"Omics" - Experimental Approachs 11/18/05
|
|
|
- Claud Griffin Allison
- 5 years ago
- Views:
Transcription
1 "Omics" - Experimental Approachs Bioinformatics Seminars "Omics" Experimental Approaches Nov 18 Fri 12:10 BCB Seminar in E164 Lago Using P-Values for the Planning and Analysis of Microarray Experiments Dan Nettleton, Stat 1 2 Mon Wed Protein Structure Prediction Genome Analysis Protein 3' structure prediction Genome analysis & genome projects Comparative genomics; ENCODE, SNPs, HapMaps, medical genomics Thur Lab Protein structure prediction, SNPs Mount Bioinformatics Reading Assignment (Fri & after break) Chp 13 Microarray Analysis Ck Errata: Fri Experimental approaches: microarrays, proteomics, metabolomics, medical genomics 3 4 BCB 544 Additional Readings Required: Human HapMap (Nature 437, Oct 27, 2005) Commentary (437:1233) News & Views (437: 1241) Optional: Article (437:1299) A haplotype map of the human genome The International HapMap Consortium Review last lecture & New: Genomics 5 6 D Dobbs ISU - BCB 444/544X 1
2 "Omics" - Experimental Approachs Genomics - for excellent overview lectures, see these posted by NHGRI & Pevsner: 1- Genomic sequencing Mapping and Sequencing CTGA2005Lecture1.pdf Eric Green, NHGRI 2- Human genome project The Human Genome _ch17.pdf Jonathan Pevsner, Kennedy Krieger Institute 3- SNPs Studying Genetic Variation II: Computational Techniques Jim Mullikin, NHGRI CTGA2005Lecture13.pdf 4- Comparative Genomics Comparative Sequence Analysis Elliott Margulies, NHGRI CTGA2005Lecture8.pdf 1- Genomic sequencing Many thanks to: Eric Green, NHGRI for the following slides extracted from his lecture on: Mapping and Sequencing CTGA2005Lecture1.pdf 7 8 Genomic Sequencing - Brief Review Comparison of Sequenced Genome Sizes 9 10 Comparison of Genetic & Physical Maps STSs: Provide common markers for "linking" genetic & physical maps D Dobbs ISU - BCB 444/544X 2
3 "Omics" - Experimental Approachs With complete genomes (now), why bother to generate physical maps? Genomic sequencing requires assembly of sequences obtained from DNA cloned in vectors Advances in DNA Sequencing Technology Sequencing Method #1: Gilbert-Maxim "Chemical Degradation" Sequencing Method #2: Sanger "Di-deoxy Chain Termination" Automated Sequencing for Genome Projects: Sanger method - with improvements 17 Another recent improvement: rapid & high resolution separation of fragments in capillaries instead of gels (E Yeung,Ames Lab, ISU) 18 D Dobbs ISU - BCB 444/544X 3
4 "Omics" - Experimental Approachs Human Genome Sequencing "Hierarchical" BAC-by-BAC Shotgun Sequencing Two approaches: Public (government) - International Consortium (6 countries, NIH-funded in US) "Hierarchical" cloning & BAC-by-BAC sequencing Map-based assembly Private (industry) - Celera (Craig Ventner) Whole genome random "shotgun" sequencing Computational assembly (took advantage of public maps & sequences,too) Guess which human genome they sequenced? Craig's Whole-Genome "Shotgun" Sequencing "Hierarchical" Subcloning Strategy "Shotgun" Sequencing Stategy Computational Assembly of Shotgun Sequences D Dobbs ISU - BCB 444/544X 4
5 "Omics" - Experimental Approachs Either Strategy: Sequence "Finishing" = Hard!! 1st Eukaryotic Genome Sequence: S. cerevisiae 25 1st Animal Genome Sequence: C. elegans st Draft Human Genome - "Finished" in Public Sequencing - International Consortium Timetable for Human Genome Sequencing: Faster than expected! D Dobbs ISU - BCB 444/544X
6 "Omics" - Experimental Approachs "Finishing" the Human Genome - continues "Complete" Human Genome Sequence - What next? Interpreting the Human Genome Sequence Comparative Genomics: now with entire genomic sequences Comparing Genomes: Functional Elements ENCODE Project D Dobbs ISU - BCB 444/544X 6
