbpA GFP PbpH Δmbl GFP PbpH RFP MreB GFP PbpH RFP Mbl GFP Pbp2a ΔpbpH GFP MreC GFP MreD RodA GFP RodA GFP ΔmreB RodA GFP Δmbl RodA GFP ΔpbpH GFP Mbl Δmbl + lysozyme GFP MreB ΔmreB + lysozyme GFP Mbl Δmbl w/o Mg GFP Mbl Δmbl 23 C GFP Mbl Δmbl 30 C GFP Mbl Δmbl 37 C GFP MreB + low phosphomycin GFP Mbl + low phosphomycin Van FL *: Mean and SD determined for all speeds together or on average speeds for individual cells 16

18 Table S2. Trace angles Strain Mean (degrees*) SD N GFP MreB ΔmreB GFP Mbl Δmbl GFP Mbl Δmbl ΔmreB GFP Mbl Δmbl ΔmreBH GFP MreBH ΔmreBH GFP PbpH wt GFP PBP2a ΔpbpH GFP MreC GFP MreD RodA GFP Van FL GFP Mbl ΔpbpH GFP Mbl ΔpbpA GFP Mbl ΔmreB GFP PbpH ΔmreB GFP MreBH ΔmreB GFP MreB ΔpbpA GFP MreB ΔpbpH GFP Mbl + low phosphomycin GFP MreB + low phosphomycin *: Angle of trace in maximum projection relative to long axis of cell Table S3. Colocalization Strain colocalization green red N GFP PbpH / RFP MreB 78.5* GFP PbpH / RFP Mbl RodA GFP / RFP MreB RodA GFP / RFP Mbl GFP MreB / Mbl RFP MreBH GFP / RFP MreB GFP MreBH / Mbl RFP GFP Mbl / Mbl RFP Mbl GFP / RFP Mbl *: all values in % 17

19 Table S4. Strains and plasmids Name Genotype * Construction, reference Bacillus subtilis strains 168 trpc2 Laboratory stock 4261 mbl::cat (35) 2535 mrebh::cat (12) RWSB17 mbl::erm This study 2505 mbl::spc (31) 2504J mbl::spc This study mreb::kan (36) 2523 amye::(p xyl gfp-mbl spc) mbl Ω(pMUTIN4 erm) (20) 3723 amye::(p xyl gfp-mreb spc) mreb::kan (36) 2566J amye::(p xyl gfp-mrebh spc) mrebh::cat (12) 4736 roda Ω(rodA-gfp cat) L. J. Wu, unpublished ABS1506 pbpa Ω(P xyl gfp-pbpa cat) This study DP pbph Ω(P xyl gfp-pbph cat) (16) DP147 pbpa Ω(P xyl gfp-pbpa cat) pbph::spc R. A. Daniel, unpublished DP146 pbph Ω(P xyl gfp-pbph cat) pbpa::cat::spc R. A. Daniel, unpublished XI2465 pbpa::cat::spc (16) DPVB133 pbph::spc (17) RCL143 pbpa::cat::spc::erm This study pqp1 XI2465 RCL145 pbph::spc::erm This study pqp1 DPVB133 RCL147 pbph Ω(P xyl gfp-pbph cat) mreb::kan This study ABS1515 pbpa Ω(P xyl gfp-pbpa cat) mreb::kan This study 3725 ABS1506 ABS1500 pbph Ω(P xyl gfp-pbph cat) mbl::spc This study 2504J 3140 ABS1518 pbph Ω(P xyl gfp-pbpa cat) mbl::spc This study 2504J ABS pbpc Ω(P xyl gfp-pbpc cat) (16) 2083 pona Ω(P xyl gfp-pona cat) (16) 2082 pbpd Ω(P xyl gfp-pbpd cat) (16) 2084 pbpf Ω(P xyl gfp-pbpf cat) (16) 2521 mblω (mbl-gfp cat) (31) 3104 dacc Ω(P xyl gfp-dacc cat) (16) 3122 pbpb Ω(P xyl gfp-pbpb cat) (16) 2081 pbpi Ω(P xyl gfp-pbpi cat) (16) 2085 daca Ω(P xyl gfp-daca cat) (16) 18