7 "Omics" - Experimental Approachs ENCODE - Web Sites Eric Green's Genomic Sequencing Challenges (2005 List) Human Genome Project Many thanks to: Jonathan Pevsner Kennedy Krieger Institute for the following slides extracted from his lecture on: The Human Genome _ch17.pdf Human Genome Sequence - Where is it? D Dobbs ISU - BCB 444/544X 7
8 "Omics" - Experimental Approachs D Dobbs ISU - BCB 444/544X 8
9 "Omics" - Experimental Approachs The Human Genome - 3 Major Access Sites: 3- SNPs Many thanks to: Jim Mullikin, NHGRI for the following slides extracted from his lecture on: Studying Genetic Variation II: Computational Techniques CTGA2005Lecture13.pdf SNPs: Single Nucleotide Polymorphisms D Dobbs ISU - BCB 444/544X 9
10 "Omics" - Experimental Approachs SNPs: Single Nucleotide Polymorphisms SNP Discovery Methods SNPs - from EST Mining SNPs: from Clone Overlap The SNP Consortium (TSC) Haplotype Map (HapMap) Project D Dobbs ISU - BCB 444/544X 10
11 "Omics" - Experimental Approachs SNPs: from Targeted Resequencing Using PolyPhred to Visualize SNPs SNPs: from Sequencing Chips "SNP Chips": an example SNPs: How are they distributed? SNPs: How are they distributed? D Dobbs ISU - BCB 444/544X 11
12 "Omics" - Experimental Approachs SNPs: Where are they stored? SNPs: Access via 3 Major Genome Browsers Haplotype - What is it? Haplotypes: an example Hapmap Project HapMap Project Goals D Dobbs ISU - BCB 444/544X 12
13 "Omics" - Experimental Approachs Significance of SNP Analyses 4- Comparative Genomics Many thanks to: Elliott Margulies, NHGRI for the following slides extracted from his lecture on: Comparative Sequence Analysis CTGA2005Lecture8.pdf Comparative Genomics Comparative genomics provides important clues re: biological function Many different terms are used to describe different types of conserved sequences D Dobbs ISU - BCB 444/544X 13
14 "Omics" - Experimental Approachs Sequence Comparisons via Alignments Visualization Tools for Comparative Genomics 79 Two major tools: 81 Comparing multiple species with zpicture 82 What have we learned from comparative genomics? An example 80 Best of both tools: D Dobbs ISU - BCB 444/544X
15 "Omics" - Experimental Approachs New topic today: Microarrays, proteomics, metabolomics & medical genomics: Experimental approaches "Omics" - for excellent overview lectures, see these posted by NHGRI & Pevsner: 1- Gene expression analysis Gene Expression _Chp6.pdf Jonathan Pevsner, Kennedy Krieger Institute 2- Microarrays Microarray Analysis (& more) CTGA2005Lecture14.pdf Paul Meltzer, NHGRI 3- Proteomics Proteins and Proteomics _Chp8.pdf Jonathan Pevsner, Kennedy Krieger Institute Servers: Resources for Genomics & Gene Expression Analysis NCBI (National Center for Biolotechnology Information) Genomics: Genomic Biology, COG,HomoloGene, Genetic Analysis Software Microarrays: GEO (Gene Expression Omnibus) ExPASy (Expert Protein Analysis System) Microarrays: GOCluster Proteomics: Proteomics Server URLs for Resources: ISU Resources & Experts Facilities: Biotech - Instrumentation Facilities CIAG - Center for Integrated Animal Genomics PSI - Plant Sciences Institute PSI Centers Faculty: BCB - Bioinformatics & Computational Biology Baker Center - for Bioinformatics & Biological Statistics CIAG - Center for Integrated Animal Genomics CILD - Computational Intelligence, Learning & Discovery ISU Resources & Experts Genomic sequencing & comparative genomics Facilities: Biotech DNA Facility - Polking Carver Co-lab - Schnable Experiments: Microbial: Minion, others Plant: Schnable, Bogdonave, others Animal: Rothschild, Tuggle, Reecy, others Analysis: Huang, Chou, Brendel, Proulx, Gu ISU Resources & Experts Microarrays Facilities: Carver Co-lab - Schnable Experiments: Microbial: Beattie, Beetham, others Plant: Schnable, Bogdonave, Wise, many others Animal: Rothschild, Tuggle, many others Analysis: Nettleton, Honavar, Gu, Proulx D Dobbs ISU - BCB 444/544X 15