20 3107 pbpx Ω(P xyl gfp-pbpx cat) (16) 3416 mrec Ω(P xyl gfp-mrec cat) (37) 3417 mred Ω(P xyl gfp-mred cat) (37) 2585J amye::(p xyl lyte-gfp spc) (12) RWSB1 amye::(p xyl gfp-mreb spc) This study RWB1 168 RWSB6 amye::(p xyl gfp-mreb spc) mbl::cat This study RWB RWSB44 amye::(p xyl gfp-mreb spc) mrebh::cat This study RWB RWSB45 amye::(p xyl gfp-mreb spc) mreb::kan mrebh::cat This study RWSB5 amye::(p xyl mrfpruby-mreb spc) This study RWB4 168 RWSB55 amye::(p xyl mrfpruby-mbl spc) This study RWB RWSB54 mbl Ω(mbl-mrfpruby cat) amye::(p xyl gfp-mbl spc) This study RWB5 RWSB41 ABS1527 amye::(p xyl mrfpruby-mreb spc) pbpa Ω(P xyl gfp-pbpa cat) This study RWSB5 RCL1506 RWSB70 amye::(p xyl mrfpruby-mreb spc) pbph Ω(P xyl gfp-pbph cat) This study RWSB ABS1533 amye::(p xyl mrfpruby-mreb spc) pbph::spc::erm This study RCL145 RWSB5 RWSB73 amye::(p xyl mrfpruby-mreb spc) pbpa Ω(P spac gfp-pbpa cat) pbph::spc::erm This study psg5073 ABS1533 ABS1509 amye::(p xyl gfp-mreb spc) pbpa::cat::spc::erm This study RCL143 RWSB1 ABS1512 amye::(p xyl gfp-mreb spc) pbph::spc::erm This study RCL145 RWSB1 RWB62 amye::(p xyl -mrfpruby-mreb spc) roda Ω(rodA-gfp cat) This study RWB RWSB41 amye::(p xyl gfp-mbl spc) This study RWB7 168 RWSB13 amye::(p xyl gfp-mbl spc) mrebh::cat This study RWB RWSB8 amye::(p xyl gfp-mbl spc) mreb::kan This study RWB RWSB57 amye::(p xyl mrfpruby-mbl spc) pbph Ω(P xyl gfp-pbph cat) This study RWB RWSB61 amye::(p xyl mrfpruby-mbl spc) roda Ω(rodA-gfp cat) This study RWB RWSB12 amye::(p xyl gfp-mbl spc) mbl ΩpMUTIN4-erm mrebh::cat This study RWSB10 amye::(p xyl gfp-mbl spc) mbl ΩpMUTIN4-erm mreb::kan This study ABS1521 amye::(p xyl gfp-mbl spc) pbpa::cat::spc::erm This study RWSB41 RCL143 RWSB67 amye::(p xyl gfp-mbl spc) pbph::spc::erm This study RWSB41 RCL145 RWSB42 amye::(p xyl -gfp-mrebh spc) This study RWB6 168 RWSB43 amye::(p xyl -gfp-mrebh spc) mbl::cat This study RWB RWSB46 amye::(p xyl gfp-mrebh spc) mrebh::cat mbl::cat This study 2535 RWSB43 RWSB7 amye::(p xyl -gfp-mrebh spc) mreb::kan This study RWB RWSB11 amye::(p xyl gfp-mrebh spc) mrebh::cat mreb::kan This study 2535 RWSB7 RWSB16 mbl Ω(mbl-mrfpruby cat) This study RWB5 168 RWSB19 mrebh Ω(mreBH-gfp cat) This study RWB RWSB18 mbl Ω(mbl-mrfpruby cat) amye::(p xyl gfp-mreb spc) This study RWSB16 RWB1 RWSB21 mrebh Ω(mreBH-gfp cat) amye::(p xyl mrfpruby-mreb spc) This study RWB19 RWB4 19