16 "Omics" - Experimental Approachs ISU Resources & Experts Proteomics Facilities: Biotech Protein Facility - Tabbatabai Carver Co-lab Proteomics Facility - Lewis Experiments: Microbial:? (not sure!) Plant: Rodermel, Voytas, others? Animal: Greenlee, others? Analysis: Honavar, Dobbs ISU Resources & Experts Metabolomics Facilities: Keck Metabolomics Facility - Nikolau Ames Lab - Yeung, others Experiments: Wurtele, Nikolau, Yeung Analysis: Dickerson, Shanks ISU Resources & Experts Medical genomics ISU Resources & Experts Other "Omics:" Hmmm - not a lot at ISU (yet) But, see: Ellinwood in Animal Science "Glycomics" - Carbohydrate modifications: Facilities, Experiments, Analysis: Pohl Overview of Experimental Methods 1- Gene expression analysis Gene Expression _Chp6.pdf Jonathan Pevsner, Kennedy Krieger Institute 2- Microarrays Microarray Analysis (& more) CTGA2005Lecture14.pdf Paul Meltzer, NHGRI 3- Proteomics Proteins and Proteomics _Chp8.pdf Jonathan Pevsner, Kennedy Krieger Institute 95 D Dobbs ISU - BCB 444/544X 16
#33 - Genomics 11/09/07
BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33
Chapter 18 Active Reading Guide Genomes and Their Evolution
Name: AP Biology Mr. Croft Chapter 18 Active Reading Guide Genomes and Their Evolution Most AP Biology teachers think this chapter involves an advanced topic. The questions posed here will help you understand
Bioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
CMPS 6630: Introduction to Computational Biology and Bioinformatics. Sequence Assembly
CMPS 6630: Introduction to Computational Biology and Bioinformatics Sequence Assembly Why Genome Sequencing? Sanger (1982) introduced chaintermination sequencing. Main idea: Obtain fragments of all possible
Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
What is Systems Biology
What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the
Whole Genome Alignments and Synteny Maps
Whole Genome Alignments and Synteny Maps IINTRODUCTION It was not until closely related organism genomes have been sequenced that people start to think about aligning genomes and chromosomes instead of
Genome Sequencing & DNA Sequence Analysis
7.91 / 7.36 / BE.490 Lecture #1 Feb. 24, 2004 Genome Sequencing & DNA Sequence Analysis Chris Burge What is a Genome? A genome is NOT a bag of proteins What s in the Human Genome? Outline of Unit II: DNA/RNA
D Dobbs ISU - BCB 444/544X 1
11/7/05 Protein Structure: Classification, Databases, Visualization Announcements BCB 544 Projects - Important Dates: Nov 2 Wed noon - Project proposals due to David/Drena Nov 4 Fri PM - Approvals/responses
Microbiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
BIOLOGY 146 Course Layout
BIOLOGY 146 Course Layout For BSc (EDP) Students Presented by the Department of Botany & Zoology 2 nd Semester, 16 Credits Instructor Information Course Coordinator and Lecturer: Dr. Marnel Mouton Teaching
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
Small RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
CS612 - Algorithms in Bioinformatics
Fall 2017 Databases and Protein Structure Representation October 2, 2017 Molecular Biology as Information Science > 12, 000 genomes sequenced, mostly bacterial (2013) > 5x10 6 unique sequences available
CHAPTER 1 Life: Biological Principles and the Science of Zoology
CHAPTER 1 Life: Biological Principles and the Science of Zoology 1-1 Zoology: The Uses of Principles The scientific study of animal life Does Life Have Defining Properties? No simple definition The history
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
BCB 444/544 Fall 07 Dobbs 1
BCB 444/544 Lecture 21 Protein Structure Visualization, Classification & Comparison Secondary Structure #21_Oct10 Required Reading (before lecture) Mon Oct 8 - Lecture 20 Protein Secondary Structure Chp
MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.
Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
Bioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
BIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
Welcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
Phylogenetic Trees. What They Are Why We Do It & How To Do It. Presented by Amy Harris Dr Brad Morantz
Phylogenetic Trees What They Are Why We Do It & How To Do It Presented by Amy Harris Dr Brad Morantz Overview What is a phylogenetic tree Why do we do it How do we do it Methods and programs Parallels
Protein Structure Prediction 11/11/05
11/11/05 Protein Structure Prediction & Modeling Bioinformatics Seminars Nov 11 Fri 12:10 BCB Seminar in E164 Lago Building Supertrees Using Distances Steve Willson, Dept of Mathematics http://www.bcb.iastate.edu/courses/bcb691-f2005.html
Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
Computational Systems Biology
Computational Systems Biology Vasant Honavar Artificial Intelligence Research Laboratory Bioinformatics and Computational Biology Graduate Program Center for Computational Intelligence, Learning, & Discovery
Pyrobayes: an improved base caller for SNP discovery in pyrosequences
Pyrobayes: an improved base caller for SNP discovery in pyrosequences Aaron R Quinlan, Donald A Stewart, Michael P Strömberg & Gábor T Marth Supplementary figures and text: Supplementary Figure 1. The
CGS 5991 (2 Credits) Bioinformatics Tools
CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue
October 08-11, Co-Organizer Dr. S D Samantaray Professor & Head,
A Journey towards Systems system Biology biology :: Biocomputing of of Hi-throughput Omics omics Data data October 08-11, 2018 Coordinator Dr. Anil Kumar Gaur Professor & Head Department of Molecular Biology
Algorithmics and Bioinformatics
Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32
Proteomics Systems Biology
Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular
Support Vector Machines (SVM) in bioinformatics. Day 1: Introduction to SVM
1 Support Vector Machines (SVM) in bioinformatics Day 1: Introduction to SVM Jean-Philippe Vert Bioinformatics Center, Kyoto University, Japan Jean-Philippe.Vert@mines.org Human Genome Center, University
Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
Bayesian Clustering of Multi-Omics
Bayesian Clustering of Multi-Omics for Cardiovascular Diseases Nils Strelow 22./23.01.2019 Final Presentation Trends in Bioinformatics WS18/19 Recap Intermediate presentation Precision Medicine Multi-Omics
OMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
SCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
Mathangi Thiagarajan Rice Genome Annotation Workshop May 23rd, 2007
-2 Transcript Alignment Assembly and Automated Gene Structure Improvements Using PASA-2 Mathangi Thiagarajan mathangi@jcvi.org Rice Genome Annotation Workshop May 23rd, 2007 About PASA PASA is an open
Course Descriptions Biology
Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,
CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
Bundle at a Glance Biology 2015/16
Introduction: Scientific Investigation and Reasoning Skills (3 A/B days) Biology Process TEKS: 1A demonstrate safe practices during laboratory and field investigations. 1B demonstrate an understanding
Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18
Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18 1. Programme title(s) and UCAS code(s): BSc Biological Sciences C100 BSc Biological Sciences (Biochemistry) C700 BSc Biological
1. CHEMISTRY OF LIFE. Tutorial Outline
Tutorial Outline North Carolina Tutorials are designed specifically for the Common Core State Standards for English language arts, the North Carolina Standard Course of Study for Math, and the North Carolina
Bioinformatics Practical for Biochemists
Bioinformatics Practical for Biochemists Andrei Lupas, Birte Höcker, Steffen Schmidt WS 2012/2013 01. DNA & Genomics 1 Description Lectures about general topics in Bioinformatics & History Tutorials will
Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following
Name: Score: / Quiz 2 on Lectures 3 &4 Part 1 Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following foods is not a significant source of
EBI web resources II: Ensembl and InterPro. Yanbin Yin Spring 2013
EBI web resources II: Ensembl and InterPro Yanbin Yin Spring 2013 1 Outline Intro to genome annotation Protein family/domain databases InterPro, Pfam, Superfamily etc. Genome browser Ensembl Hands on Practice
Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
Reducing storage requirements for biological sequence comparison
Bioinformatics Advance Access published July 15, 2004 Bioinfor matics Oxford University Press 2004; all rights reserved. Reducing storage requirements for biological sequence comparison Michael Roberts,
Decoding heterogeneous big data in an integrative way
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations 2013 Decoding heterogeneous big data in an integrative way XIA ZHANG Iowa State University Follow this and additional
APPENDIX II. Laboratory Techniques in AEM. Microbial Ecology & Metabolism Principles of Toxicology. Microbial Physiology and Genetics II
APPENDIX II Applied and Environmental Microbiology (Non-Thesis) A. Discipline Specific Requirement Biol 6484 Laboratory Techniques in AEM B. Additional Course Requirements (8 hours) Biol 6438 Biol 6458
Sequencing alignment Ameer Effat M. Elfarash
Sequencing alignment Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg Why perform a multiple sequence alignment? MSAs are at the heart of comparative genomics
Networks & pathways. Hedi Peterson MTAT Bioinformatics
Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
Algorithms in Computational Biology (236522) spring 2008 Lecture #1
Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: 15:30-16:30/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office hours:??