21 RWSB206 roda Ω(rodA-gfp cat) mreb::kan This study RWSB208 roda Ω(rodA-gfp cat) mbl::erm This study 4736 RWSB17 RWSB186 amye::(p xyl mrfpruby-mbl spc) mbl Ω(mbl-gfp cat) This study RWSB RWSB218 roda Ω(rodA-gfp cat) pbph::spc This study 4736 DPVB133 Escherichia coli strains FB72 DY329, mreb -rfp- mreb (32) Caulobacter crescentus strains LS3814 xylωp xyl gfp-mreb neo (33) Plasmids psg1151 psg1729 RWB2 RWB3 plasmid with a cat a resistance cassette, allowing Campbell insertion of a gene at its native locus in translational fusion with the 5 terminus of gfpmut1 plasmid with a spc a resistance cassette, allowing integration at the amye locus, of a gene in translational fusion with the 3 terminus of gfpmut1, under the control of the xylose-inducible promoter P xyl psg1151 derivative where gfpmut1 is replaced by mrfpruby psg1729 derivative where gfpmut1 is replaced by mrfpruby (30) (30) This study This study RWB1 psg1729 derivative carrying a gfp-mreb fusion This study RWB6 psg1729 derivative carrying a gfp-mrebh fusion This study RWB7 psg1729 derivative carrying a gfp-mbl fusion This study RWB4 RWB3 derivative carrying a mrfpruby-mreb fusion This study RWB13 RWB3 derivative carrying a mrfpruby-mbl fusion This study RWB5 RWB2 derivative carrying a mbl-mrfpruby fusion This study RWB14 psg1151 derivative carrying a mrebh-gfp fusion This study RWC316 ptopo-mrfpruby Laboratory stock pqp1 plasmid allowing allelic exchange of spc with erm Laboratory stock psg5073 plasmid with gfp in in-frame fusion with 804 first bp of pbpa under the IPTG inducible P spac promoter, allowing Campbell-type integration at the pbpa locus *. Resistance gene abbreviations: kan, kanamycin; spc, spectinomycin; cat, chloramphenicol; erm, erythromycin. Other abbreviations:, deletion; Ω, insertion. X Z depicts construction procedure, where X could be plasmid or chromosomal DNA and Z is the recipient strain transformed by X. (16) 20

22 Table S5. Primers used in this study Primer RWS1217 RWS1218 RWS881 RWS996 RWS1640 RWS1641 RWS1527 RWS1528 RWS1529 RWS1530 RWS1642 RWS1051 MreBH-6 MreBH-8 MreBH-P 1 MreBH-P 2 MreBH-P 3 MreBH-P 4 MreBH-P 5 Mbl-P 1 Mbl-P 2 Mbl-P 3 Mbl-P 4 RWS1166 Sequence 5 3 GGTACCCTGCAGATGGGCAAGCT GGATCCGAGCGCCTGTGCTAT CTCGAGATGTTTGGAATTGGTGCTAG AAGCTTTTATCTAGTTTTCCCTTTGAAAAGATG GAATTCATGGGCAAGCT ACATAGCACAGGCGCTTAAACTAGT GGATCCAGATGTTTGCAAGGGATATTGGTA GAATTCCGATCCTCAGCTTAGTTTGCGTTT GGATCCACATGTTTCAATCAACTGAAATC GAATTCGATATCAAGCTTTTTAATTGCCTTTT CTCGAGAAGCGGCGGGAAACATG TAAGGGTAAGTTTTCCGTATGTTG ATACTCGAGGAAGAGCCAGTTGCAG CGGGAATTCGATATCAAGCTTGCTTAGTTTGCGTTTAGGAAGCTTGCTT AGTTTGCGTTTAGGAAGCTTTTTAATTGCCTTTTGCAGCTTATCAAT TATCCTTCATTTTCTTAACCAGCTGCTGTT CGACCTGCAGGCATGCAAGCTGTCAATCCCGATTTCAGTTGATT CGAGCTCGAATTCACTGGCCGTCGGGCACAGGCCGTTCTTTAGAAGTG GCTTGATAATGTAAGGCAGCGTAATG CACTGATTGAAAACCCGGTTATAGATG CGGCATATACAGAAAAGATGATAGG CGACCTGCAGGCATGCAAGCTCCGAGGTCAATACCAATATCCC CGAGCTCGAATTCACTGGCCGTCGTCATGCTTGATAATATGGACA ATACCCATTTCCAGTGACGAGCTGCA CGACGGCCAGTGAATTCGAGCTCGCCCTTTAGTAACGTGTAACTTTCC restriction endonuclease sites are underlined 21

23 4. Legends for Supplementary Movies Movie S1. GFP fusions to MreB isoforms localize to circumferentially moving patches. Cells of strains 3723, 2523 and 2566J, ectopically expressing xyloseinducible GFP-MreB, GFP-Mbl and GFP-MreBH respectively as only copy of the corresponding mreb isoform in the cell were grown to mid-exponential phase in LBM supplemented with 0.5% xylose and imaged by TIRFM. Scale bar: 1µm. Time indicated on bottom right. Movie S2. GFP fusions to MreC and MreD localize to circumferentially moving patches. GFP-MreC and GFP-MreD fusions were expressed from the xyloseinducible promoter at the respective endogenous locus (strains 3416 and 3417 respectively). Scale bar: 1µm. Time indicated on bottom right. Movie S3. GFP fusions to PbpH, PBP2a and RodA localize to circumferentially moving patches (strains 3140, DP147 and 4736 respectively). Scale bar: 1µm. Time indicated on bottom right. Movie S4. Fission, fusion and reversal of GFP-Mbl patches. GFP-Mbl is expressed from the xylose-inducible promoter at the amye locus in cells deleted for the endogenous mreb and mbl isoforms (strain RWSB10). Overlay of images taken by TIRFM (red), epifluorescence (green) and LED (blue, indicates cell outline). Time indicated on bottom right. Movie S5. Reversible arrest of Mbl patches mobility upon vancomycin treatment. Movies of a single cell expressing the GFP-Mbl fusion (strain 2523) before (-8 min), after treatment with 100 µg/ml Vancomycin (0 min) and at different time points after washout of the drug (5 and 10 min). Time indicated on bottom right. Movie S6. Treatment of GFP-Mbl expressing cells (strain 2523) with 100 µg/ml lysozyme first leads to partial (left) and then to complete stop (middle) of patch motility. Many cells also show diffuse motion of GFP signal no longer associated 22

24 with the membrane (right). Time indicated on bottom left. Cell outlines indicated by white lines. Movie S7. Movement of a GFP-Mbl patch (asterisk) along the cell axis. Cells of strain RWSB10 were grown to mid-exponential phase in LBM in the presence of 0.5% xylose. In this strain, GFP-Mbl is expressed from a xylose-inducible promoter at the amye locus in cells deleted for the endogenous mreb and mbl isoforms. Overlay of images taken by TIRFM (red), epifluorescence (green) and LED (blue, indicates cell outline). Time indicated on bottom right. 23