What can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
ALL LECTURES IN SB Introduction
1. Introduction 2. Molecular Architecture I 3. Molecular Architecture II 4. Molecular Simulation I 5. Molecular Simulation II 6. Bioinformatics I 7. Bioinformatics II 8. Prediction I 9. Prediction II ALL
Curriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
Computational Biology From The Perspective Of A Physical Scientist
Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)
Network Biology-part II
Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New
Contra Costa College Course Outline
Contra Costa College Course Outline Department & Number: BIOSC 110 Course Title: Introduction to Biological Science Pre-requisite: None Corequisite: None Advisory: None Entry Skill: None Lecture Hours:
Introduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
Variant visualisation and quality control
Variant visualisation and quality control You really should be making plots! 25/06/14 Paul Theodor Pyl 1 Classical Sequencing Example DNA.BAM.VCF Aligner Variant Caller A single sample sequencing run 25/06/14
Computational Structural Bioinformatics
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
Biology Assessment. Eligible Texas Essential Knowledge and Skills
Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules
Data Mining in Bioinformatics HMM
Data Mining in Bioinformatics HMM Microarray Problem: Major Objective n Major Objective: Discover a comprehensive theory of life s organization at the molecular level 2 1 Data Mining in Bioinformatics
Lecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the sequence of amino acids in a protein?
Lecture 5 (FW) February 4, 2009 Translation, trna adaptors, and the code Reading.Chapters 8 and 9 Lecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the
Course plan Academic Year Qualification MSc on Bioinformatics for Health Sciences. Subject name: Computational Systems Biology Code: 30180
Course plan 201-201 Academic Year Qualification MSc on Bioinformatics for Health Sciences 1. Description of the subject Subject name: Code: 30180 Total credits: 5 Workload: 125 hours Year: 1st Term: 3
STAAR Biology Assessment
STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of
BIO 181 GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package
GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package COURSE INFORMATION Is this a new course or a proposed modification to an existing course? Please check the appropriate box.
Bioinformatics. Genotype -> Phenotype DNA. Jason H. Moore, Ph.D. GECCO 2007 Tutorial / Bioinformatics.