25 References and Notes 1. J. V. Höltje, Microbiol. Mol. Biol. Rev. 62, 181 (Mar, 1998). 2. R. Carballido-López, Microbiol. Mol. Biol. Rev. 70, 888 (Dec, 2006). 3. R. Carballido-López, A. Formstone, Curr. Opin. Microbiol. 10, 611 (Dec, 2007). 4. W. Margolin, Curr. Biol. 19, R812 (Sep 15, 2009). 5. R. A. Daniel, J. Errington, Cell 113, 767 (Jun 13, 2003). 6. A. V. Divakaruni, C. Baida, C. L. White, J. W. Gober, Mol. Microbiol. 66, 174 (Oct, 2007). 7. H. J. Yu, A. H. Crevenna, M. Bettenbuehl, T. Freisinger, R. Wedlich-Söldner, Journal of Cell Science (2011). 8. T. C. Fleming et al., Genes Dev. 24, 1160 (Jun 1, 2010). 9. M. T. Cabeen, C. Jacobs-Wagner, Annu. Rev. Genet. 44, 365 (2010). 10. Materials and methods are available as supporting material on Science Online. 11. H. J. Defeu Soufo, P. L. Graumann, EMBO Rep. 5, 789 (Aug, 2004). 12. R. Carballido-López et al., Dev. Cell 11, 399 (Sep, 2006). 13. H. J. Defeu Soufo, P. L. Graumann, Mol. Microbiol. 62, 1340 (Dec, 2006). 14. C. L. White, A. Kitich, J. W. Gober, Mol. Microbiol. 76, 616 (May, 2010). 15. D. Claessen et al., Mol. Microbiol. 68, 1029 (May, 2008). 16. D. J. Scheffers, L. J. Jones, J. Errington, Mol. Microbiol. 51, 749 (Feb, 2004). 17. Y. Wei, T. Havasy, D. C. McPherson, D. L. Popham, J. Bacteriol 185, 4717 (Aug, 2003). 18. A. O. Henriques, P. Glaser, P. J. Piggot, C. P. Moran, Jr., Mol. Microbiol. 28, 235 (Apr, 1998). 19. S. Y. Kim, Z. Gitai, A. Kinkhabwala, L. Shapiro, W. E. Moerner, Proc. Natl. Acad. Sci. USA 103, (Jul 18, 2006). 20. R. Carballido-López, J. Errington, Dev. Cell 4, 19 (2003). 21. D. Kahne, C. Leimkuhler, W. Lu, C. Walsh, Chem. Rev. 105, 425 (Feb, 2005). 22. E. D. Brown, E. I. Vivas, C. T. Walsh, R. Kolter, J. Bacteriol. 177, 4194 (Jul, 1995). 23. T. Murray, D. L. Popham, P. Setlow, J. Bacteriol. 179, 3021 (May, 1997). 24. T. Uehara, J. T. Park, J. Bacteriol. 190, 3914 (Jun, 2008). 25. D. Barrett et al., J. Biol. Chem. 282, (Nov 2, 2007).

26 26. A. R. Paredez, C. R. Somerville, D. W. Ehrhardt, Science 312, 1491 (Jun 9, 2006). 27. A. L. Marston, J. Errington, Mol Cell 4, 673 (Nov, 1999). 28. C. D. Ellermeier, R. Losick, Genes Dev 20, 1911 (Jul 15, 2006). 29. M. Fischer, I. Haase, S. Wiesner, A. Muller Taubenberger, FEBS Lett 580, 2495 (May 1, 2006). 30. P. J. Lewis, A. L. Marston, Gene 227, 101 (Feb 4, 1999). 31. L. J. Jones, R. Carballido López, J. Errington, Cell 104, 913 (Mar 23, 2001). 32. F. O. Bendezu, C. A. Hale, T. G. Bernhardt, P. A. de Boer, Embo J 28, 193 (Feb 4, 2009). 33. Z. Gitai, N. Dye, L. Shapiro, Proc Natl Acad Sci U S A 101, 8643 (Jun 8, 2004). 34. P. Glaser et al., Genes Dev 11, 1160 (May 1, 1997). 35. K. Schirner, J. Errington, J Bacteriol 191, 1404 (Mar, 2009). 36. A. Formstone, J. Errington, Mol Microbiol 55, 1646 (Mar, 2005). 37. M. Leaver, J. Errington, Mol Microbiol 57, 1196 (Sep, 2005).

Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.

Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study