Bioinformatics Jason H. Moore, Ph.D. Frank Lane Research Scholar in Computational Genetics Associate Professor of Genetics Adjunct Associate Professor of Biological Sciences Adjunct Associate Professor
Mole_Oce Lecture # 24: Introduction to genomics
Mole_Oce Lecture # 24: Introduction to genomics DEFINITION: Genomics: the study of genomes or he study of genes and their function. Genomics (1980s):The systematic generation of information about genes
CHEM 121: Chemical Biology
Instructors Prof. Jane M. Liu (HS-212) jliu3@drew.edu x3303 Office Hours Anytime my office door is open CHEM 121: Chemical Biology Class MF 2:30-3:45 pm PRE-REQUISITES: CHEM 117 COURSE OVERVIEW This upper-level
Undergraduate Curriculum in Biology
Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles
Genom, transkriptom in proteom
Genom, transkriptom in proteom The conceptual relationship of the genome, transcriptome, proteome and metabolome Fenotipi/Phenotypes Morphological phenotypes are fixed in distinct dog breeds. Fizikalna
The Contribution of Bioinformatics to Evolutionary Thought
The Contribution of Bioinformatics to Evolutionary Thought A demonstration of the abilities of Entrez, BLAST, and UCSC s Genome Browser to provide information about common ancestry. American Scientific
Introduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple
Bioinformatics and BLAST
Bioinformatics and BLAST Overview Recap of last time Similarity discussion Algorithms: Needleman-Wunsch Smith-Waterman BLAST Implementation issues and current research Recap from Last Time Genome consists
MULTIPLE SEQUENCE ALIGNMENT FOR CONSTRUCTION OF PHYLOGENETIC TREE
MULTIPLE SEQUENCE ALIGNMENT FOR CONSTRUCTION OF PHYLOGENETIC TREE Manmeet Kaur 1, Navneet Kaur Bawa 2 1 M-tech research scholar (CSE Dept) ACET, Manawala,Asr 2 Associate Professor (CSE Dept) ACET, Manawala,Asr
Clustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
Bioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
week: 4 Date: Microscopes Cell Structure Cell Function Standards None 1b, 1h 1b, 1h, 4f, 5a 1a, 1c, 1d, 1e, 1g, 1j
July, 2004 week: 1 Topics Course introduction Lab Safety week: 2 Introduction to chemistry Chapter summarizing Note Taking week: 3 Biochemistry: Compounds of life week: 4 Microscopes Cell Structure Cell
Yifei Bao. Beatrix. Manor Askenazi
Detection and Correction of Interference in MS1 Quantitation of Peptides Using their Isotope Distributions Yifei Bao Department of Computer Science Stevens Institute of Technology Beatrix Ueberheide Department
Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
Cluster Analysis of Gene Expression Microarray Data. BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002
Cluster Analysis of Gene Expression Microarray Data BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002 1 Data representations Data are relative measurements log 2 ( red
STRUCTURAL BIOINFORMATICS I. Fall 2015
STRUCTURAL BIOINFORMATICS I Fall 2015 Info Course Number - Classification: Biology 5411 Class Schedule: Monday 5:30-7:50 PM, SERC Room 456 (4 th floor) Instructors: Vincenzo Carnevale - SERC, Room 704C;
Molecular and Cellular Biology
You Do Not Need to write down the following infos because all the following slides and all lecture notes will be uploaded at the link: http://itbe.hanyang.ac.kr This/today s file will be uploaded next
Advanced Cell Biology. Lecture 1
Advanced Cell Biology. Lecture 1 Alexey Shipunov Minot State University January 9, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 1 January 9, 2013 1 / 27 Outline Course in general Description Grading
Life Sciences 1a: Section 3B. The cell division cycle Objectives Understand the challenges to producing genetically identical daughter cells
Life Sciences 1a: Section 3B. The cell division cycle Objectives Understand the challenges to producing genetically identical daughter cells Understand how a simple biochemical oscillator can drive the
Bioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
Computational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
G4120: Introduction to Computational Biology
ICB Fall 2009 G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology & Immunology Copyright 2008 Oliver Jovanovic, All Rights Reserved. Genome
Washtenaw Community College Comprehensive Report. BIO 103 General Biology II Proposed Start Semester: Spring/Summer 2011
Page 1 of 7 Washtenaw Community College Comprehensive Report BIO 103 General Biology II Proposed Start Semester: Spring/Summer 2011 Course Cover Division: Math, Natural and Behavioral Sciences Department:
Protein Structure Analysis and Verification. Course S Basics for Biosystems of the Cell exercise work. Maija Nevala, BIO, 67485U 16.1.
Protein Structure Analysis and Verification Course S-114.2500 Basics for Biosystems of the Cell exercise work Maija Nevala, BIO, 67485U 16.1.2008 1. Preface When faced with an unknown protein, scientists
Protein Bioinformatics. Rickard Sandberg Dept. of Cell and Molecular Biology Karolinska Institutet sandberg.cmb.ki.
Protein Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology Karolinska Institutet rickard.sandberg@ki.se sandberg.cmb.ki.se Outline Protein features motifs patterns profiles signals 2 Protein
CELL AND MICROBIOLOGY Nadia Iskandarani
7Course Title: Head of Department: Teacher(s) + e-mail: Cycle/Division: Biology IA: CELL AND MICROBIOLOGY Nadia Iskandarani Ms.Ibtessam: ibtissam.h@greenwood.sch.ae High School Grade Level: Grade 10 Credit